ID: 1187207713

View in Genome Browser
Species Human (GRCh38)
Location X:17198650-17198672
Sequence GGGTTGCAGGTGCTGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187207713_1187207725 27 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207725 X:17198700-17198722 GGAACAAGTTTGCCCTGGGAAGG No data
1187207713_1187207724 23 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207724 X:17198696-17198718 AATTGGAACAAGTTTGCCCTGGG No data
1187207713_1187207723 22 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207713_1187207722 6 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207722 X:17198679-17198701 TAAGAGGTTTATCTGGCAATTGG No data
1187207713_1187207716 -10 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207716 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
1187207713_1187207720 -1 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207720 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187207713 Original CRISPR GGGTTGCAGGTGCTGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr