ID: 1187225786

View in Genome Browser
Species Human (GRCh38)
Location X:17374923-17374945
Sequence CAGTAAGCGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187225786_1187225792 3 Left 1187225786 X:17374923-17374945 CCCTCTTCCCTCTGCGCTTACTG No data
Right 1187225792 X:17374949-17374971 ACACCCCTACTCCCAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187225786 Original CRISPR CAGTAAGCGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr