ID: 1187207712

View in Genome Browser
Species Human (GRCh38)
Location X:17198642-17198664
Sequence GGTGCTGGCAGTTGGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187207712_1187207722 14 Left 1187207712 X:17198642-17198664 CCTGACATCCAACTGCCAGCACC No data
Right 1187207722 X:17198679-17198701 TAAGAGGTTTATCTGGCAATTGG No data
1187207712_1187207720 7 Left 1187207712 X:17198642-17198664 CCTGACATCCAACTGCCAGCACC No data
Right 1187207720 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
1187207712_1187207716 -2 Left 1187207712 X:17198642-17198664 CCTGACATCCAACTGCCAGCACC No data
Right 1187207716 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
1187207712_1187207723 30 Left 1187207712 X:17198642-17198664 CCTGACATCCAACTGCCAGCACC No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187207712 Original CRISPR GGTGCTGGCAGTTGGATGTC AGG (reversed) Intergenic
No off target data available for this crispr