ID: 1187207723

View in Genome Browser
Species Human (GRCh38)
Location X:17198695-17198717
Sequence CAATTGGAACAAGTTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187207714_1187207723 15 Left 1187207714 X:17198657-17198679 CCAGCACCTGCAACCCCTTGCCT No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207715_1187207723 9 Left 1187207715 X:17198663-17198685 CCTGCAACCCCTTGCCTAAGAGG No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207713_1187207723 22 Left 1187207713 X:17198650-17198672 CCAACTGCCAGCACCTGCAACCC No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207721_1187207723 -5 Left 1187207721 X:17198677-17198699 CCTAAGAGGTTTATCTGGCAATT No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207712_1187207723 30 Left 1187207712 X:17198642-17198664 CCTGACATCCAACTGCCAGCACC No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207717_1187207723 2 Left 1187207717 X:17198670-17198692 CCCCTTGCCTAAGAGGTTTATCT No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207718_1187207723 1 Left 1187207718 X:17198671-17198693 CCCTTGCCTAAGAGGTTTATCTG No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data
1187207719_1187207723 0 Left 1187207719 X:17198672-17198694 CCTTGCCTAAGAGGTTTATCTGG No data
Right 1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187207723 Original CRISPR CAATTGGAACAAGTTTGCCC TGG Intergenic
No off target data available for this crispr