ID: 1187202421

View in Genome Browser
Species Human (GRCh38)
Location X:17147891-17147913
Sequence GTATGTATATCACATAGAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187202418_1187202421 19 Left 1187202418 X:17147849-17147871 CCTTCAGGATGCTTGTAACCAAG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1187202421 X:17147891-17147913 GTATGTATATCACATAGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1187202420_1187202421 1 Left 1187202420 X:17147867-17147889 CCAAGTACTTTCAGGATGCTTTT 0: 1
1: 0
2: 1
3: 20
4: 251
Right 1187202421 X:17147891-17147913 GTATGTATATCACATAGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1187202417_1187202421 26 Left 1187202417 X:17147842-17147864 CCAAGAACCTTCAGGATGCTTGT 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1187202421 X:17147891-17147913 GTATGTATATCACATAGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187202421 Original CRISPR GTATGTATATCACATAGAGT AGG Exonic