ID: 1187203478

View in Genome Browser
Species Human (GRCh38)
Location X:17158751-17158773
Sequence GGGGAAAGAAACCACTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187203474_1187203478 22 Left 1187203474 X:17158706-17158728 CCTGTTTTTTCTATGTTGGCAAC No data
Right 1187203478 X:17158751-17158773 GGGGAAAGAAACCACTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187203478 Original CRISPR GGGGAAAGAAACCACTGTGC AGG Intergenic
No off target data available for this crispr