ID: 1187218086

View in Genome Browser
Species Human (GRCh38)
Location X:17296481-17296503
Sequence AGGAGAAGCCAGGATCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187218086_1187218092 29 Left 1187218086 X:17296481-17296503 CCCATAAGATCCTGGCTTCTCCT No data
Right 1187218092 X:17296533-17296555 TAGCCTAGCCAGAGAGCCTAGGG No data
1187218086_1187218091 28 Left 1187218086 X:17296481-17296503 CCCATAAGATCCTGGCTTCTCCT No data
Right 1187218091 X:17296532-17296554 CTAGCCTAGCCAGAGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187218086 Original CRISPR AGGAGAAGCCAGGATCTTAT GGG (reversed) Intergenic
No off target data available for this crispr