ID: 1187218110

View in Genome Browser
Species Human (GRCh38)
Location X:17296721-17296743
Sequence AAATGTGGCCAGTTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187218106_1187218110 1 Left 1187218106 X:17296697-17296719 CCACAGGTGGCTATTGAACACTT No data
Right 1187218110 X:17296721-17296743 AAATGTGGCCAGTTGGAACTGGG No data
1187218102_1187218110 24 Left 1187218102 X:17296674-17296696 CCGTCCAATATAATAGACAGTAG No data
Right 1187218110 X:17296721-17296743 AAATGTGGCCAGTTGGAACTGGG No data
1187218103_1187218110 20 Left 1187218103 X:17296678-17296700 CCAATATAATAGACAGTAGCCAC No data
Right 1187218110 X:17296721-17296743 AAATGTGGCCAGTTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187218110 Original CRISPR AAATGTGGCCAGTTGGAACT GGG Intergenic
No off target data available for this crispr