ID: 1187210168

View in Genome Browser
Species Human (GRCh38)
Location X:17222368-17222390
Sequence AGAATAATGATATGTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187210164_1187210168 -3 Left 1187210164 X:17222348-17222370 CCCATTTTGTAACAAGATATAGA No data
Right 1187210168 X:17222368-17222390 AGAATAATGATATGTGGAGGTGG No data
1187210162_1187210168 20 Left 1187210162 X:17222325-17222347 CCTGAATGGTATTGAGTATTTGG No data
Right 1187210168 X:17222368-17222390 AGAATAATGATATGTGGAGGTGG No data
1187210165_1187210168 -4 Left 1187210165 X:17222349-17222371 CCATTTTGTAACAAGATATAGAA No data
Right 1187210168 X:17222368-17222390 AGAATAATGATATGTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187210168 Original CRISPR AGAATAATGATATGTGGAGG TGG Intergenic
No off target data available for this crispr