ID: 1187205733

View in Genome Browser
Species Human (GRCh38)
Location X:17179257-17179279
Sequence CTATTTCCACAAATAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187205729_1187205733 10 Left 1187205729 X:17179224-17179246 CCTCCCTTTGGAGCTGGCTGGGT No data
Right 1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG No data
1187205727_1187205733 11 Left 1187205727 X:17179223-17179245 CCCTCCCTTTGGAGCTGGCTGGG No data
Right 1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG No data
1187205732_1187205733 6 Left 1187205732 X:17179228-17179250 CCTTTGGAGCTGGCTGGGTGGAT No data
Right 1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG No data
1187205731_1187205733 7 Left 1187205731 X:17179227-17179249 CCCTTTGGAGCTGGCTGGGTGGA No data
Right 1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG No data
1187205725_1187205733 12 Left 1187205725 X:17179222-17179244 CCCCTCCCTTTGGAGCTGGCTGG No data
Right 1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187205733 Original CRISPR CTATTTCCACAAATAGAATG TGG Intergenic
No off target data available for this crispr