ID: 1187212454

View in Genome Browser
Species Human (GRCh38)
Location X:17244802-17244824
Sequence CGGGGTGGCCGCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187212443_1187212454 12 Left 1187212443 X:17244767-17244789 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG No data
1187212439_1187212454 28 Left 1187212439 X:17244751-17244773 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG No data
1187212441_1187212454 13 Left 1187212441 X:17244766-17244788 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187212454 Original CRISPR CGGGGTGGCCGCCGGGCAGA GGG Intergenic
No off target data available for this crispr