ID: 1187205245

View in Genome Browser
Species Human (GRCh38)
Location X:17175728-17175750
Sequence TTGCTCACATAAAGTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187205243_1187205245 15 Left 1187205243 X:17175690-17175712 CCAATTCTGAGGGGCCTAACACA No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data
1187205240_1187205245 18 Left 1187205240 X:17175687-17175709 CCCCCAATTCTGAGGGGCCTAAC No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data
1187205242_1187205245 16 Left 1187205242 X:17175689-17175711 CCCAATTCTGAGGGGCCTAACAC No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data
1187205241_1187205245 17 Left 1187205241 X:17175688-17175710 CCCCAATTCTGAGGGGCCTAACA No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data
1187205244_1187205245 1 Left 1187205244 X:17175704-17175726 CCTAACACAATAGACATTTATTT No data
Right 1187205245 X:17175728-17175750 TTGCTCACATAAAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187205245 Original CRISPR TTGCTCACATAAAGTCCAGC TGG Intergenic