ID: 1187202418

View in Genome Browser
Species Human (GRCh38)
Location X:17147849-17147871
Sequence CTTGGTTACAAGCATCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187202418_1187202421 19 Left 1187202418 X:17147849-17147871 CCTTCAGGATGCTTGTAACCAAG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1187202421 X:17147891-17147913 GTATGTATATCACATAGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1187202418_1187202422 23 Left 1187202418 X:17147849-17147871 CCTTCAGGATGCTTGTAACCAAG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1187202422 X:17147895-17147917 GTATATCACATAGAGTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187202418 Original CRISPR CTTGGTTACAAGCATCCTGA AGG (reversed) Exonic