ID: 1187207715

View in Genome Browser
Species Human (GRCh38)
Location X:17198663-17198685
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187207715_1187207723 9 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207715_1187207724 10 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207724 X:17198696-17198718 AATTGGAACAAGTTTGCCCTGGG No data
1187207715_1187207730 28 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207730 X:17198714-17198736 CTGGGAAGGCCGGTAGTGCTGGG No data
1187207715_1187207725 14 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207725 X:17198700-17198722 GGAACAAGTTTGCCCTGGGAAGG No data
1187207715_1187207729 27 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207729 X:17198713-17198735 CCTGGGAAGGCCGGTAGTGCTGG No data
1187207715_1187207722 -7 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207722 X:17198679-17198701 TAAGAGGTTTATCTGGCAATTGG No data
1187207715_1187207731 29 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207731 X:17198715-17198737 TGGGAAGGCCGGTAGTGCTGGGG No data
1187207715_1187207726 18 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207726 X:17198704-17198726 CAAGTTTGCCCTGGGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187207715 Original CRISPR CCTCTTAGGCAAGGGGTTGC AGG (reversed) Intergenic
No off target data available for this crispr