ID: 1187217927

View in Genome Browser
Species Human (GRCh38)
Location X:17295199-17295221
Sequence TAGAACCCCCAAAATGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187217922_1187217927 7 Left 1187217922 X:17295169-17295191 CCTAGAGAAGCCATACTAATTGG No data
Right 1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG No data
1187217920_1187217927 9 Left 1187217920 X:17295167-17295189 CCCCTAGAGAAGCCATACTAATT No data
Right 1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG No data
1187217925_1187217927 -3 Left 1187217925 X:17295179-17295201 CCATACTAATTGGGTGATTTTAG No data
Right 1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG No data
1187217921_1187217927 8 Left 1187217921 X:17295168-17295190 CCCTAGAGAAGCCATACTAATTG No data
Right 1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG No data
1187217919_1187217927 10 Left 1187217919 X:17295166-17295188 CCCCCTAGAGAAGCCATACTAAT No data
Right 1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187217927 Original CRISPR TAGAACCCCCAAAATGGAGA TGG Intergenic
No off target data available for this crispr