ID: 1187185941

View in Genome Browser
Species Human (GRCh38)
Location X:16985726-16985748
Sequence GTAGATACCCAGATCAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187185938_1187185941 21 Left 1187185938 X:16985682-16985704 CCTCCTGATGGGCAGACTTGCTT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG 0: 1
1: 0
2: 0
3: 0
4: 61
1187185939_1187185941 18 Left 1187185939 X:16985685-16985707 CCTGATGGGCAGACTTGCTTTCT 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187185941 Original CRISPR GTAGATACCCAGATCAATCA AGG Intronic
905022391 1:34826821-34826843 GGAGATGCTCAGCTCAATCATGG - Intronic
918561646 1:185875820-185875842 GTAGATAACTAGATGACTCAAGG - Intronic
924629056 1:245720168-245720190 CTAGATGACCAGATAAATCATGG - Intergenic
1069346115 10:67471906-67471928 TAAGATACACAGATCAATGATGG + Intronic
1080241073 11:30127895-30127917 GAACAGACCCAGAGCAATCATGG + Intergenic
1080487923 11:32730618-32730640 GAAAATACCCAGATACATCATGG - Intronic
1082645321 11:55716803-55716825 GTAGATACACAGAGGAATGAAGG + Intergenic
1093253765 12:16840552-16840574 ATAGAGAACCAGATCATTCAAGG + Intergenic
1101991498 12:109489342-109489364 CTAGAGACCCAGACCAAGCAAGG - Intronic
1108323798 13:49310391-49310413 GTAGACACACAGATCGCTCAGGG - Exonic
1118424659 14:65647189-65647211 TAAAATACCCAGATCACTCAAGG + Intronic
1119169343 14:72522027-72522049 GTAGCTACACACATAAATCAAGG - Intronic
1125608856 15:40957625-40957647 GGAGACACCCAGACCAATCCAGG - Intergenic
1126280948 15:46948665-46948687 GTAGAGATCCAGAGTAATCAAGG - Intergenic
1128910042 15:71505499-71505521 GTAGACAGCCAAATCAAACAGGG + Intronic
1131206796 15:90456085-90456107 GTACATAAACAAATCAATCATGG - Intronic
1139620009 16:68131625-68131647 GCAGATACCAAGCACAATCAAGG + Intronic
1141990494 16:87606441-87606463 GGAGCTACTCAGCTCAATCAGGG - Intronic
1159573777 18:70150548-70150570 TTAGATACTCAGCTAAATCAAGG - Intronic
1159706177 18:71691648-71691670 GGATATACCCAGGTCTATCATGG - Intergenic
1161348457 19:3779310-3779332 GCAGATTCCAAGATCCATCAAGG - Intronic
1162783394 19:13019029-13019051 GTAGTTACCCAGATCAACATGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168571209 19:57472194-57472216 GCAGAAACCCAGATTAATAAAGG - Exonic
931503667 2:62899732-62899754 AAAGAGACCCAGATAAATCAAGG - Intronic
936398471 2:112148275-112148297 GCAGATACCCCTGTCAATCATGG - Intronic
940393466 2:153160671-153160693 GTAGACATCCAGATAAGTCATGG + Intergenic
944183002 2:196915961-196915983 GCAGAAATCCAGAGCAATCATGG + Intronic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
1169932451 20:10849053-10849075 GGAGATAACCAAAGCAATCAGGG - Intergenic
1174129100 20:48329178-48329200 TCAGATACCCAGCTTAATCAAGG + Intergenic
949649423 3:6138650-6138672 GAAGATTTACAGATCAATCAGGG - Intergenic
952727952 3:36608289-36608311 GTAGGTACACAGACCATTCAGGG - Intergenic
961938224 3:130608965-130608987 GTACATATCAAGACCAATCAGGG + Intronic
970841994 4:20484531-20484553 CTAGAGACCCAGATCATGCATGG - Intronic
974711248 4:65598666-65598688 GAAGATGCCCCAATCAATCAAGG - Intronic
976711425 4:88075548-88075570 GCAGCTTCCCAGATCAGTCATGG + Exonic
980773294 4:137406335-137406357 GTAACTAATCAGATCAATCAAGG + Intergenic
981628538 4:146790044-146790066 GAAGATATCCAGATAAAGCAAGG - Intronic
984604840 4:181773268-181773290 GTAGAGACCAAAATCAGTCATGG + Intergenic
989389646 5:40886706-40886728 GTAGATGACCAGTTCAGTCATGG + Intergenic
993815264 5:92536487-92536509 GTAGAGATTCAGAACAATCATGG - Intergenic
994385233 5:99123086-99123108 GTTGATACCCAGATCAACTTTGG - Intergenic
997865118 5:137455219-137455241 GAATAGACCCAGATCCATCAAGG - Intronic
1015066554 6:129036418-129036440 GTAGATACCCAAATAAAAGAAGG - Intronic
1017739792 6:157396891-157396913 GTAGTTTCCCAGCTCAATAAAGG - Intronic
1023893097 7:44407859-44407881 GTAGAAACACAGATCAATTCAGG + Intronic
1024262646 7:47583411-47583433 ATAAATACCCAGATCAGTCTGGG - Intergenic
1033552475 7:142460017-142460039 GTAGAATCCCTGATCACTCAAGG - Intergenic
1037086325 8:14855357-14855379 CTTGATACCCAGATCAAGAATGG - Intronic
1039104638 8:33976828-33976850 GTAGATATCCAATTCAATCCAGG - Intergenic
1042588412 8:70369347-70369369 TTAGAAAGCCAGATTAATCAGGG - Intronic
1044554331 8:93545805-93545827 GTAGTTACCAAGCTCAGTCAGGG + Intergenic
1047553033 8:125897379-125897401 TTAGCTACCAAGATCAATGAGGG - Intergenic
1053420356 9:37973710-37973732 GGAGATACCCAAGTCACTCAAGG + Intronic
1059558271 9:115304858-115304880 GGAAATTCCCAGATGAATCAAGG + Intronic
1185516358 X:701858-701880 GTAGCTACCCGGCTCAACCATGG + Intergenic
1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG + Intronic
1192113560 X:68389751-68389773 GCAGAAACCCAGATCTCTCAGGG - Intronic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1198983088 X:142421780-142421802 GGAGATACCCAGAAAAAGCATGG - Intergenic