ID: 1187190493

View in Genome Browser
Species Human (GRCh38)
Location X:17030487-17030509
Sequence CTAGCAGCCCACATCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187190493_1187190500 16 Left 1187190493 X:17030487-17030509 CCCATAAAGATGTGGGCTGCTAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1187190500 X:17030526-17030548 CAAAGTCTAAAGAAGGTCCTGGG 0: 1
1: 0
2: 3
3: 17
4: 170
1187190493_1187190502 24 Left 1187190493 X:17030487-17030509 CCCATAAAGATGTGGGCTGCTAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1187190502 X:17030534-17030556 AAAGAAGGTCCTGGGGTTCATGG 0: 1
1: 0
2: 0
3: 22
4: 246
1187190493_1187190501 17 Left 1187190493 X:17030487-17030509 CCCATAAAGATGTGGGCTGCTAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1187190501 X:17030527-17030549 AAAGTCTAAAGAAGGTCCTGGGG 0: 1
1: 0
2: 3
3: 15
4: 186
1187190493_1187190499 15 Left 1187190493 X:17030487-17030509 CCCATAAAGATGTGGGCTGCTAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1187190499 X:17030525-17030547 ACAAAGTCTAAAGAAGGTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 169
1187190493_1187190498 9 Left 1187190493 X:17030487-17030509 CCCATAAAGATGTGGGCTGCTAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1187190498 X:17030519-17030541 GGATAAACAAAGTCTAAAGAAGG 0: 1
1: 0
2: 5
3: 17
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187190493 Original CRISPR CTAGCAGCCCACATCTTTAT GGG (reversed) Intronic
902454801 1:16525086-16525108 CCAGCAACCCACAAATTTATGGG - Intergenic
908462869 1:64363203-64363225 GTAGCAGCCCACCTCTTGAGAGG + Intergenic
911590746 1:99745209-99745231 TTAGCAGCCAGCAGCTTTATAGG - Intronic
922803602 1:228374880-228374902 TGAGCAGCCCACATCCCTATGGG + Intronic
1066417840 10:35237790-35237812 CTAGTATCCCACACATTTATGGG + Intergenic
1084039984 11:66537045-66537067 CAAGCAGCTCAGATCTTTGTGGG + Intronic
1084390507 11:68873088-68873110 CAAGCACCCCCCGTCTTTATTGG + Intergenic
1085941646 11:81212742-81212764 CTGGCAGCCCACAACTCTAAAGG + Intergenic
1086016067 11:82168976-82168998 CTAGCTCCCCACATCTTGATAGG + Intergenic
1090879149 11:130818059-130818081 CTAGCAGCCCACATCCAAAGAGG + Intergenic
1096898982 12:54854697-54854719 CCATAAGCCCACATCTTTAGAGG - Intronic
1097349755 12:58535972-58535994 TAAGCAGCCCCAATCTTTATAGG + Intergenic
1097992225 12:65848049-65848071 CTAGCAGCTTACTTCTTTAGTGG - Intronic
1100612727 12:96204982-96205004 CTTGCAGCCCACATCCGTAAAGG - Intronic
1107196879 13:37662788-37662810 CTAACAGCACACAGCTTCATGGG - Intronic
1110601977 13:77386058-77386080 CTTGCAGCCCAATTGTTTATTGG + Intergenic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1120643440 14:87043498-87043520 CTCACAGCTCACATCTTTATTGG - Intergenic
1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG + Intergenic
1126879443 15:53078682-53078704 CAAGGAGCCCACATTCTTATGGG + Intergenic
1130841533 15:87705505-87705527 CCTGCAGCCCACATCTTTCCCGG + Intergenic
1147635839 17:41963368-41963390 TTAGCAGCGTATATCTTTATAGG + Intronic
1148063903 17:44854828-44854850 CTAAGAGCACACATCTTTCTGGG - Intronic
1149069691 17:52525244-52525266 CCAGCAGCCCACTTTTTTTTTGG + Intergenic
1149901336 17:60482340-60482362 CTGACAGGCCACATCTTTATTGG - Intronic
1152424456 17:80211359-80211381 CTCGCGGCCCACATCTCTCTTGG - Intronic
1160979421 19:1810094-1810116 CTGGCGGCCCAGATCTTTCTGGG + Intronic
1161361321 19:3851550-3851572 GGGGCAGCCCACATCTTCATGGG + Intronic
1163193780 19:15699455-15699477 CTAGCAGTCTCCATCTTTTTTGG + Intergenic
927932180 2:27052124-27052146 CTAGCAGCCCACCTCTTTTAGGG + Intronic
931432007 2:62215782-62215804 CTAGCAGCCTCCATCTCTAGAGG - Intronic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
933112021 2:78414417-78414439 TAAGCAGCCCACAGCTTTTTAGG - Intergenic
936625974 2:114149851-114149873 CCAGCTGCCCACATGTTTGTGGG + Intergenic
939423349 2:142002460-142002482 CTAGCAGCACTTATCCTTATAGG - Intronic
941605434 2:167591058-167591080 CTTGGAGCCTACATTTTTATGGG + Intergenic
941678013 2:168365087-168365109 AAAGCAGCCCAAATGTTTATTGG + Intergenic
942487071 2:176451206-176451228 CCAGCAGCCCACATTTATAGGGG - Intergenic
943487865 2:188510045-188510067 CTAGCACCCCTCATCTTTCAGGG - Intronic
1173169377 20:40711367-40711389 CGAGAAGCCCACCTCTTTATGGG + Intergenic
1175012672 20:55755354-55755376 CTAGTAACCCACATATTCATTGG + Intergenic
1177030088 21:15971932-15971954 CTAGCAGCTCACAGTTTTCTAGG - Intergenic
1181895859 22:26106847-26106869 CCAGCAGCCCATATCTTATTAGG - Intergenic
954384570 3:50237392-50237414 CTAGCAGCCACCATCTTTTCTGG - Intronic
963128383 3:141835828-141835850 CTAGCAGCCCACTTCCGTAAAGG - Intergenic
964527011 3:157625750-157625772 ACAGCAGCAAACATCTTTATAGG - Intronic
965821303 3:172686961-172686983 CTTCCAGCCCACTTCTTTTTAGG - Intronic
967594380 3:191312941-191312963 TTTGCAGGCCACATTTTTATGGG + Intronic
973637411 4:52873041-52873063 CTTGCAACCCACATGTTTGTAGG - Exonic
978487030 4:109266526-109266548 CCAGCCCCCCATATCTTTATAGG - Intronic
981751013 4:148092307-148092329 CCTGCTGTCCACATCTTTATGGG + Intronic
984705739 4:182845914-182845936 CTGGCAGCCCAGACCTTTCTTGG + Intergenic
986771972 5:10982494-10982516 CTATTAGCCCACTTCCTTATGGG + Intronic
988329011 5:29810534-29810556 GTAGTTGCGCACATCTTTATAGG + Intergenic
992151968 5:73913786-73913808 ATACCAGCCCACAACATTATAGG - Intronic
998440519 5:142157706-142157728 TTAGCAGTCCATATTTTTATAGG + Intergenic
1018509186 6:164506429-164506451 GTAGCAACCCACATCCTTGTGGG + Intergenic
1031385833 7:121149879-121149901 CCTGATGCCCACATCTTTATGGG + Intronic
1034875792 7:154723907-154723929 CTCTCTGCCCACATCCTTATGGG - Intronic
1037882540 8:22579997-22580019 CTAGCTGCCCACCTCGTTCTTGG - Intronic
1041320849 8:56611135-56611157 CTAGCAGCCTTTATCTTTTTAGG - Intergenic
1046758593 8:117996865-117996887 CAAGCAGCTAACATTTTTATAGG + Intronic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1048275750 8:133064688-133064710 CCAGCAGCCCTCCTCTTAATAGG + Intronic
1052733874 9:32320327-32320349 CAAGCAGCCCACAGCTGCATTGG - Intergenic
1058270820 9:102969190-102969212 CTAGCCCCCCACCTCTTGATAGG + Intergenic
1059458877 9:114417053-114417075 CTCTCGGCCAACATCTTTATGGG + Intronic
1186627710 X:11312595-11312617 CTAGCCTCCCACATCTTTAGAGG + Intronic
1187190493 X:17030487-17030509 CTAGCAGCCCACATCTTTATGGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1200062817 X:153491185-153491207 CAAGCAGCCCACCTCTGTAGGGG + Intronic