ID: 1187207719

View in Genome Browser
Species Human (GRCh38)
Location X:17198672-17198694
Sequence CCAGATAAACCTCTTAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187207719_1187207729 18 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207729 X:17198713-17198735 CCTGGGAAGGCCGGTAGTGCTGG No data
1187207719_1187207726 9 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207726 X:17198704-17198726 CAAGTTTGCCCTGGGAAGGCCGG No data
1187207719_1187207725 5 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207725 X:17198700-17198722 GGAACAAGTTTGCCCTGGGAAGG No data
1187207719_1187207723 0 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207719_1187207730 19 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207730 X:17198714-17198736 CTGGGAAGGCCGGTAGTGCTGGG No data
1187207719_1187207731 20 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207731 X:17198715-17198737 TGGGAAGGCCGGTAGTGCTGGGG No data
1187207719_1187207724 1 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207724 X:17198696-17198718 AATTGGAACAAGTTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187207719 Original CRISPR CCAGATAAACCTCTTAGGCA AGG (reversed) Intergenic
No off target data available for this crispr