ID: 1187181659

View in Genome Browser
Species Human (GRCh38)
Location X:16948022-16948044
Sequence GTGATAAGACTGTTAATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187181658_1187181659 -10 Left 1187181658 X:16948009-16948031 CCAGCACTTCATGGTGATAAGAC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1187181659 X:16948022-16948044 GTGATAAGACTGTTAATATCAGG 0: 1
1: 0
2: 1
3: 8
4: 103
1187181656_1187181659 13 Left 1187181656 X:16947986-16948008 CCTTTGTCTGTCATTTCATGTCA 0: 1
1: 0
2: 0
3: 26
4: 453
Right 1187181659 X:16948022-16948044 GTGATAAGACTGTTAATATCAGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187181659 Original CRISPR GTGATAAGACTGTTAATATC AGG Intronic
901008583 1:6184205-6184227 GTCTTAAGACAGTTGATATCTGG - Intronic
901623417 1:10607714-10607736 GTAAGAAGACTGTTAATAATGGG - Intronic
903934876 1:26888717-26888739 GTGATACGACAGTGAATATTTGG - Intronic
907944864 1:59126361-59126383 GTAATGAGACTTGTAATATCAGG - Intergenic
909150287 1:71994206-71994228 GTGATAAGACATTAAATATGAGG + Intronic
909249671 1:73336188-73336210 GTTAAAAGACTGTTGATATTAGG + Intergenic
923548502 1:234942480-234942502 GTGATAAGAATTTTAAGATGGGG - Intergenic
1062894937 10:1096176-1096198 GAGATCAGACTGCTCATATCTGG + Exonic
1064608534 10:17071636-17071658 GAGATAAAATTATTAATATCTGG - Intronic
1064826667 10:19411067-19411089 ATGAGAAGACTTTAAATATCAGG + Intronic
1069445981 10:68473507-68473529 GTCATAAAGCTGTTGATATCAGG - Intergenic
1071444569 10:85733923-85733945 GTGAAAATCCTGTTAAAATCAGG - Intronic
1079238636 11:18706783-18706805 GAGATAGAACGGTTAATATCTGG - Intronic
1079630153 11:22665181-22665203 GTGACAAGAATATTCATATCTGG + Intronic
1080515816 11:33018886-33018908 GTGATACATCTGTTAATTTCTGG + Intronic
1092548208 12:9469842-9469864 GAGATAACACTGCTAATATTTGG + Intergenic
1092584353 12:9881385-9881407 GATATAAGCTTGTTAATATCTGG - Intergenic
1093689503 12:22094019-22094041 GTGATAAGACTCATAGTACCTGG + Intronic
1094504795 12:31052611-31052633 GAGATAACACTGCTAATATTTGG - Intergenic
1095314733 12:40746188-40746210 GTAGTAAGACTGCTAATATTTGG - Intronic
1096294300 12:50370599-50370621 GTGATACTATTTTTAATATCTGG - Intronic
1098699137 12:73600737-73600759 GTGATAAAAAAGTTAATAACTGG + Intergenic
1099497728 12:83372933-83372955 CCAATAAGACTGTTAATCTCAGG + Intergenic
1102393140 12:112565849-112565871 TTAATAAGACTGACAATATCGGG - Intergenic
1105061461 12:133155168-133155190 GAACTTAGACTGTTAATATCTGG + Intronic
1105362938 13:19737522-19737544 GTAATAAGACAGTTAACATCAGG - Intronic
1105804070 13:23939434-23939456 GTAATAAGTCAGTTAACATCAGG + Intergenic
1107112947 13:36717158-36717180 GTAGTAAGAATGTTAATACCTGG - Intergenic
1107775485 13:43836001-43836023 ATAATAAGATTATTAATATCAGG + Intronic
1113103848 13:106750974-106750996 GTGATTAGACTTATAATAGCAGG - Intergenic
1113154581 13:107304756-107304778 GTGATAAGAATGTCAATTGCTGG + Intronic
1114866633 14:26602278-26602300 ATGAGAAGACTGTTAATAGAAGG + Intergenic
1117165386 14:53027853-53027875 GTGATACGAGTTTTAATCTCTGG - Intergenic
1119204730 14:72785673-72785695 GTGATAAGAAGGTTTATTTCTGG - Intronic
1120361198 14:83505053-83505075 AGGCTAAGACTGTGAATATCAGG + Intergenic
1120629765 14:86875559-86875581 GTGATAAGATTGACAACATCTGG - Intergenic
1125328396 15:38560084-38560106 GAGATAAGACAATTAATCTCAGG + Intronic
1131362305 15:91804022-91804044 GTGAACAGACTGTTAACAACAGG - Intergenic
1134766347 16:16762032-16762054 TTAATAAGACTGTTATTAGCAGG - Intergenic
1134979702 16:18597178-18597200 TTAATAAGACTGTTATTAGCAGG + Intergenic
1138800842 16:60026955-60026977 GAGATAAGATTGATAATATTGGG - Intergenic
1138934575 16:61703253-61703275 CTTATAATACTGTTAATATAGGG + Intronic
1140575527 16:76163696-76163718 GTGATATGATTCTTAGTATCAGG + Intergenic
1155957948 18:31969471-31969493 GTTGTAAGACTGTTAATTTGTGG + Intergenic
1159322413 18:66869576-66869598 GTGATAAGACTTCAAATATGAGG - Intergenic
1164187076 19:22879799-22879821 TTGATATGACTGCTAATAGCTGG - Intergenic
1164191526 19:22922450-22922472 GGCATAAGAATGTTAATATTGGG - Intergenic
1166653595 19:44594053-44594075 GAGATAAGACTGATGCTATCTGG - Intergenic
927625424 2:24712140-24712162 GAGGTAAGACTGTTAATGACTGG - Intronic
930054551 2:47241898-47241920 GTGATAAGACTGTTGCTTTCTGG + Intergenic
935832804 2:107018114-107018136 GTGCTAAGTTTCTTAATATCAGG + Intergenic
939192126 2:138929413-138929435 ATGATAAGGCTCTTACTATCTGG + Intergenic
939804974 2:146764172-146764194 GTGATAAGAATGTTTATAACTGG + Intergenic
940537352 2:154962034-154962056 GACATAAGGCTGATAATATCAGG - Intergenic
941371039 2:164664646-164664668 GTGACAAAACTTTTAATAACAGG + Intronic
942211991 2:173680513-173680535 GTGGTAAGACTGTTAACATTTGG + Intergenic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
946230460 2:218287915-218287937 GTGATCAGAATGGTAATCTCGGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
948558446 2:238834469-238834491 GTGTTAAAACTGATTATATCTGG - Intergenic
1169398886 20:5262427-5262449 GGGAGAACACTGTTAATATCAGG + Intergenic
1171060017 20:21947366-21947388 TTGGTAAGAATATTAATATCTGG - Intergenic
1173168745 20:40705326-40705348 GTGATAGGACTGTTAATATTTGG - Intergenic
1176992088 21:15509146-15509168 TTGATAACACTATTAATTTCTGG - Intergenic
949714787 3:6917342-6917364 GTGATAAAACTTTTCATATAAGG + Intronic
951880393 3:27475666-27475688 GTTATAAGCCTGTTTGTATCTGG - Intronic
952745995 3:36779942-36779964 GTAATAGGTGTGTTAATATCAGG - Intergenic
957818609 3:85338312-85338334 GTGAAAATACTTTTAATAACTGG + Intronic
965495183 3:169389441-169389463 GTGATAAGTCTGTTCTTACCTGG - Intronic
966381709 3:179351135-179351157 GTGATAAGAATGTAAACATCAGG + Intronic
974192167 4:58519560-58519582 ATGATAGCACTGTTAATATCTGG + Intergenic
974602117 4:64096792-64096814 GTTATAAGACTTATGATATCTGG - Intergenic
975487552 4:74950783-74950805 TTGATGAGACTGTTTAAATCAGG + Intronic
977484738 4:97628223-97628245 CTGATAATCCTGCTAATATCAGG - Intronic
978679485 4:111361986-111362008 GTGATAAGCATGTTAAAAACTGG - Intergenic
981214926 4:142152859-142152881 ATGATATGACTGTTAAGGTCAGG + Intronic
982729631 4:158942394-158942416 GTGCAAAGCCTGTTAACATCAGG - Intronic
982772579 4:159411164-159411186 TTGATTAGAATGTTAAGATCTGG + Intergenic
983138148 4:164111325-164111347 GTGATAAGAATCTTATTATTTGG - Intronic
983663412 4:170155246-170155268 GTGATAAGACTGAAAAAATTTGG + Intergenic
992686983 5:79208712-79208734 TTGACAAGGCTGTGAATATCAGG + Intronic
992933238 5:81673140-81673162 GTGATTAGAAAGTAAATATCTGG - Intronic
992960381 5:81952619-81952641 GTGATGAGGCTGTTTAGATCTGG - Intergenic
993819712 5:92599780-92599802 CTGATAATACTCTTAAAATCAGG - Intergenic
1000169258 5:158685714-158685736 TTGATAAGGCTGTCTATATCAGG - Intergenic
1001657988 5:173368449-173368471 ATGGTAAGACTCTTGATATCAGG - Intergenic
1002956969 6:1875562-1875584 GTGATAAGAATATTAAAATCTGG - Intronic
1009049350 6:58259553-58259575 GTGATATTGCTTTTAATATCTGG - Intergenic
1011040355 6:83023268-83023290 GTGATAAGATTCTAGATATCTGG + Intronic
1014684814 6:124483453-124483475 GTGATATAAGTCTTAATATCAGG - Intronic
1019678327 7:2329360-2329382 GTGATAAGACGCTGTATATCTGG - Intronic
1019734561 7:2644395-2644417 GTGCTGGGACTGTTAATATGAGG + Intronic
1021059774 7:16097001-16097023 GTTTTAAGACTGTTAAATTCAGG + Intronic
1021930093 7:25571682-25571704 GTTATAAAAGTGTTAATACCTGG - Intergenic
1026730484 7:72907415-72907437 GCAATAAGACGGTAAATATCTGG - Intronic
1027469025 7:78550542-78550564 GATAGAAGACTGTTAATACCTGG + Intronic
1029118073 7:98248162-98248184 GTGGAAAGACTGTTCCTATCAGG - Intronic
1032302795 7:130704244-130704266 ATGTTAATTCTGTTAATATCAGG + Intergenic
1039126890 8:34213569-34213591 TTGATAAGAGAGTTAATAACAGG + Intergenic
1042657098 8:71111681-71111703 GTGCTAAGACTGGTCATATGGGG + Intergenic
1042680370 8:71376984-71377006 GAGATAAGGATGTTTATATCAGG - Intergenic
1046195879 8:110861773-110861795 GTGATAAAAATGTTTATCTCTGG + Intergenic
1048783669 8:138028085-138028107 GGAATAAAACTGTTGATATCTGG - Intergenic
1050790447 9:9462158-9462180 GTGAGTAGACTTTCAATATCGGG + Intronic
1055318101 9:75054307-75054329 CTGATAATACTGATAATTTCAGG + Intergenic
1055923902 9:81490373-81490395 GTGAGAAGACTCCTGATATCTGG - Intergenic
1057529229 9:95829746-95829768 GTAATAAGCCTGTTAATTTTTGG - Intergenic
1187181659 X:16948022-16948044 GTGATAAGACTGTTAATATCAGG + Intronic
1187335540 X:18378080-18378102 GGGAAAAGACTGACAATATCAGG + Intergenic
1187848577 X:23566844-23566866 GTGGTAAGACTTTCAATTTCTGG - Intergenic
1187921299 X:24204940-24204962 GCCATAAGACTGTAAATTTCTGG + Intronic
1199174833 X:144775113-144775135 GGGATGAGAGTGTTATTATCAGG + Intergenic
1200752075 Y:6955430-6955452 GTAATAAGACTGTGATTATTCGG + Intronic