ID: 1187205242

View in Genome Browser
Species Human (GRCh38)
Location X:17175689-17175711
Sequence GTGTTAGGCCCCTCAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187205242_1187205245 16 Left 1187205242 X:17175689-17175711 CCCAATTCTGAGGGGCCTAACAC No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187205242 Original CRISPR GTGTTAGGCCCCTCAGAATT GGG (reversed) Intergenic
No off target data available for this crispr