ID: 1187212844

View in Genome Browser
Species Human (GRCh38)
Location X:17246914-17246936
Sequence CTTCCTAAAGGGAACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187212836_1187212844 13 Left 1187212836 X:17246878-17246900 CCAGGTAGGTCTCAGTTATATGA No data
Right 1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187212844 Original CRISPR CTTCCTAAAGGGAACTTGGG AGG Intergenic
No off target data available for this crispr