ID: 1187189940

View in Genome Browser
Species Human (GRCh38)
Location X:17024726-17024748
Sequence GAGAGATCACAATTGGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187189935_1187189940 22 Left 1187189935 X:17024681-17024703 CCAGGAAATAAATTTATTAATGA 0: 1
1: 0
2: 2
3: 56
4: 659
Right 1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187189940 Original CRISPR GAGAGATCACAATTGGGAGC GGG Intronic
901840837 1:11952929-11952951 GTGAGATCACAGTTGGGTTCTGG + Intronic
902663961 1:17924563-17924585 GAGAGACGACACTTGGGACCAGG + Intergenic
917294787 1:173507260-173507282 GAGAGCTCACAATTTAGGGCTGG - Intronic
918632781 1:186738558-186738580 GAGAGAAGAGAATTAGGAGCAGG - Intergenic
923879703 1:238090230-238090252 CAGAGATCATAAAAGGGAGCTGG - Intergenic
924368108 1:243318386-243318408 AAGAGATCACTATTGGGTACTGG + Intronic
1064888202 10:20136576-20136598 GAGAGATCACGATGAGGAGGTGG + Intronic
1067012696 10:42729245-42729267 GGGAGATCACAAAACGGAGCAGG + Intergenic
1069211854 10:65771652-65771674 GAGAGATCAGAGTTGGTGGCAGG + Intergenic
1073165603 10:101446907-101446929 CAGAGAGCACAATAGGGAGAAGG + Intronic
1073834195 10:107422024-107422046 GAGAGATCCCATTTTGGAGTAGG + Intergenic
1075195005 10:120348671-120348693 TAGAGATGTCAACTGGGAGCTGG - Intergenic
1075494541 10:122908608-122908630 GAGAGATGAAAATAGGGAGAAGG - Intergenic
1077142019 11:1028943-1028965 GAGAGATCACAATTTTGTCCTGG + Exonic
1078062039 11:8054472-8054494 GAGAGAGCACAAGTGGGAGTAGG + Intronic
1078067709 11:8089201-8089223 GTGAGATCCCAGTAGGGAGCTGG + Intronic
1079789459 11:24717709-24717731 AAGAGATAACTATTGGGGGCCGG - Intronic
1080833649 11:35919516-35919538 GAGAGATCTCCATTGGGTGGAGG + Intergenic
1081842369 11:46211905-46211927 GAGAGGTGAGATTTGGGAGCAGG + Intergenic
1082251086 11:49980914-49980936 AAGGGAACACATTTGGGAGCTGG - Intergenic
1083667440 11:64283595-64283617 GAAAGAACACATCTGGGAGCTGG + Intronic
1083711264 11:64550448-64550470 GAAAGATAACTATTGGGCGCTGG - Intergenic
1085332504 11:75665878-75665900 GAGAGATGCCAAGTGGGAGGTGG + Intronic
1090340085 11:126010094-126010116 GAAAGCTCTCATTTGGGAGCAGG - Intronic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1091189350 11:133677534-133677556 CAGAGATCACATTTCAGAGCTGG - Intergenic
1092173119 12:6385425-6385447 CAGGGATCTCAAGTGGGAGCAGG + Intronic
1092580849 12:9839210-9839232 GAGAGATTACAATGAGAAGCTGG - Intronic
1093090618 12:14916052-14916074 AAAAGATCACAATTTGGTGCTGG + Intronic
1093309235 12:17559010-17559032 GAGAGATATCAATTGGTTGCAGG - Intergenic
1097174569 12:57135421-57135443 GAGAGAGCTGAGTTGGGAGCGGG - Intronic
1097234619 12:57530672-57530694 AAGTGAGCACATTTGGGAGCTGG - Exonic
1101489879 12:105200649-105200671 GAGAAATCACAATTTAGAGGAGG + Intronic
1103469698 12:121170144-121170166 AAGTTATCACAATTAGGAGCTGG - Intronic
1104959680 12:132482684-132482706 GAGACAACAGAATGGGGAGCTGG - Intergenic
1106136889 13:26980150-26980172 GAGAAATCAGAAGTGGGGGCAGG + Intergenic
1109209460 13:59517766-59517788 GATATAACAAAATTGGGAGCAGG - Intergenic
1110287168 13:73763149-73763171 GAGAGTTCATACTTGGGAGGGGG - Intronic
1130213799 15:81949926-81949948 GAGCGATGACAAGTGGGAGAAGG - Intergenic
1130816418 15:87440047-87440069 GAGAGATAACAATTGGGGTCGGG - Intergenic
1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG + Intronic
1131308000 15:91262571-91262593 AAGAGATAACTATTGGGTGCTGG - Intronic
1133273269 16:4621757-4621779 GAGAGATCACAATGGGTGGGGGG + Intronic
1136099564 16:27983743-27983765 GAGAAATCAAAATGGGGGGCAGG + Intronic
1137921101 16:52489320-52489342 GACAGATCACAATGTGGAGATGG - Intronic
1139144362 16:64306850-64306872 GAGAGAAGACAAGTGGGAGAGGG + Intergenic
1141817244 16:86420119-86420141 GGAAGAGCAGAATTGGGAGCTGG + Intergenic
1144140345 17:12341623-12341645 GAGAGATCAGAATTCTCAGCTGG + Intergenic
1146559340 17:33854779-33854801 GGCAGATGACAAATGGGAGCTGG - Intronic
1147304852 17:39556243-39556265 GATAGCTCTCAGTTGGGAGCTGG - Intronic
1148270192 17:46256511-46256533 GTGATAGCACAATTGGGTGCTGG - Intergenic
1151436254 17:74099634-74099656 CAGAGATCACAGCTGGGAGATGG + Intergenic
1151447706 17:74177984-74178006 GAGAGAGCAGAGTTGGGTGCTGG + Intergenic
1151587604 17:75019981-75020003 GAGAAATCACAGTTGTGAGGTGG + Intronic
1156969331 18:43135904-43135926 GAGAGATCACATTAATGAGCAGG - Intergenic
1159933155 18:74335020-74335042 GAGAGATGAGACTTAGGAGCTGG - Intronic
1160184016 18:76660696-76660718 GAGAGACCAGAATGGGGAGGAGG + Intergenic
1163060280 19:14755719-14755741 CAGAGATCACATCTGAGAGCAGG + Exonic
1164848511 19:31458142-31458164 GAGAGATAATAATTGGCAGAGGG - Intergenic
1165482778 19:36074853-36074875 GAGAGAGCAGAACTGGGGGCAGG - Intronic
1166346316 19:42168268-42168290 GAGAGATCAGACTTGGTACCTGG + Intronic
1167421647 19:49407428-49407450 GAGGGGTCACACTTGGGACCTGG - Intronic
928362148 2:30672793-30672815 GAGAAATCACAATAGGGAATAGG + Intergenic
928859969 2:35846035-35846057 GAGAGATCACACAGGTGAGCAGG + Intergenic
930603709 2:53470677-53470699 GAGAGTTGATAATTGGTAGCAGG - Intergenic
933693715 2:85199228-85199250 CTGAGATCACCATTGTGAGCTGG - Intronic
934938330 2:98481207-98481229 GAGGGATTACAATGGGCAGCAGG - Intronic
936766155 2:115851034-115851056 GAGAGATGGCAATTGAAAGCTGG - Intergenic
942687865 2:178552787-178552809 GAGAGATCACGTATAGGAGCTGG + Exonic
947021675 2:225684300-225684322 TGGAGATCACAATTGGGATTAGG + Intergenic
1173011457 20:39186931-39186953 AAGAGACCAAGATTGGGAGCAGG + Intergenic
1173055225 20:39605343-39605365 GAAAGATCAGAGGTGGGAGCTGG - Intergenic
1175894024 20:62328135-62328157 CAGGGAGCACAAATGGGAGCAGG + Intronic
1177622749 21:23617988-23618010 GAGGGAAAAAAATTGGGAGCAGG - Intergenic
1182317400 22:29457232-29457254 GAGAGAGCACATTGGGGATCTGG - Intergenic
1183300700 22:37057651-37057673 GAGAGACCACACTTGGTGGCAGG + Intronic
955563308 3:60216799-60216821 GTGAGATGACAGTTGGTAGCAGG - Intronic
955659998 3:61288233-61288255 GAGTGATCCCAAATGAGAGCAGG + Intergenic
958659068 3:97042261-97042283 GAGAGAGCACGAGTGGGAGAGGG - Intronic
962402952 3:135077314-135077336 GAGAGAACAAACCTGGGAGCAGG - Intronic
964434172 3:156634818-156634840 GAGAGATGGCAGTTTGGAGCAGG - Intergenic
965949188 3:174283658-174283680 GATAGATAATAATTGGGAGGGGG - Exonic
969314658 4:6374519-6374541 GAAAGATCACAATTGTCATCTGG + Intronic
970429848 4:15978634-15978656 GAGACATCACTGTGGGGAGCGGG + Intronic
973084368 4:46037001-46037023 GAGAGATCACAATTTCCAACTGG - Exonic
975419113 4:74141384-74141406 GAGAACTCACATTTGGCAGCAGG - Intronic
976228001 4:82811953-82811975 GAGAGCTGAGATTTGGGAGCAGG - Intergenic
982454471 4:155592169-155592191 GAGAGACCAGAGGTGGGAGCAGG + Intergenic
984139368 4:175983966-175983988 GAGAGAGCACAATAGGTAACTGG - Intronic
989446728 5:41538428-41538450 TAGTGATCAAAATAGGGAGCTGG - Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
993683362 5:90907592-90907614 GAGAAATCACAGTTGGCAGAAGG - Intronic
999475315 5:151892707-151892729 GAGTAATCACACTTGGCAGCTGG + Intronic
1000196535 5:158964517-158964539 GAGAGAACAAACATGGGAGCTGG + Intronic
1004326818 6:14682578-14682600 GACAGAACACTATTGGGAGATGG + Intergenic
1004664661 6:17738875-17738897 GAGAGGTCAAAATTGAGTGCTGG + Intergenic
1005143230 6:22658172-22658194 GAAAGATCAGAAAAGGGAGCTGG + Intergenic
1008642910 6:53483190-53483212 GAGAGACCACTATTGGGAGGGGG + Intergenic
1011325052 6:86141498-86141520 GAAAGATAACAATTGGGTACTGG - Intergenic
1013774295 6:113662284-113662306 GAAAGTGCACAATTGGGAGGAGG - Intergenic
1016767408 6:147810455-147810477 GAGGCAGCACAATTGTGAGCTGG + Intergenic
1017286015 6:152677250-152677272 GAGAGAGCAAAATGGAGAGCAGG - Intergenic
1017694168 6:156998186-156998208 GAGAGATCAAGATTGGGAGAGGG - Intronic
1021554236 7:21903565-21903587 AAGAGGTCACACTCGGGAGCAGG + Intronic
1022070292 7:26906794-26906816 GAGAGATCAATTTTGGGAGTGGG - Intronic
1022209730 7:28196637-28196659 GAGTGGTCAGAATTGGAAGCGGG - Intergenic
1027704102 7:81508091-81508113 GATAGTTCATAATTGGGAGGAGG - Intergenic
1029911231 7:104150963-104150985 GAGAAATGACATTTGGGAGATGG + Intronic
1030877583 7:114834431-114834453 GAGAAATCTCAATAGGGAACTGG + Intergenic
1031196082 7:118615664-118615686 GAAAGGTCACAATGGAGAGCAGG + Intergenic
1031217542 7:118915136-118915158 ATGAAATCACAAATGGGAGCAGG + Intergenic
1032259646 7:130324836-130324858 GAGTGATCACAATTAGGCCCAGG - Intergenic
1033309383 7:140249466-140249488 AAGAGAGCAGAGTTGGGAGCAGG - Intergenic
1034230633 7:149524759-149524781 GAGAGATTATAAATGGGAGGAGG + Intergenic
1036099009 8:5756816-5756838 TAGATATCAAAATTAGGAGCAGG + Intergenic
1038411442 8:27362498-27362520 GAGAGATGACTGTGGGGAGCAGG + Intronic
1041401570 8:57450747-57450769 GAGAGAGCTCAAGTGGGAGAAGG + Intergenic
1041406881 8:57509365-57509387 GAGACATCATAATTGGCAGATGG - Intergenic
1041542438 8:59001276-59001298 GACAGATGACAATTGTGAGGTGG - Intronic
1041990319 8:63980600-63980622 GAGTGATCTCATTTAGGAGCAGG - Intergenic
1042274736 8:66992533-66992555 GAGAGCTCTCACTGGGGAGCAGG + Intronic
1044164465 8:88964477-88964499 AAGAGATCCTAATTGGGAGGAGG + Intergenic
1044874095 8:96647092-96647114 CATAGATCACATTTTGGAGCTGG + Intronic
1049186788 8:141259410-141259432 GAGGGATCACCCTTCGGAGCAGG + Intronic
1051418523 9:16869498-16869520 GAGATGTCACATTAGGGAGCAGG + Intronic
1051569638 9:18541134-18541156 GATACAACAAAATTGGGAGCAGG + Intronic
1051712010 9:19940766-19940788 GAGAGGGCACCCTTGGGAGCAGG - Intergenic
1053198950 9:36139810-36139832 GAGAAACCACAGCTGGGAGCAGG - Intronic
1055562461 9:77534536-77534558 AACACATCACAATTGGGAGATGG - Intronic
1056144103 9:83712146-83712168 GAGTGATCACTATTGTGAACTGG + Intergenic
1058126150 9:101197324-101197346 GAGACATCAAGTTTGGGAGCAGG - Intronic
1059300659 9:113310303-113310325 GAGAGATAACATATGGGAACGGG + Intergenic
1062723735 9:138059261-138059283 GGGGGCTCACAATTTGGAGCTGG + Intronic
1185881362 X:3744285-3744307 AAAAGATCACCATTGGGTGCTGG + Intergenic
1186924992 X:14323795-14323817 GGAAGATAAAAATTGGGAGCTGG - Intergenic
1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG + Intronic
1188901956 X:35744195-35744217 GAGCTATAACAATTGGGAACAGG - Intergenic
1189180506 X:39000171-39000193 GAAAAATGACAACTGGGAGCAGG + Intergenic
1190953335 X:55167629-55167651 GAGAGATTTCAAGTGTGAGCTGG - Intronic
1191852807 X:65598281-65598303 GAGAGATAAAAATAGAGAGCAGG + Intronic
1196252028 X:113472419-113472441 GAGAAACCACAAATGAGAGCTGG - Intergenic
1198088078 X:133299693-133299715 GAGAGATGACATTTGGTAACAGG - Intergenic
1200850772 Y:7880908-7880930 AAGAGATCACAACTTGGTGCTGG + Intergenic