ID: 1187216641

View in Genome Browser
Species Human (GRCh38)
Location X:17283283-17283305
Sequence GGTTCCAGTGGAGGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187216634_1187216641 -2 Left 1187216634 X:17283262-17283284 CCAGCTGTGTAGCTTGCACATGG No data
Right 1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG No data
1187216631_1187216641 30 Left 1187216631 X:17283230-17283252 CCTGCAGCAGGCCAAGTGCTTCA No data
Right 1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG No data
1187216632_1187216641 19 Left 1187216632 X:17283241-17283263 CCAAGTGCTTCAAAACTGTTCCC No data
Right 1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG No data
1187216633_1187216641 -1 Left 1187216633 X:17283261-17283283 CCCAGCTGTGTAGCTTGCACATG No data
Right 1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187216641 Original CRISPR GGTTCCAGTGGAGGGGAAGC GGG Intergenic
No off target data available for this crispr