ID: 1187215619

View in Genome Browser
Species Human (GRCh38)
Location X:17273151-17273173
Sequence ACCACAGTAATAGTTGTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187215619_1187215620 -10 Left 1187215619 X:17273151-17273173 CCGGTAACAACTATTACTGTGGT No data
Right 1187215620 X:17273164-17273186 TTACTGTGGTCTTTGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187215619 Original CRISPR ACCACAGTAATAGTTGTTAC CGG (reversed) Intergenic
No off target data available for this crispr