ID: 1187190267

View in Genome Browser
Species Human (GRCh38)
Location X:17027969-17027991
Sequence TGGCCAAGCCTGCCTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187190267_1187190270 1 Left 1187190267 X:17027969-17027991 CCAGTCACAGGCAGGCTTGGCCA 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1187190270 X:17027993-17028015 CCCAGATTTCCCACACAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 103
1187190267_1187190274 29 Left 1187190267 X:17027969-17027991 CCAGTCACAGGCAGGCTTGGCCA 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1187190274 X:17028021-17028043 AAAATCTGCCTCTCCAAAAAAGG 0: 1
1: 0
2: 5
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187190267 Original CRISPR TGGCCAAGCCTGCCTGTGAC TGG (reversed) Intronic
900370547 1:2330166-2330188 TGGCCAGGCCTGCCCCTAACTGG + Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
900947461 1:5839125-5839147 TGCCCAATCCTGCCTGGAACTGG - Intergenic
900955327 1:5883206-5883228 CAGCCCAGCCTGCCTGTGCCAGG + Intronic
900970164 1:5987723-5987745 CGGGGAAGCCTGGCTGTGACTGG + Intronic
901313986 1:8293026-8293048 TGTCCAACCCTGCCTGGGACTGG + Intergenic
902838593 1:19061659-19061681 GGGCCATTCCTGCCCGTGACAGG - Intergenic
904086827 1:27915191-27915213 AGGCCAAGCCTGGATGAGACTGG - Intergenic
905474618 1:38217469-38217491 TGCCCAAGCAAGCCTGTGGCTGG - Intergenic
907461161 1:54606428-54606450 TGGCCATGCCTGCCTCTGTGTGG + Intronic
907499000 1:54864898-54864920 CAGCCAAGCCTGGCTGTGAAAGG - Intronic
908001418 1:59684077-59684099 AGCACAAGCCTGCATGTGACGGG + Intronic
908742369 1:67342036-67342058 TTCCCAAGCCTGCCTGAGAGTGG - Intronic
911062817 1:93762545-93762567 TGGCCTGGCCTGCCTTTGCCTGG - Intronic
911160254 1:94676817-94676839 TGGACAAACCTGCCCATGACAGG + Intergenic
911643171 1:100310695-100310717 TGGCCTAGCCTGTCTTAGACAGG - Intergenic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
915957925 1:160238691-160238713 TGGCCATGTGTGCCCGTGACGGG - Exonic
917089208 1:171336175-171336197 TGGCCAGTCCTGCCTTTGTCAGG - Intronic
1062902875 10:1159021-1159043 TGGCCAAGACTGCGTCTGTCTGG + Intergenic
1064002288 10:11673707-11673729 TGGCCAAGTCAGCGTGTGAGAGG + Intergenic
1065171704 10:23036627-23036649 TGGCTTAGCCTGCCTGGGTCTGG - Intronic
1065225648 10:23541365-23541387 TGGCAAAGGCTGCATGTGCCCGG + Intergenic
1069003979 10:63297344-63297366 TGTCCAAGCCTGGCTGAGCCCGG - Intronic
1070776616 10:79113481-79113503 TGGCCTGGCCTGAATGTGACTGG + Intronic
1071489501 10:86126658-86126680 TGGCCAACTCTGCCTGTGGCAGG - Intronic
1072445016 10:95491598-95491620 CGGCCAAGCCTGCCTATGAAGGG - Intronic
1072782522 10:98260227-98260249 TGATCAAGCCAGGCTGTGACTGG - Intronic
1072803527 10:98409616-98409638 TGGGCAAGGCTGCATGTGCCAGG + Intronic
1074495746 10:113978842-113978864 TGGACAGCCCTGCATGTGACTGG + Intergenic
1076340850 10:129743956-129743978 TGGCCATGCCTGGCTGGGATGGG + Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078106635 11:8361911-8361933 TGGCCAAGCAGGCATGTGAGAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082794481 11:57369571-57369593 TGGCCAAGCCTTCCCTTGTCTGG - Intronic
1083855082 11:65389300-65389322 TGGCCTGGCCTGGCTGTGCCAGG + Intronic
1084408199 11:68991168-68991190 TGCCCAAGCCCGCCTGGGAAGGG - Intergenic
1084466780 11:69327984-69328006 TGGCCAAGCCTGCTGGGCACTGG - Intronic
1084969535 11:72763135-72763157 TGTCCTAGCTTGCCTGGGACTGG - Intronic
1085218513 11:74852708-74852730 TGGCCAAGCCAGCCTCTGAAGGG + Intronic
1085368289 11:75974068-75974090 TGGCCCAGCCATCCTGTTACTGG - Intronic
1086523217 11:87696214-87696236 TAGCCAAGCCTTCTTGTGAATGG + Intergenic
1089400411 11:118161133-118161155 TGGCCCAGCCTGCCTGGGGCGGG - Intergenic
1089573227 11:119423365-119423387 TGGCCAGGCCTGCCAGCCACAGG - Exonic
1089728713 11:120506455-120506477 TGGCCATGCCTGTCTGGGAAAGG - Intergenic
1090024915 11:123159350-123159372 GGGGCAAGCCTGCATGTGACAGG + Intronic
1092056729 12:5513685-5513707 TGGCCAAGCATTCCTGGGAAGGG + Intronic
1096193513 12:49634593-49634615 TGCCCAGGCCTACCTGTAACGGG - Exonic
1101740549 12:107496580-107496602 TGACCAAGTCTGCCTCTGAGTGG + Intronic
1104607555 12:130201096-130201118 TGGCCAAGCCAGCCTGAGGCAGG + Intergenic
1105411755 13:20177144-20177166 TGGGGAAGCCTGGCTGAGACGGG + Intergenic
1108497102 13:51035890-51035912 TAGACAAGCCTGCCTGAGGCCGG - Intergenic
1110709359 13:78633134-78633156 TGGACAAGCATTACTGTGACTGG + Intronic
1112917503 13:104569607-104569629 TGGCAAAGCCAGCCTGTACCAGG + Intergenic
1118156020 14:63242655-63242677 TGGAGAAGCCTGGCTGTGATGGG + Intronic
1118617596 14:67585382-67585404 TAGACAAGGCTGCTTGTGACAGG - Intronic
1119652588 14:76394169-76394191 TGGCCAAGTCTACCTGACACAGG - Intronic
1119748591 14:77061927-77061949 TGGCCAGGCCTCCTGGTGACTGG - Intergenic
1120936476 14:89900551-89900573 TGACAAAGCCTGAATGTGACAGG - Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1123885623 15:24725250-24725272 TTGCCATGCCTGGCTGTCACTGG - Intergenic
1123983062 15:25621364-25621386 AGGGCTAGCATGCCTGTGACTGG - Intergenic
1124024267 15:25950122-25950144 TGGCGCAGCCTGCCTGTCCCAGG - Intergenic
1128329430 15:66745976-66745998 TGGCCACACCTGCCTGCAACAGG - Intronic
1128561781 15:68673382-68673404 TAGCCAAGCATGCCTGAGTCCGG + Intronic
1132209383 15:100008662-100008684 TGCCCAAGTCTCCCTGGGACAGG - Intronic
1132339123 15:101066928-101066950 TGGCCATGGCTGCCTGTTTCTGG + Intronic
1132393800 15:101457741-101457763 TGGCCAGGGCTGCCTGTGTGTGG - Intronic
1132930930 16:2458984-2459006 TGGCCCCGCCTGCCTGTGGTGGG + Intergenic
1132939812 16:2501084-2501106 TGGCCAAGCCTGGCGTTGCCTGG + Exonic
1134242890 16:12518715-12518737 TGGCCCACCAGGCCTGTGACAGG - Intronic
1135591897 16:23711076-23711098 TGGCCAGCCCTGCTTGGGACAGG - Intronic
1137731417 16:50693429-50693451 TGGCCAGGCTTACCTGGGACAGG - Intergenic
1140454763 16:75098575-75098597 TGGCCCAGTCTGCCAGGGACAGG - Intronic
1141252662 16:82372444-82372466 TGGAGAAGCCTGCCTGTGAGTGG + Intergenic
1141983065 16:87561777-87561799 TGGCTAGGACTGCCTGTGCCTGG - Intergenic
1142159986 16:88552387-88552409 TGGTCACGCCTGCCTGCCACAGG + Intergenic
1142895595 17:2975749-2975771 TGGCCCGCACTGCCTGTGACTGG + Intronic
1142970646 17:3609392-3609414 GGGCCAGGCCTGCCTGAGCCTGG + Exonic
1144681702 17:17200246-17200268 TGGGCATGCCTGCCTGTTACTGG + Intronic
1144826438 17:18108133-18108155 GGGCAGAGCCTGCCTGTGCCTGG - Intergenic
1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG + Intronic
1148115156 17:45171153-45171175 TGGCCAGGCCTGGGTGTGGCAGG - Intergenic
1148366280 17:47057982-47058004 TGCCCATGCCTGCCTGTAGCCGG + Intergenic
1148444036 17:47727030-47727052 TGGCAGAGCCTGACTGTGCCAGG + Intergenic
1148724547 17:49779377-49779399 TGGCTATGCCTGGCTGTCACTGG + Intronic
1151038931 17:70835467-70835489 TGGCCAAGCCTGCCTCTCCACGG + Intergenic
1151527708 17:74682364-74682386 GGGAGAAGCCTGCCTGTGAATGG - Intronic
1152430323 17:80245234-80245256 CGTCCAAAGCTGCCTGTGACCGG - Exonic
1152738194 17:82007699-82007721 CGGCCAGGCCAGCCTGTGGCAGG - Intronic
1155748263 18:29388410-29388432 TAGACTAGCCTGCATGTGACTGG + Intergenic
1157332904 18:46716462-46716484 TGGCCCAGGCTGCCTGTGGGTGG - Intronic
1158124926 18:54090602-54090624 GGGCCAGGCCTGGCTGTGAAGGG - Intergenic
1159985365 18:74835099-74835121 TGGCCTAACCTGCCTATCACAGG - Intronic
1160681103 19:412039-412061 TGGCCAAGCCAGGCTGTGGTGGG - Intergenic
1160836251 19:1126084-1126106 CGCCCAAGCCTGCCTGAGCCCGG + Intronic
1162362327 19:10227551-10227573 GGCCCAAGCCTGCCTGGGACTGG - Intronic
1162460508 19:10811495-10811517 TGGCCAAGTCTGTCAGTGCCTGG + Intronic
1163212532 19:15851840-15851862 TGGCCAAGCCTGGCTTTAATGGG + Intergenic
1163418280 19:17200218-17200240 AGGCCCAGCCTCCCTGTGACTGG - Intronic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
926146063 2:10397730-10397752 TGGCCAGGCCTTCCTGTCTCGGG - Intronic
928317344 2:30256380-30256402 GTTCCCAGCCTGCCTGTGACTGG + Intronic
933654255 2:84874745-84874767 TTGCCAAGCCAACCAGTGACTGG + Intronic
934949297 2:98565542-98565564 AGCCCAGGCCTGGCTGTGACAGG - Intronic
934954724 2:98608250-98608272 GAGCCAGGCCTGCCTGGGACAGG + Intronic
935022898 2:99248986-99249008 TGTCCAAGTCTACCTGTTACAGG + Intronic
937119201 2:119430449-119430471 GGGCCAAGCCTTCCTGTGCCTGG + Intronic
938318577 2:130346621-130346643 TGGCCCCGCCTGCCTCTGAGTGG + Exonic
943592105 2:189811223-189811245 TGGTCTAACATGCCTGTGACTGG + Intronic
944834272 2:203562774-203562796 TGACCAACCATGGCTGTGACAGG + Intergenic
946941176 2:224771664-224771686 TGGCCATGCCTGCTGGTCACAGG - Intronic
947262133 2:228235061-228235083 TGCCCATGCCTAGCTGTGACAGG - Intergenic
947629789 2:231644715-231644737 TGGCTCAGCCTTCCTGAGACAGG - Intergenic
947753339 2:232544105-232544127 TGGCCTAGAATGCCTGGGACAGG - Intronic
947872287 2:233445997-233446019 AGGCCAAGCCTGAGTGTGTCAGG + Intronic
1169114005 20:3051064-3051086 TGGCTAGGCCTGCCTGTCTCAGG - Intergenic
1169791424 20:9414290-9414312 TGGCAAAGGCTGTCAGTGACAGG + Intronic
1171229797 20:23475244-23475266 TTGCTAAGCCTGCCCATGACGGG - Intergenic
1172228007 20:33318086-33318108 ATGCTCAGCCTGCCTGTGACAGG + Intergenic
1172319070 20:33982259-33982281 TGGAGAAGTCTGCCTGTGACTGG - Intergenic
1172444897 20:34987787-34987809 TGGCCAAGGCCACCTATGACCGG + Exonic
1173332155 20:42084579-42084601 TAGCCAGGCCTGCCTAGGACTGG + Intronic
1175463255 20:59171034-59171056 TTGCACAGCCTGCCTGTGGCTGG - Intergenic
1175976927 20:62715529-62715551 TGGCCATGGCTGGCTCTGACTGG + Intronic
1181030160 22:20145698-20145720 GGGCCAAGCCTGGCTGAGAGAGG - Intronic
1181915072 22:26273428-26273450 TGGGCAAGCCTGCAAGTGAAGGG + Intronic
1182528392 22:30936468-30936490 GGGCAAAGCCAGCCTGTGTCAGG - Intronic
1184504576 22:44893127-44893149 TGTCCAGCCCTGCCTGTGACCGG + Intronic
949449314 3:4167351-4167373 TTTCCAATCCTCCCTGTGACTGG + Intronic
949928789 3:9061829-9061851 TGGCTAAGCCAGCCTGGGAATGG + Intronic
950850245 3:16055363-16055385 TGGCCTCGGCTGCCTGTCACTGG - Intergenic
952425845 3:33173912-33173934 AGGCCAGGCCTGGCTGTGGCTGG + Intronic
953003623 3:38957621-38957643 TGGCCAGGGCTACCTGTCACAGG + Intergenic
953663871 3:44911273-44911295 TGGCCAATTCTGCCTGTGTTAGG - Exonic
954283735 3:49603052-49603074 TGGCCATACCTGCCTCTCACTGG + Intronic
954396743 3:50297079-50297101 GGGCCATGCCCGCCTGTCACGGG - Exonic
954453865 3:50586458-50586480 TAGCCAGGCCTGCCTGCCACGGG - Intergenic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
962959091 3:140293421-140293443 TGGACAAGCCAGTCAGTGACAGG + Intronic
964579287 3:158213651-158213673 TGGATATGCCAGCCTGTGACAGG + Intronic
964643179 3:158931526-158931548 AGGCCATGCCAGCCTGTTACGGG + Intergenic
965524486 3:169701706-169701728 TGCCCAACCCTGCCAGTAACAGG + Intergenic
966869089 3:184278378-184278400 CAGCCCAGCCTGCCTGTCACAGG - Intronic
968625244 4:1623986-1624008 GGGCCATGCCTGCCTGGGGCGGG + Intronic
969110903 4:4843743-4843765 TGGGCAAGCCTGCCCATGCCCGG + Intergenic
969273072 4:6116055-6116077 TGGCCCAGCCTGGCAGTGTCTGG - Intronic
969376382 4:6766226-6766248 TGGGCCAGACTGCCAGTGACAGG - Intergenic
971450409 4:26795179-26795201 AGGGCAAGCCTGCCTGTGTGAGG - Intergenic
972316895 4:37935099-37935121 TGGCCAAGCCTGACATTAACAGG + Intronic
973162046 4:47031266-47031288 TGGCTAAGGCTGCCTGTGATTGG - Intronic
974005302 4:56550593-56550615 TGAGCAAGCTTTCCTGTGACTGG + Intronic
975661871 4:76696577-76696599 AGGCCAGGCCAGCCTATGACAGG - Intronic
976738844 4:88338066-88338088 TGGACAGGCCTACCTATGACAGG - Intergenic
978682584 4:111399769-111399791 TGGCCAAGACAGCCTTTGGCTGG + Intergenic
980088668 4:128418287-128418309 TTCCCAAGCCTGCCTGTTTCAGG - Intergenic
980243005 4:130201859-130201881 TGGCCAAGCCTACATCTGGCAGG + Intergenic
982493452 4:156059266-156059288 AGGCAAAGACAGCCTGTGACAGG + Intergenic
996256260 5:121407818-121407840 TGGCCAAGCCTACCTCTTACAGG + Intergenic
997110318 5:131067169-131067191 TTTCCAAGCCAGCCTGTGTCTGG - Intergenic
998051012 5:139035486-139035508 TTGCCAAGGCAGCCGGTGACTGG - Intronic
1000975458 5:167759629-167759651 TGGACAAGCCTGGATGTGCCAGG + Intronic
1001293456 5:170482744-170482766 AGGCCAAGCCTGTCTGAGAGAGG + Intronic
1001537779 5:172510328-172510350 TGTCCAATCCTCCCTGAGACGGG + Intergenic
1006665776 6:35692012-35692034 TGGCCAGTCCTGCCTGTCACTGG + Intronic
1006911054 6:37563939-37563961 TGGCCCAGGCTCCCTGTGCCAGG + Intergenic
1007268992 6:40621304-40621326 TGGCCAAGCCCACCTGTGGATGG + Intergenic
1007340232 6:41186556-41186578 TGACCAGGCCTGCCTGGAACCGG + Intergenic
1007813087 6:44500164-44500186 TGGCCCAGTCTGAATGTGACAGG + Intergenic
1008007983 6:46432624-46432646 TGGCCAAGTCTGCTGGTAACTGG - Intronic
1011884321 6:92075322-92075344 TGGACAAGCCTCCCTGTCGCTGG - Intergenic
1011948067 6:92932297-92932319 TGTCAAAACCTGCCTGAGACTGG - Intergenic
1012548457 6:100447445-100447467 TGAACCAGCCTGCCTGGGACTGG + Intronic
1016423857 6:143913403-143913425 GGGCGGAGCCTGCCTGAGACAGG - Intronic
1017028776 6:150202766-150202788 GGGCCAGGCCTTCCTGTGACTGG - Intronic
1017295003 6:152783316-152783338 TGACCAGGCGTTCCTGTGACAGG + Intergenic
1017733565 6:157339692-157339714 TGTCCCAGCCCTCCTGTGACTGG - Intergenic
1017751075 6:157491045-157491067 TGCCCATGCCAGCCAGTGACAGG - Intronic
1018611775 6:165654294-165654316 TGGCCCAGCCTTGCTGAGACTGG - Intronic
1018824177 6:167397025-167397047 TGCCCTTGACTGCCTGTGACAGG - Intergenic
1018894607 6:168005095-168005117 ACGCCAAGCTCGCCTGTGACAGG - Intronic
1018970618 6:168526143-168526165 GGACCAGGCCTGCATGTGACAGG + Intronic
1019315207 7:380998-381020 TGGCCAGGACTCCCTGAGACAGG + Intergenic
1020372893 7:7453745-7453767 TGGCCACGCCTGGCTGCAACAGG - Intronic
1021408599 7:20303014-20303036 TACACAAGCCTGCCTGTTACTGG + Intergenic
1023806546 7:43876864-43876886 AGGCCAGGCCTGCCAGTGCCCGG + Exonic
1026405083 7:70056705-70056727 TTGCCAATCCTGCCTTTGAAAGG - Intronic
1026909841 7:74085124-74085146 TGACTAAGCATGCCTGTGGCTGG + Intronic
1026942234 7:74293801-74293823 TGGCCAGGGCTGCCTGCCACTGG + Intronic
1027055051 7:75043919-75043941 GGACGCAGCCTGCCTGTGACTGG - Intronic
1029687149 7:102156761-102156783 TGGCCCATCCTGTCTGTGACGGG - Intronic
1031878724 7:127171867-127171889 TGTCCAAGACTGCATGTGTCTGG - Intronic
1033044350 7:137947816-137947838 CAGCCAAGCCAGGCTGTGACTGG - Intronic
1038335175 8:26640298-26640320 TGACCAAGCCAGCCTCTGGCAGG - Intronic
1038865252 8:31432622-31432644 TGTCCACTACTGCCTGTGACTGG + Intergenic
1039427102 8:37495127-37495149 GTGCCCAGCCTGCCTGTCACTGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1043157801 8:76806994-76807016 TGGCAAAGGATGCCTGTCACAGG - Intronic
1045225639 8:100242700-100242722 TGCCCAGGCCTGCCTGAGAGAGG + Intronic
1047220167 8:122912316-122912338 TGCCCAGGCCAGCCTGTGGCTGG - Intronic
1049288432 8:141789068-141789090 TGGCCCAGCCTGCCAGAGAATGG - Intergenic
1049961572 9:742542-742564 TAGCCAAGCTTGGCTGTGAAGGG - Intronic
1050004963 9:1120019-1120041 TGGCCATTCCTGCCTGGGGCTGG + Intergenic
1051625459 9:19095265-19095287 TGGAAAAGCCTGACTGTGAAAGG - Intronic
1053517390 9:38742673-38742695 ATCCCAAGCCTGTCTGTGACAGG + Intergenic
1056620771 9:88211941-88211963 TCTCCAAGCCTGCTTGTGGCTGG - Intergenic
1059392215 9:114006376-114006398 TCACCAAGCCTCCCTGTGCCTGG + Intronic
1059425162 9:114216382-114216404 TGGCCATGCCTGCATGTGTAAGG - Intronic
1060397373 9:123325597-123325619 CTGCGAAGCCTCCCTGTGACTGG - Intergenic
1061369003 9:130187443-130187465 TGGCCAGGGCTGCCTCTGCCTGG + Intronic
1061953629 9:133950151-133950173 TGGCCCTGCCTGCCTGTGCCAGG - Intronic
1062597381 9:137305400-137305422 TGGCCGAGGCTGCCAGTGCCAGG - Intergenic
1185993360 X:4916025-4916047 TGGCCAAGCCTGCCCATGGAAGG + Intergenic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1197612705 X:128657044-128657066 AGACCAAGACTGGCTGTGACTGG + Intergenic