ID: 1187190819

View in Genome Browser
Species Human (GRCh38)
Location X:17033285-17033307
Sequence GGATTGAAACAAATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187190819_1187190831 18 Left 1187190819 X:17033285-17033307 CCCTGCCTCATTTGTTTCAATCC 0: 1
1: 0
2: 0
3: 20
4: 259
Right 1187190831 X:17033326-17033348 CTTGTTATGCTGGAGACTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1187190819_1187190825 8 Left 1187190819 X:17033285-17033307 CCCTGCCTCATTTGTTTCAATCC 0: 1
1: 0
2: 0
3: 20
4: 259
Right 1187190825 X:17033316-17033338 CTGCCCTCCCCTTGTTATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 125
1187190819_1187190832 19 Left 1187190819 X:17033285-17033307 CCCTGCCTCATTTGTTTCAATCC 0: 1
1: 0
2: 0
3: 20
4: 259
Right 1187190832 X:17033327-17033349 TTGTTATGCTGGAGACTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187190819 Original CRISPR GGATTGAAACAAATGAGGCA GGG (reversed) Intronic
901369320 1:8783004-8783026 GGGTTGAAAGAAAGGAGTCAAGG - Intronic
902245580 1:15118455-15118477 GGAGTGACACAAATGACACAAGG - Intergenic
902812393 1:18896003-18896025 GGATTGCACCAAATGGGGCAGGG - Intronic
905273623 1:36802908-36802930 GGAATGAAGAAAAGGAGGCAAGG - Intronic
906794972 1:48689502-48689524 GGAAGGAAACAAAGGAGGAAGGG - Intronic
907861477 1:58357866-58357888 GGATGGAAAGAATTGAGGGAGGG - Intronic
907869681 1:58432016-58432038 GGTTTGGAACAAATGTGGAAGGG + Intronic
908180938 1:61604842-61604864 GGAAAGAAAAAAATGAGGAAAGG + Intergenic
910373942 1:86549112-86549134 GGAGTAAAACAAATCAGGAAGGG + Intronic
910590323 1:88923255-88923277 GGATTGAAAGACATAAGGTAGGG + Intergenic
911879740 1:103221112-103221134 GGAATGAAAAATATTAGGCAAGG + Intergenic
912016174 1:105039406-105039428 GGAAAGAAACAAGTGAGACAGGG - Intergenic
916224981 1:162480600-162480622 GTATTGAAACAAATGAAACATGG + Intergenic
919002166 1:191846889-191846911 GGATTGATACAAATGTTTCATGG + Intergenic
919574268 1:199287315-199287337 GAATGGGAAAAAATGAGGCATGG + Intergenic
920734717 1:208521722-208521744 GGAATGAAAAACATGAGGAATGG - Intergenic
921131983 1:212227790-212227812 GGATGGAAGGAAAGGAGGCAGGG + Intergenic
922926460 1:229350972-229350994 GGATTAAAATAAATCAGGCCAGG + Intergenic
924240833 1:242038712-242038734 GGCTGGACACAAATGTGGCAGGG - Intergenic
924252517 1:242147148-242147170 GGATGGTTACAAAAGAGGCATGG - Intronic
924597364 1:245459073-245459095 GGCTTGAATCACAGGAGGCAAGG - Intronic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1066749546 10:38638884-38638906 GTATTTAAACAAATAAGGCTGGG - Intergenic
1066967098 10:42278886-42278908 GTATTTAAACAAATAAGGCTGGG + Intergenic
1068392010 10:56409651-56409673 GGATTGAACCAAAGGAGGGGAGG - Intergenic
1070332450 10:75427995-75428017 GGCCTGAAAGAAATGAGGCCAGG + Intergenic
1070721858 10:78762515-78762537 GGAATGAAAGAAAAGAGGGAGGG - Intergenic
1072767682 10:98108941-98108963 AGATTGAAAAAAATCAGGAAAGG - Intergenic
1073235316 10:102009728-102009750 GCAATGAAACAAAAGAGGGATGG - Intronic
1073630827 10:105147154-105147176 GGATTGCCAGAAATGTGGCATGG - Intronic
1073692891 10:105830817-105830839 GAAGTGAAAAATATGAGGCAGGG + Intergenic
1074856033 10:117474289-117474311 GGAGAGAAACAGATGAGGCCAGG + Intergenic
1076440748 10:130479883-130479905 GGATTGAAGCAAATGAATCTAGG + Intergenic
1080452065 11:32385839-32385861 GGATATATAAAAATGAGGCAAGG + Intergenic
1081677355 11:44978695-44978717 AGATTGAAGCAAGTGAGGCTGGG + Intergenic
1082220339 11:49627606-49627628 AGACTGAAAAAAATGAGACAGGG - Intergenic
1083178693 11:60970718-60970740 GGATGGGACCAATTGAGGCAGGG + Intergenic
1084495547 11:69501126-69501148 GGATGGAAAGAAAGGAGGGAGGG + Intergenic
1084836751 11:71807476-71807498 GTATGGAAAAAAATGAGGTAGGG - Intergenic
1085865961 11:80292570-80292592 AGATAGAAAAAAATGAAGCAAGG - Intergenic
1085968003 11:81552467-81552489 AGATTGAAACTAGTAAGGCAAGG - Intergenic
1086600527 11:88627979-88628001 AGATTGTAACAAATAAGGCTGGG - Intronic
1088680382 11:112236501-112236523 GCATTAAAAAAAATGTGGCAGGG - Intronic
1089390351 11:118097723-118097745 GGATTGGAACAAAAGAGTCTGGG - Intronic
1089628678 11:119769992-119770014 GGATTGAAAGAAGGAAGGCAGGG + Intergenic
1090119016 11:124005106-124005128 GGATTGAAAGAAAGGTGGAATGG - Intergenic
1091172789 11:133533025-133533047 GGTTTTAAACCAATGATGCAGGG + Intergenic
1091771233 12:3152495-3152517 GTATTGAAAAGAATGAGGGAAGG + Intronic
1092292701 12:7172535-7172557 GTAGTGAGACAAATGAGGCTGGG - Intergenic
1092533226 12:9362374-9362396 GTATGGAAACAAATGAGGAAGGG - Intergenic
1092700549 12:11225256-11225278 GGATTGTCACAAATGAGTAAAGG + Intergenic
1092791580 12:12075391-12075413 GAATAGAAACATATCAGGCAGGG - Intronic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1094172843 12:27512225-27512247 GGAGTGAAACAAATGGATCATGG + Intergenic
1094789289 12:33892270-33892292 TCATGGAAACAAATTAGGCAGGG + Intergenic
1097603439 12:61723350-61723372 AGATTGAAACAATGGATGCATGG + Intronic
1097622796 12:61961787-61961809 AGATTGAAAGAAATGTGGAAAGG - Intronic
1100046527 12:90388138-90388160 GGATTTATCCAAATGATGCAAGG + Intergenic
1100126212 12:91429378-91429400 GGTTAGAAAAAAATGAGACATGG + Intergenic
1101735399 12:107459487-107459509 AGATGGAAAAAAATGAAGCAGGG + Intronic
1102730898 12:115108529-115108551 GCATTGAAAAAAATGATGAATGG + Intergenic
1103876343 12:124130441-124130463 AAATTCAAAAAAATGAGGCAGGG - Intronic
1104560984 12:129844266-129844288 TGCTTGAAACAATTGAGGGAAGG + Intronic
1105320713 13:19318764-19318786 TGATTGAAAAAAAAGAGGCAAGG - Intergenic
1106794061 13:33186159-33186181 GGAATGAAAACAATGAGGAAAGG - Intronic
1107982931 13:45750670-45750692 GGATTGAGAGACAGGAGGCAGGG + Intergenic
1108033839 13:46265885-46265907 GTATTGAAAACAATGAGGCTAGG - Intronic
1110170095 13:72490332-72490354 GGACTGCCACAAAGGAGGCATGG - Intergenic
1110391099 13:74975191-74975213 TCATTGAAAGCAATGAGGCAGGG - Intergenic
1110894132 13:80727842-80727864 AAATAGAAACAAGTGAGGCAAGG - Intergenic
1110962994 13:81654258-81654280 GGAAGGAAACAAAGGAGGAATGG + Intergenic
1111705321 13:91741388-91741410 TTAATGAAAGAAATGAGGCAGGG + Intronic
1115501786 14:34056464-34056486 GGATTGAAACATATGATGACAGG - Intronic
1116179197 14:41514281-41514303 AGGTGGAAACAAATGAGTCATGG + Intergenic
1117784028 14:59263947-59263969 GGATGGAGACAAATTAGGAAGGG - Intronic
1118500747 14:66360331-66360353 GGCTGGAAACAAATGAGGACAGG + Intergenic
1118891005 14:69908848-69908870 AGATTAAAAGAAAAGAGGCAAGG - Intronic
1119399151 14:74349938-74349960 GGTATGAAACCAAGGAGGCAAGG - Intronic
1121486675 14:94321687-94321709 GGAGTGAGCCAGATGAGGCAGGG - Intronic
1122024553 14:98866323-98866345 GGCTTGAAAAAAAAAAGGCATGG + Intergenic
1123689798 15:22828534-22828556 TGAATGAAACAAATGAGTCGTGG - Exonic
1123691640 15:22843034-22843056 GGTTTGGAACAAATGATGCAGGG + Intronic
1125915570 15:43484318-43484340 GGATTGAAGCAGATGAAGAATGG - Intronic
1126362364 15:47859594-47859616 GGATTGAATAAAATGAGACAAGG - Intergenic
1126558341 15:50016043-50016065 GGATTTATATAAATTAGGCAGGG - Intronic
1127350920 15:58151253-58151275 AGATTGAAACTAGTAAGGCAAGG - Intronic
1128414011 15:67427276-67427298 GGATCCAAGCACATGAGGCATGG - Intronic
1128897946 15:71393013-71393035 GGATTTGAACAAATGAGAAACGG - Intronic
1130963416 15:88680306-88680328 TTCTTCAAACAAATGAGGCAAGG - Intergenic
1133992828 16:10723115-10723137 AGATTGAAACTAGTAAGGCAAGG + Intergenic
1134197853 16:12172605-12172627 GGATTAAATGAAATCAGGCAAGG + Intronic
1135396094 16:22132751-22132773 GGATGGAAAGAGATGAGGCTGGG - Intronic
1136098950 16:27979156-27979178 GGATTCAAACAAGCCAGGCATGG + Intronic
1136244238 16:28964212-28964234 GAGTTGAAACAAATGAGGGTTGG + Exonic
1136733168 16:32438251-32438273 GTATTTAAACAAATAAGGCTGGG + Intergenic
1138339773 16:56281076-56281098 GGTTAAAAAAAAATGAGGCATGG + Intronic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1139712012 16:68783070-68783092 GGGTTGAACCAAAGGAGGGATGG - Intronic
1139809322 16:69599592-69599614 GGAGTGAAAAAAATAAAGCAGGG + Intronic
1140860069 16:79010612-79010634 GGTATGAAACAAATCAGGGAAGG + Intronic
1142401551 16:89861270-89861292 GGATTTAATCAACTGAGGTAAGG + Intronic
1203019915 16_KI270728v1_random:391352-391374 GTATTTAAACAAATAAGGCTGGG - Intergenic
1203038250 16_KI270728v1_random:664510-664532 GTATTTAAACAAATAAGGCTGGG - Intergenic
1142626784 17:1197345-1197367 GGTTTGAAAAAAATTGGGCAGGG + Intronic
1145240247 17:21236766-21236788 GGCTGGAAAAAAATGGGGCAGGG + Intergenic
1146803558 17:35846765-35846787 GTACAGAAATAAATGAGGCATGG + Intronic
1149999025 17:61420782-61420804 GGATTAAGAGAAATGAGGCCAGG - Intergenic
1151693747 17:75703495-75703517 GGACTCAAACAAAAGAGACAGGG - Intronic
1152088898 17:78236311-78236333 GGTTTGGCACAGATGAGGCAGGG + Intronic
1155474015 18:26220264-26220286 TGATTGAAACAAGTGAAGAATGG + Intergenic
1155992068 18:32287989-32288011 TGATTCATACAAATGAGGCACGG + Exonic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1159257582 18:65967231-65967253 TGAATGAAGCAAATGAGGGAGGG - Intergenic
1160293656 18:77618025-77618047 GGATTGAAACAGAAGACACAGGG + Intergenic
1167900026 19:52613844-52613866 CGAATGTAACAAATGTGGCAAGG - Exonic
925681228 2:6423611-6423633 GCTTTGAAACAAAGAAGGCATGG + Intergenic
926555709 2:14355491-14355513 GGATTGAGAGAATTGAGGGATGG - Intergenic
926710644 2:15876791-15876813 GGATTTAATCAAATGATGTATGG - Intergenic
927703226 2:25281073-25281095 GGAGTGAAACAGATGAGGAAAGG - Intronic
927708763 2:25312659-25312681 CTCTTGAAACAAATGGGGCAGGG - Intronic
928599735 2:32892772-32892794 GGAGTGAAACCAATGAAGCAGGG - Intergenic
929772709 2:44905899-44905921 GGATTGAAAAAAAGGAGCTAAGG - Intergenic
929925803 2:46207351-46207373 GGAATGAGACAAACTAGGCACGG - Intergenic
930891839 2:56398930-56398952 TAAGTGAAACAAATGACGCAAGG - Intergenic
931598073 2:63972588-63972610 AGATAGAAACAAATTAGGCCAGG + Intronic
931946224 2:67311194-67311216 GGGTTGAATCAAATGATGAAAGG + Intergenic
933467810 2:82677630-82677652 GGCATGAATAAAATGAGGCAGGG - Intergenic
933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG + Intronic
934312544 2:91881010-91881032 GTATTTAAACAAATAAGGCTGGG - Intergenic
934922997 2:98360678-98360700 GTATTGAAAATAATGAGGCCGGG + Intronic
935756358 2:106278881-106278903 GGATTCAAAGAAAAGTGGCAAGG - Intergenic
936590850 2:113802591-113802613 GGGTTGAAATAACTGATGCATGG + Intergenic
937653870 2:124352153-124352175 GGATTTGATGAAATGAGGCAAGG - Intronic
940503045 2:154518727-154518749 GGTTTGAGACAAATGCAGCATGG + Intergenic
941568963 2:167145368-167145390 GAATTGAAAGAAAAGAGGAAGGG + Intronic
942145200 2:173019814-173019836 GGAATGAAGCAAATGAAGGAGGG - Intronic
942885001 2:180912414-180912436 GGATTGACACAGAAGAGCCAAGG + Intergenic
944151087 2:196559594-196559616 GGATGCAAACAACAGAGGCATGG + Intronic
944741571 2:202617914-202617936 AGATTGAAACTAGTAAGGCAAGG - Intergenic
944955680 2:204805721-204805743 GGATTTATACCAATGATGCAAGG + Intronic
945143624 2:206714022-206714044 TGATTCAAACATATGTGGCAAGG + Intronic
945752625 2:213807208-213807230 GTATGGAAGCAAATGAGTCAAGG - Intronic
947753525 2:232544999-232545021 GGATGGAAAAACATGAGGCCGGG + Intronic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1170173429 20:13440871-13440893 GCATTGCTACAAATGAAGCAAGG - Intronic
1172045244 20:32075502-32075524 CGAATGAATCAAATGAGGGATGG - Intronic
1174512267 20:51062689-51062711 GGATGGAAAGAAAAAAGGCAAGG - Intergenic
1175117697 20:56694650-56694672 GAAATGAAACAAAGGAGGCCAGG + Intergenic
1175345273 20:58268568-58268590 TGATGGAAACAAAGGAGACAGGG + Intergenic
1176950623 21:15042277-15042299 GGATAGAAACAGATGAAGGAAGG - Intronic
1178876245 21:36416327-36416349 CGATGAAAACAAAGGAGGCACGG + Exonic
1180986045 22:19904438-19904460 GGATGCAAACAAAGGAGGAAGGG + Intronic
1184268087 22:43360807-43360829 TGATTGAAAGAAACGGGGCAGGG - Intergenic
949634427 3:5967501-5967523 GGAATGAAAAAAAGGAGGGAAGG - Intergenic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
950840960 3:15967961-15967983 GGATTGAAATAGATAAGGGAAGG - Intergenic
954984307 3:54776179-54776201 GGATAGAAACAGATCAGCCAGGG + Intronic
955023536 3:55144734-55144756 GGAGAGAAACAAATGAGCCCTGG - Intergenic
956357679 3:68412081-68412103 GGATTTACACACATGAGGCCAGG - Intronic
956951341 3:74286949-74286971 GGATTCACACACCTGAGGCAGGG + Intronic
957550159 3:81694160-81694182 GGATGGAAGGAAATGAGGGAAGG + Intronic
958421077 3:93932376-93932398 GAAGTGAAACAAATGAGTAAGGG - Intronic
958604558 3:96340478-96340500 GAAATGAGACAGATGAGGCATGG + Intergenic
959093945 3:101933484-101933506 GGAAGGAAAGAAATGAGGCAGGG + Intergenic
959130225 3:102346037-102346059 GGAATGAAACAAATTAGAAATGG + Intronic
960002357 3:112746243-112746265 AGATTGAAAGACATGAGGCCGGG + Intronic
961581864 3:127889789-127889811 GGATTGAAAGAATCAAGGCAGGG + Intergenic
961855125 3:129862622-129862644 AGATGGAAACAAATGAGGTTAGG + Intronic
962490560 3:135889797-135889819 GGACTGCAGCAAATGAAGCAGGG - Intergenic
963310435 3:143704695-143704717 GGATTAAAAAAAATGTGGCTTGG + Intronic
964390500 3:156191793-156191815 GGATAGCATTAAATGAGGCAGGG - Intronic
965313294 3:167158675-167158697 GGTTGAAAAGAAATGAGGCAAGG + Intergenic
967267513 3:187703561-187703583 GAATTAAAACAACTGAGGCCTGG + Intronic
967488554 3:190062221-190062243 GGGTTGAAGCAAATAAGGAAGGG - Intronic
969303924 4:6314266-6314288 AGAAGGAAACACATGAGGCAGGG - Intergenic
969332761 4:6489260-6489282 GGCATGAAACAAATGAAACAGGG - Intronic
970384793 4:15545443-15545465 GGACTGAAACTCCTGAGGCAGGG - Intronic
971088987 4:23317478-23317500 AGATTGAAACAAATAATGGAGGG - Intergenic
971175198 4:24275957-24275979 GAATTGAAGGAAATGAGGGAAGG + Intergenic
971674532 4:29608721-29608743 AGATTGAAAGTAATGAGGCATGG + Intergenic
973152517 4:46906122-46906144 GGATTGAAATATATGGGGCCGGG - Intronic
975782365 4:77853000-77853022 GGATTGAAATAAATGTGGACAGG + Intergenic
977742705 4:100505562-100505584 GGATTCACCCACATGAGGCAAGG + Intronic
977944744 4:102899030-102899052 GTATTTAAACAAATAAGGCTGGG - Intronic
980462413 4:133133023-133133045 GGTTTGCAGCTAATGAGGCATGG + Intergenic
980813256 4:137911156-137911178 GGCTTGAATCAAGTGAGGCATGG + Intergenic
981767700 4:148270529-148270551 GGTTTGAAATAAATATGGCATGG - Intronic
982300934 4:153878906-153878928 GGATTGTGACAAAGGTGGCATGG + Intergenic
982442779 4:155456458-155456480 AGATTGAAACTAGTAAGGCAAGG + Intergenic
982910178 4:161131354-161131376 GGATTGTAGCAAATGTGGCATGG - Intergenic
983276478 4:165623662-165623684 AGATTGAGAGAAATGAGACAGGG - Intergenic
984418681 4:179492226-179492248 AGATTGTAACAATTGAGACATGG - Intergenic
985021735 4:185698592-185698614 GTACTGAATCATATGAGGCAGGG + Intronic
985166997 4:187107255-187107277 GGATTTGAACAGAGGAGGCAGGG - Intergenic
988484974 5:31661104-31661126 GGAAAGAAACAAATGAGAAAGGG + Intronic
990942445 5:61216140-61216162 GGCTTGAAAGAAATAAGGCCTGG - Intergenic
991673743 5:69072924-69072946 AGAAGGAAACAAATGAGACACGG + Intergenic
992728721 5:79636353-79636375 TGATTCAAACTAATGAGGGAGGG - Intronic
993516358 5:88840578-88840600 GGCTAGAAACAAATCTGGCAAGG - Intronic
993569582 5:89520671-89520693 TGATTGAAAGAAAAGAGGAAGGG + Intergenic
995678761 5:114694086-114694108 GGAGTGAAACAAATGAGAAGAGG - Intergenic
995707613 5:115001225-115001247 GTATTGAAATAGAAGAGGCATGG - Intergenic
995915595 5:117241616-117241638 AGAGTGAAAAAAATGAGGCTTGG + Intergenic
997480495 5:134180745-134180767 GGATTCTCACAAATTAGGCATGG - Intronic
999356089 5:150932908-150932930 GGATTAGAACAATTTAGGCATGG - Intergenic
1000245807 5:159447549-159447571 GGATGGAAACAAACCAGGGAAGG + Intergenic
1003377993 6:5596884-5596906 GGATTTAACCAAGTTAGGCAGGG - Intronic
1004953055 6:20695933-20695955 GGATTGGAAGAAAGGAGGAATGG - Intronic
1005160460 6:22855669-22855691 TATTTGAAACAAATGAGGGAAGG - Intergenic
1005322147 6:24666215-24666237 GGTTTGAAACAAATGAACGAAGG - Intronic
1005791262 6:29303541-29303563 GAATTGAACCAAATGTGCCAGGG + Intergenic
1005807546 6:29488581-29488603 GGTTTGAAAGAGATGAGACATGG - Intergenic
1009372731 6:62927620-62927642 AGATTGGAAAAAATGATGCAAGG + Intergenic
1010392378 6:75352479-75352501 GGATTGCCACAATTGAAGCAGGG - Intronic
1011990790 6:93514858-93514880 GGGATGAAACAAAGGAGACAAGG - Intergenic
1012608138 6:101183425-101183447 GTATTGAAAGAACTGATGCAAGG + Intergenic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1013538473 6:111085114-111085136 TAATTGTAACAAATGAGGCAAGG - Intergenic
1013954824 6:115829483-115829505 GGAATGAATGAAATGAGGTAAGG - Intergenic
1018365152 6:163112469-163112491 GGCTTGCAACAAATGAGGGAGGG - Intronic
1020645994 7:10814909-10814931 GGATTGAAAAAAATTAGAAAAGG - Intergenic
1020665692 7:11039198-11039220 GGAAAGAAAAAAATGTGGCAGGG - Intronic
1022299675 7:29091382-29091404 GGATTTAAACCAAAGAGGGATGG + Intronic
1022362291 7:29673154-29673176 AGATTTATACAAATGAGGGAGGG + Intergenic
1022428995 7:30297155-30297177 AGATTTATACAAATGAGGGAGGG - Intronic
1022647755 7:32247142-32247164 GGATTTTAACAAATGAAGAAAGG + Intronic
1022699105 7:32740591-32740613 AGATTTATACAAATGAGGGAGGG - Intergenic
1024782743 7:52870715-52870737 GGATTAAAAAAAATGTGGTATGG + Intergenic
1025229553 7:57192626-57192648 AGATTGAAACTAGTAAGGCAAGG - Intergenic
1026039358 7:66854294-66854316 GAATTTTAACAAATGAGGCCGGG - Intergenic
1027243032 7:76345645-76345667 AGATTTAAAAAAATGAGGCCTGG + Intronic
1027531091 7:79333419-79333441 TTATTGAAAAAAATGAGGCCGGG - Intronic
1027773078 7:82431742-82431764 GGATTAAAAAACATGAGGCCAGG + Intronic
1027885945 7:83904938-83904960 GGATTGAAACAACTGAGTACAGG + Intergenic
1028613175 7:92734737-92734759 GGATAGGGACAAAAGAGGCATGG + Intronic
1028626510 7:92883446-92883468 GTATTGAAATAAACGAGGCTGGG + Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1030805217 7:113909452-113909474 GAATTCAAACAAAGAAGGCAGGG + Intronic
1032674028 7:134111580-134111602 GTAAGGAAACAAATGAGGGAGGG - Intergenic
1039011216 8:33095455-33095477 GGATGGAAAGAAAGGAGTCAAGG + Intergenic
1039225242 8:35380999-35381021 GGATGGCTACAAATGAAGCAGGG + Intronic
1041516492 8:58705085-58705107 AGATGGAGAGAAATGAGGCAGGG - Intergenic
1042436480 8:68772330-68772352 TGATTGAAACAAGAGAAGCATGG + Intronic
1042903527 8:73750405-73750427 TGATTAAAGCAAATGAGGCCAGG + Intronic
1043679944 8:83010953-83010975 GGATTGCAGAAAAAGAGGCATGG + Intergenic
1048240347 8:132735216-132735238 GAATTGCAACTAATGAGGAAAGG + Intronic
1050387641 9:5107857-5107879 AGATTGAAACTAATAAGGCAAGG - Intronic
1052237621 9:26231434-26231456 GGAGTGAAACAAATGGATCATGG + Intergenic
1053377485 9:37619940-37619962 GGATAGAAACAAATGAATCTGGG - Intronic
1055980775 9:81997964-81997986 GGAAGGAAACAAAGGAGGGATGG - Intergenic
1056095032 9:83243789-83243811 GGAATGAAACAAAAGGGGTAGGG - Intronic
1057106745 9:92426580-92426602 GGATAAAAATGAATGAGGCATGG + Intronic
1059361864 9:113749877-113749899 GGATTGAACCAAAATATGCAAGG - Intergenic
1060029942 9:120205611-120205633 GGATTCAAACTAATATGGCAGGG + Intergenic
1060042722 9:120313572-120313594 AGATTTAAACAAATTAGGAATGG + Intergenic
1060122139 9:121002865-121002887 GGATGGAGCCAAATGAGGGAGGG + Intronic
1060125426 9:121039985-121040007 GTAGTGAAACAAATCAGACATGG + Intronic
1060385581 9:123224837-123224859 GGAGTGAAACTAATGGGTCATGG - Intronic
1060896648 9:127223222-127223244 AGATAGACACAAAGGAGGCATGG + Intergenic
1061000106 9:127898059-127898081 GGATTCAAGCAGATGTGGCAAGG + Intronic
1062334842 9:136060563-136060585 GGACTGAACCAGATGAGTCAAGG - Intronic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1188581456 X:31718841-31718863 GGATTCAATGAAATGACGCATGG - Intronic
1188936921 X:36187418-36187440 GGATTGAACAAAATGAGGTTTGG + Intergenic
1189912713 X:45827352-45827374 GGATTAAAAGAAATGATGTATGG - Intergenic
1190403054 X:50058179-50058201 GCATTCAAAGAAATGGGGCAGGG - Intronic
1190755856 X:53401298-53401320 GGATTGAAACAAAGAGGACAAGG - Intronic
1191912989 X:66171526-66171548 GGAGAGAAAAAAATGAGTCATGG - Intronic
1192428933 X:71099861-71099883 GGATTGGAAGAAATAAGGCTGGG + Intronic
1192618034 X:72648294-72648316 AGATTGCAGAAAATGAGGCAAGG + Intronic
1196200305 X:112879140-112879162 GAATTCAAATAAAAGAGGCAGGG + Intergenic
1196903688 X:120411171-120411193 GGATTGAAACACATTATACAAGG + Intergenic
1197203423 X:123769252-123769274 TGCTTGTAACAAATGAGCCATGG - Intergenic
1197339002 X:125243339-125243361 GGATTTAAAGAATTCAGGCAGGG + Intergenic
1197456773 X:126685933-126685955 GTATTGAACAAAATGATGCATGG + Intergenic
1197592734 X:128428499-128428521 TGATTGACAGAAATGAAGCATGG - Intergenic
1198939456 X:141936946-141936968 AGATTTAAACAAATGATGGAAGG + Intergenic
1199652833 X:149963867-149963889 GGATTAAAACAAATGAGAAAAGG - Intergenic
1199809730 X:151337291-151337313 AGAGTGAGACAAATGAGGCATGG + Intergenic
1201711294 Y:16995797-16995819 GGATTGAAATACTTGAAGCATGG - Intergenic