ID: 1187226473

View in Genome Browser
Species Human (GRCh38)
Location X:17378318-17378340
Sequence TTGTACATGAATAATAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187226473 Original CRISPR TTGTACATGAATAATAAAGA TGG Intronic
900233172 1:1572761-1572783 CTGTACCTGCATAACAAAGATGG - Intronic
900806829 1:4773010-4773032 TTACACATGAGTAATAAAAAAGG - Intronic
901218656 1:7569820-7569842 TGGTACAGTAATAATAATGATGG - Intronic
901266926 1:7918154-7918176 TTGTACATGTTTAGTAGAGATGG + Exonic
902755254 1:18545244-18545266 TTTTCCAGGAAAAATAAAGAAGG - Intergenic
902788655 1:18750003-18750025 TTGTACATGAAGAATTGATAAGG + Intergenic
904599383 1:31665289-31665311 ATGCACAGGAAGAATAAAGAAGG - Intronic
905008139 1:34727888-34727910 GTGTTCAAGAATAATAATGAAGG + Intronic
907640081 1:56179844-56179866 TTGCACTTGAATGCTAAAGAAGG + Intergenic
909266897 1:73571093-73571115 TTGTACATAAATAAGCAAGGAGG + Intergenic
910558396 1:88562824-88562846 TTGCACATGAAGAATATAAAAGG - Intergenic
910671813 1:89781336-89781358 ATGTATAATAATAATAAAGATGG + Intronic
911841740 1:102690711-102690733 TTGTAAATAATTAATAATGAAGG - Intergenic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
913031152 1:114904030-114904052 TTGAAAATGAATAATAAAGTTGG - Intronic
913678084 1:121161253-121161275 TTGTACACTTATAGTAAAGATGG - Intergenic
914029921 1:143948882-143948904 TTGTACACTTATAGTAAAGATGG - Intronic
914159528 1:145119068-145119090 TTGTACACTTATAGTAAAGATGG + Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
917084738 1:171294184-171294206 ATCTACAGGAATACTAAAGAAGG + Intergenic
917961817 1:180151713-180151735 TTATGCATGAATAAAAGAGAGGG - Intergenic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918510029 1:185302229-185302251 ATATACAGGAATACTAAAGAGGG + Intronic
918663552 1:187119080-187119102 TTTTACATAAATAATAATCAAGG - Intergenic
918858608 1:189792116-189792138 TTGCACATGAATAATGTTGATGG + Intergenic
918930914 1:190855857-190855879 CTGTACAGGAAGAATAAAGCTGG - Intergenic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919160514 1:193824359-193824381 TATTACATGAATAATAATGGTGG - Intergenic
920465385 1:206179766-206179788 TTGTACACTTATAGTAAAGATGG - Intergenic
920893766 1:210022498-210022520 TGGTACATGAATAGTAGAGCAGG + Intronic
921420155 1:214937764-214937786 TTATACATGAAAAATAAATGTGG + Intergenic
922007202 1:221543513-221543535 TTGTGCAGGAAAAATAAAAAAGG + Intergenic
922046572 1:221951184-221951206 ATGTAAAGGAATAGTAAAGAAGG - Intergenic
923579922 1:235199845-235199867 TCTTACAAGAAAAATAAAGATGG + Intronic
923687634 1:236164330-236164352 ATGTACAAGAATGAAAAAGAGGG - Intronic
924374687 1:243392996-243393018 TTGAAAATTAATAATAAAAAAGG + Intronic
924687128 1:246305526-246305548 TTAAAAATGAATATTAAAGAGGG + Intronic
1063396178 10:5690156-5690178 TTGTAGAGTAATAATAAAGTAGG - Intronic
1064617608 10:17178096-17178118 TAGAAAATAAATAATAAAGAAGG - Intronic
1064907876 10:20367439-20367461 ATGTAAATGAATAAAAAAGCTGG - Intergenic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1065428842 10:25633161-25633183 TTGTACTTTATTAATAAAAATGG - Intergenic
1065563718 10:26988616-26988638 ATCTACAGGAATACTAAAGAAGG + Intergenic
1066505943 10:36043259-36043281 TTGAAAATGAATAATAGAGTTGG - Intergenic
1067317085 10:45178895-45178917 TTGTGCTTCAATAAAAAAGAAGG + Intergenic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069412413 10:68167031-68167053 TTGTCCAGGAAAAAAAAAGATGG + Intronic
1069760518 10:70807854-70807876 TTGTTGATTAAGAATAAAGAGGG + Intergenic
1071067347 10:81652001-81652023 TTGAACAAAAATAATAAAGCTGG - Intergenic
1071303785 10:84279351-84279373 TTGGAAAGGAAAAATAAAGAAGG + Intergenic
1071760178 10:88594432-88594454 TTGTATATGAAAAATAGAGTAGG - Intronic
1072105270 10:92267736-92267758 TTGTTAATCAATAATAAACATGG - Intronic
1073978829 10:109131265-109131287 TTTTACATCATCAATAAAGATGG + Intergenic
1074399875 10:113133273-113133295 TCGTACCTGGAAAATAAAGAAGG - Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1075371368 10:121938333-121938355 TTATCCATGAGTAATAAAGGGGG + Intergenic
1078151490 11:8763141-8763163 TTGTTGATGACTAATAAAGTTGG - Intronic
1079199796 11:18366559-18366581 GAGTCCCTGAATAATAAAGAGGG + Exonic
1079301234 11:19280731-19280753 TTGAACAGATATAATAAAGAAGG - Intergenic
1079663043 11:23065852-23065874 TTTTAAATGAAGAATAAAGTAGG - Intergenic
1081176199 11:39930036-39930058 TTGTACATGACTAAAAAAATTGG - Intergenic
1081218872 11:40436038-40436060 TTGAACAAGAAAATTAAAGAAGG - Intronic
1081350310 11:42044107-42044129 TTGTAATTGAAAAATAATGAAGG + Intergenic
1082620718 11:55418296-55418318 TACTCCATGAATAATAAATAAGG + Intergenic
1082678008 11:56132851-56132873 TTGAACATCAATGATACAGAGGG + Intergenic
1082858093 11:57827540-57827562 TGGTACATAAATATTTAAGAAGG + Intergenic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1085551502 11:77377613-77377635 TTGTTCATGAATACTTAAGTAGG + Intronic
1086600659 11:88629512-88629534 TTGTCCGTGATCAATAAAGAAGG - Intronic
1086813492 11:91339737-91339759 TACCACATAAATAATAAAGATGG + Intergenic
1086817804 11:91394782-91394804 CTGGAGATGATTAATAAAGATGG + Intergenic
1087128899 11:94652087-94652109 TTGTATATCAATCATAGAGAAGG - Intergenic
1087424952 11:97973553-97973575 GTGCACATGTATAAAAAAGATGG + Intergenic
1087917579 11:103829111-103829133 TTGCAACTGTATAATAAAGATGG - Intergenic
1089581410 11:119483868-119483890 TTGTCCATGAATAAAAAAGCGGG - Intergenic
1090132543 11:124159792-124159814 TTGTAGATGCATAAAAATGAGGG - Intergenic
1090210847 11:124920356-124920378 CTGTTCATGAATAAAAGAGATGG - Exonic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090760345 11:129831893-129831915 TTTTACATTTATAATAGAGATGG - Intronic
1091245682 11:134092516-134092538 TGGAACATGATGAATAAAGAGGG - Intronic
1091245757 11:134093126-134093148 TAGAACATGATGAATAAAGAGGG - Intronic
1091517818 12:1202701-1202723 TGATTCATGAATAATAAAGTAGG + Intronic
1092018160 12:5177057-5177079 CTCCACATGAAGAATAAAGATGG - Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093502719 12:19830591-19830613 TTGTACATCTATCATAAACAAGG - Intergenic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1093849181 12:24015425-24015447 TTATACAAAAACAATAAAGAGGG + Intergenic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095593593 12:43933912-43933934 TTTTACTTGAATTATAAAAATGG + Intronic
1095901434 12:47332603-47332625 TTCTACATGTATATTAAAGAGGG + Intergenic
1096003187 12:48146515-48146537 TTCTACTTGAATAATATTGAAGG - Intergenic
1097353412 12:58574246-58574268 TTGTGAATGAATAATCAAAAGGG - Intronic
1097496465 12:60343837-60343859 CTGAACAAGAAAAATAAAGAAGG - Intergenic
1099156908 12:79188904-79188926 TTTTATAAGAATAATAAAGTGGG - Intronic
1100129280 12:91470541-91470563 TTTTATAATAATAATAAAGATGG - Intergenic
1100936276 12:99670896-99670918 TGGTACATGAAAAATAAATCAGG + Intronic
1103071551 12:117948076-117948098 TTGAAAAAGAATAATAAAGGTGG + Intronic
1103855567 12:123967392-123967414 TTGCACATTGATAAGAAAGATGG - Intronic
1104004730 12:124884012-124884034 TGTTACATGAATAACAAAGCTGG - Intergenic
1105314015 13:19240611-19240633 GTGTAGATGAATAAGAAATATGG + Intergenic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1106166112 13:27248067-27248089 TTGTACATGGATAAAAATGATGG + Intergenic
1106731957 13:32551030-32551052 TAGTGCATGTATAATAAATATGG + Intergenic
1106998064 13:35510616-35510638 TTGCAAAGGAATAAAAAAGAAGG + Intronic
1107179961 13:37447326-37447348 GTGTAAAGGACTAATAAAGAAGG + Intergenic
1107877455 13:44803340-44803362 GTGTACATGAAATATAAAGTAGG + Intergenic
1108275157 13:48800831-48800853 TGGAACATGAAGAATGAAGAGGG + Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1109857329 13:68148581-68148603 TTTTAGATGAAGACTAAAGAAGG - Intergenic
1110002107 13:70215668-70215690 TTGTGCATGAAAATAAAAGATGG - Intergenic
1111127236 13:83926917-83926939 TTATACATAAAAATTAAAGATGG + Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1111525934 13:89470305-89470327 TTGTAAAGGAATAAAAAATAAGG + Intergenic
1111586065 13:90286052-90286074 TTTTACATCAATAATAATTAAGG + Intergenic
1111607171 13:90555444-90555466 TTTGACATGAATAATTAATACGG - Intergenic
1111633563 13:90874512-90874534 ATGTACATGAAAACCAAAGAGGG + Intergenic
1111734869 13:92125365-92125387 ATATAAATAAATAATAAAGATGG + Intronic
1112510329 13:100003167-100003189 TGGTACATAAAGAAAAAAGAAGG - Intergenic
1112971266 13:105266157-105266179 TTGTACTTGAACAATATAGATGG + Intergenic
1113863630 13:113507330-113507352 TTATACCTGAGTAATAAAAAGGG - Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116328048 14:43559059-43559081 TTCTAAATTAATAATGAAGATGG - Intergenic
1116798451 14:49416425-49416447 TTCTACATAAATAAAAAAGTCGG + Intergenic
1116931133 14:50692116-50692138 TTCTACTTGAAAAATATAGATGG - Intergenic
1117386767 14:55222452-55222474 TTTTAAAAGAAGAATAAAGAAGG + Intergenic
1118364012 14:65078698-65078720 TTTTACATTTTTAATAAAGATGG + Intronic
1120339330 14:83199303-83199325 TATTAAATGAATTATAAAGATGG + Intergenic
1120656252 14:87193585-87193607 TTCAACATGAATAAGATAGATGG + Intergenic
1121469612 14:94141951-94141973 TTGTACATGATAAATTTAGATGG + Intergenic
1124643450 15:31415930-31415952 TTGAACAAGAAAAAAAAAGAGGG + Intronic
1124709465 15:31994022-31994044 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1126024505 15:44432962-44432984 TTGAACATGAATGATCAACATGG + Intronic
1127834207 15:62777117-62777139 TTTTACATGAAAGAAAAAGATGG + Intronic
1129809159 15:78492883-78492905 TTGTACCTAAAAAATGAAGAAGG + Intronic
1130865136 15:87927022-87927044 TTGGAAATGAATAAAAAATATGG + Intronic
1131281879 15:91028176-91028198 TTGTACATGTTTAGTAGAGATGG - Intergenic
1133491348 16:6272636-6272658 TTGTAAATGAAGTATAAAGTGGG + Intronic
1133493226 16:6292005-6292027 TTGTACAGGAGTAAAAAAAATGG + Intronic
1133536325 16:6705696-6705718 TTATAAATGAGAAATAAAGAGGG + Intronic
1135582157 16:23637803-23637825 TGGGAAATGAATAATAAAGCAGG + Intronic
1137829656 16:51531824-51531846 TTCCACATCCATAATAAAGAAGG - Intergenic
1137845670 16:51685469-51685491 GTGTACATCAATAAAAATGAGGG - Intergenic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138753195 16:59449281-59449303 TTGAACAAGAAAAATAAAGCTGG - Intergenic
1141059784 16:80855380-80855402 TTGTAAATGAAAAAGAGAGATGG + Intergenic
1142350834 16:89578980-89579002 TTTTACCTCAATAAAAAAGAAGG - Exonic
1146413263 17:32607712-32607734 TTGTAAATGAAGAATAAAGTTGG + Intronic
1147601833 17:41751398-41751420 TTGTAAATGATTTGTAAAGATGG - Intergenic
1148215404 17:45831314-45831336 TTGTAAATGCTTAATATAGATGG - Intronic
1148220996 17:45861723-45861745 TTTTACATAAAAAATACAGATGG + Intergenic
1150393498 17:64803902-64803924 TTTTACATTTTTAATAAAGATGG - Intergenic
1151762511 17:76113936-76113958 TTGTACATTAAAAATAACTATGG + Intronic
1152487702 17:80605358-80605380 TTTTACATTAAGAAAAAAGAAGG + Intronic
1154099786 18:11461461-11461483 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1154233099 18:12576259-12576281 TTGGAAAGGAATAATAAAGTTGG + Intronic
1155866252 18:30968829-30968851 TTATTAATGAATAACAAAGAAGG - Intergenic
1156567271 18:38206627-38206649 TTGTAAATCAATAATAAAAAAGG + Intergenic
1157145033 18:45153602-45153624 TTGGAAATGAATAACAAATAAGG - Intergenic
1157524519 18:48370592-48370614 TTGTACAAAAATAATACAGAGGG - Intronic
1158155086 18:54416832-54416854 TTGTCCAAGAATAAAAAAGAAGG - Intergenic
1158745849 18:60198859-60198881 GAGTCCCTGAATAATAAAGAGGG + Intergenic
1160598904 18:79997552-79997574 ATCTACAGGAATACTAAAGAAGG - Intronic
1160602858 18:80027484-80027506 ATCTACAGGAATACTAAAGAAGG - Intronic
1161187453 19:2930986-2931008 GTGTACCTGAATCCTAAAGAGGG + Intergenic
1161642563 19:5433443-5433465 TTATACATCATTAAAAAAGAGGG + Intergenic
1163895884 19:20058738-20058760 TGGTACTTGGATAATAAAGAAGG - Intergenic
1163965288 19:20740975-20740997 TTGTAGAAGAATAATAAAATTGG - Intronic
1163975707 19:20850002-20850024 TGGTACTTGGATAATAAACAAGG - Intronic
1165823046 19:38689122-38689144 TTGTACATGAATATTCACGGTGG + Intronic
925224030 2:2167075-2167097 TTCTTTATGAATAATAATGAGGG + Intronic
926523537 2:13947597-13947619 TTGAACATAAAAAATAAAGTTGG - Intergenic
927758650 2:25730240-25730262 TTGTAAATGAAGAACAAAGTTGG + Intergenic
927774652 2:25893088-25893110 TTATACATGGACAGTAAAGAAGG + Intergenic
928707538 2:33966893-33966915 TTTTAAAAAAATAATAAAGAGGG - Intergenic
929368756 2:41195161-41195183 TTGTTCCTGAAAAATAAAGAGGG - Intergenic
929566186 2:42986663-42986685 TAGTATATGAATAATTAAGCAGG + Intergenic
929873496 2:45777311-45777333 TGGTACATGAATATAAAGGAAGG - Intronic
931097030 2:58952327-58952349 TTTTACCTGAAGAATAATGAAGG - Intergenic
931373363 2:61685103-61685125 TTGTAAAAGAAAAATAAAGTGGG - Intergenic
931735723 2:65191834-65191856 TTGAAAATGAATAATAAAATGGG + Intergenic
935031922 2:99330965-99330987 TTATACATTAATAATAAAAAAGG + Intronic
935080200 2:99785538-99785560 TTCTACATGAACAATAAAAGGGG + Intronic
935185098 2:100724618-100724640 TTATACATTAATAGTAAAGAAGG - Intergenic
935647688 2:105354254-105354276 TTCTACATGAACCATAAACAAGG - Intergenic
936398203 2:112145934-112145956 TTGAAAAGGAATAATAAAGTTGG - Intronic
936620004 2:114085746-114085768 TTTTACATGGATGATAAAGAAGG - Intergenic
936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG + Intronic
937810043 2:126189082-126189104 TTTTACAGGAATAAAAAATAAGG - Intergenic
938047294 2:128133312-128133334 TTCTACATGACAAAAAAAGAGGG - Intronic
938751883 2:134339912-134339934 TATTACATGATTAATAAAAATGG - Intronic
939227385 2:139380982-139381004 TTGTACATGATTATCAAAGATGG + Intergenic
939618631 2:144390414-144390436 TTGTACAAAAGTGATAAAGATGG + Intronic
939648034 2:144725403-144725425 TTGAATATGAGTAATAAAAATGG - Intergenic
939652056 2:144775807-144775829 TTGCAAATGAATAGAAAAGAAGG + Intergenic
939674513 2:145055362-145055384 TTGTTTGTGAATAATAGAGACGG + Intergenic
940015743 2:149102216-149102238 TAGTTCATAAATAATAATGATGG + Intronic
940023028 2:149176314-149176336 TGTTACTTGTATAATAAAGATGG + Intronic
940133421 2:150409669-150409691 TTGACCATGAATGAGAAAGAAGG - Intergenic
940448434 2:153807077-153807099 TTGGGCATGAATAATGATGATGG - Intergenic
940822417 2:158371846-158371868 ATTTATATGAATTATAAAGAGGG - Intronic
941149671 2:161898542-161898564 TTTCAAATGAATAAAAAAGATGG - Intronic
941200842 2:162507808-162507830 TTATACATGAATTTTAAAAATGG - Intronic
942170960 2:173289236-173289258 TTAAACAAGAATATTAAAGAAGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
943155929 2:184176744-184176766 ATGTCAATGAATACTAAAGAAGG - Intergenic
944390391 2:199212082-199212104 TTGAACACGAAGAACAAAGATGG - Intergenic
947194761 2:227551019-227551041 CTGTAAGTGAATAGTAAAGAGGG + Intronic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
1169013935 20:2275837-2275859 TTTGACATTAATAATAAAGGGGG - Intergenic
1169255923 20:4098643-4098665 TTGTAAAAGAAGAATAAAGTTGG + Intergenic
1169868199 20:10222968-10222990 GTGCACTTGAATAATAAACATGG + Intronic
1172258435 20:33539455-33539477 TAGGAAATGAGTAATAAAGATGG - Intronic
1172909612 20:38397669-38397691 TTGGAAATGAAGAATAAAGTTGG - Intergenic
1172945945 20:38689374-38689396 TGGTAAATGCTTAATAAAGAAGG - Intergenic
1173093444 20:39999815-39999837 TTGTAAAAGAATAACAAAGTTGG + Intergenic
1177213826 21:18104051-18104073 TTATACATGAAAAATAAAAGAGG - Intronic
1177227860 21:18280725-18280747 TTTTACATGAAAAATAGAGAGGG + Intronic
1178101004 21:29268507-29268529 ATGTACATAAATAAAAAATATGG + Intronic
1179453819 21:41484612-41484634 TTTTATATGAATAATCAATATGG + Intronic
1183173775 22:36206999-36207021 TTGTAGACAAATAATAAAGCTGG + Intergenic
1183446556 22:37860031-37860053 GTGTATATAAATAATACAGATGG - Intronic
951170631 3:19537815-19537837 CTGTAATTGTATAATAAAGAAGG + Intergenic
951365132 3:21771782-21771804 TTGAAAATAAATAACAAAGATGG + Intronic
951402918 3:22256719-22256741 GAGTACATATATAATAAAGATGG - Intronic
951428043 3:22572049-22572071 TTGTAGATGAATCAAAAAAATGG + Intergenic
951623308 3:24630698-24630720 ATATACATGTATTATAAAGATGG + Intergenic
951873588 3:27394828-27394850 TTCTACACGAATTATAAAGAGGG + Intronic
952449659 3:33419825-33419847 TTGTAACTGAAATATAAAGAAGG + Intronic
954045054 3:47922747-47922769 TTGTACATGAAAAAAAAGCAGGG + Intronic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955779979 3:62474116-62474138 TTCTACATGATCAATGAAGAGGG + Intronic
956082599 3:65574659-65574681 TTGAAAATGAAGAATAAAGTTGG + Intronic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
957364739 3:79208304-79208326 TTTTACAAGAATAAAAAGGATGG - Intronic
958579451 3:95998994-95999016 TTGTAGTTGAATCATAAAGCAGG - Intergenic
959259843 3:104063240-104063262 TTGTACATGCAAAATAAACAAGG + Intergenic
959314727 3:104788830-104788852 TTGTACAAAAAGAAGAAAGAAGG + Intergenic
959535561 3:107481256-107481278 ATTTACAGGAAGAATAAAGAAGG - Intergenic
959853753 3:111122915-111122937 GTGAACAGGAATAAAAAAGAGGG - Intronic
960061504 3:113327434-113327456 TTGACCATGAATACTAAAGATGG + Intronic
960364297 3:116752211-116752233 ATGTCTATGAAAAATAAAGAAGG + Intronic
960546801 3:118924483-118924505 ATGTACATGATTAATAGATATGG + Intronic
960861317 3:122156760-122156782 TTATACATGAAGCATAATGAGGG - Intergenic
961426185 3:126850337-126850359 TTGGACATGAATAGAAAAGTAGG + Intronic
962453598 3:135544020-135544042 TTGAAGAAGAATAACAAAGATGG - Intergenic
962720541 3:138170157-138170179 TTGTAGATGAATTATAAGGGGGG + Exonic
963324618 3:143848697-143848719 CTGTAGATTAATAATAAAAAAGG + Intergenic
963487166 3:145949542-145949564 TTGAAAATGGAAAATAAAGAGGG - Intergenic
964382996 3:156116790-156116812 GTTTACATAAATAATAAAAATGG - Intronic
964815995 3:160718662-160718684 TTGAAGATGAAGATTAAAGATGG + Intergenic
965391298 3:168107659-168107681 CTGTAAATGACTAATAAGGATGG + Intergenic
965415832 3:168391082-168391104 TTTTACATTAATATTAATGAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967437408 3:189464824-189464846 TTGTAAATGAATTTTAAAAAGGG + Intergenic
967534657 3:190588429-190588451 TGGAAAATGAATAATGAAGATGG - Intronic
969399141 4:6942255-6942277 GTGCACATGAAAAATACAGAAGG - Intronic
969625296 4:8301088-8301110 GTGTGAATCAATAATAAAGATGG - Intronic
969934792 4:10669568-10669590 TAGTACATGAAAAAGAATGAGGG + Intronic
970427304 4:15957200-15957222 GAGTACTTGATTAATAAAGATGG + Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
970930466 4:21505619-21505641 TTGTAAACAAATAATACAGATGG - Intronic
971736415 4:30459051-30459073 TTGTAAATGATAAATAAAGTAGG - Intergenic
971865928 4:32172095-32172117 TATTAAATGAATAATACAGAAGG - Intergenic
971967114 4:33574118-33574140 TGTTACATGAATTATATAGATGG + Intergenic
972438546 4:39060241-39060263 TTGTCCATGATTTATAAACATGG + Intronic
974878536 4:67725869-67725891 TTCTACATAAATATTATAGATGG + Intergenic
975184883 4:71389752-71389774 TTGTGAATGAATAATAGTGATGG - Intronic
975295205 4:72726598-72726620 TTCTACCTGAAGAAAAAAGAGGG + Intergenic
975307102 4:72862836-72862858 TTGAAAATGAAGAATAAAGTGGG + Intergenic
975920220 4:79378200-79378222 TTGCACGTAAATAATAAAGAAGG - Intergenic
976090061 4:81447855-81447877 TTGTAAATAAATACTAAACAAGG - Intronic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976485902 4:85604512-85604534 TTCTACATGAATAATTAATAAGG + Intronic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978718056 4:111869621-111869643 ATGTAAATGAAAAATAAACAAGG + Intergenic
979003001 4:115250526-115250548 TATTACTTGAATAATACAGAAGG + Intergenic
979173485 4:117631920-117631942 TTGAGCAAGAAGAATAAAGATGG + Intergenic
979582460 4:122376959-122376981 TAGGTCATGAAAAATAAAGAAGG + Intergenic
980166691 4:129236643-129236665 TTATAAATCAATAATAAATATGG + Intergenic
980432432 4:132720954-132720976 TTTTACATAAACAATAAAAATGG - Intergenic
980669448 4:135985778-135985800 GAGTACAAGAAGAATAAAGAGGG - Intergenic
981223271 4:142261684-142261706 GTGTACATGATTCTTAAAGAGGG - Intronic
981754981 4:148133026-148133048 TTTTACATTATTAATAGAGACGG - Intronic
982503065 4:156183662-156183684 TTAAATCTGAATAATAAAGAAGG - Intergenic
982985972 4:162206569-162206591 TTTTAAATGAATAAAAAACATGG + Intergenic
983101504 4:163631990-163632012 TTGAACATCACTAATAATGAGGG + Intronic
983262010 4:165467775-165467797 GTGTACGTGAATGAGAAAGAAGG + Exonic
984228800 4:177068279-177068301 TTATAAATAAATAATTAAGATGG - Intergenic
984233745 4:177131624-177131646 TGCTACAAGAAGAATAAAGAGGG + Intergenic
984676714 4:182557281-182557303 TTGGACAGGAACAATAAATAGGG - Intronic
986186566 5:5446661-5446683 TTATACACGAAAAATAAAGGCGG - Intronic
986767823 5:10943817-10943839 TTCTACAAGAATAACAAAGTGGG - Intergenic
986825833 5:11521319-11521341 TTGCCCAAGAATAATAAAGAAGG - Intronic
987275540 5:16358324-16358346 CTGTACATCAATAATAGACAAGG - Intergenic
988221477 5:28351833-28351855 TTGCACATGAAGAATAAAATTGG + Intergenic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
988932685 5:36052434-36052456 TTACACATGGATAATGAAGAAGG - Intronic
989565006 5:42893453-42893475 TTTTACATTAATAATATACAGGG - Intergenic
989766698 5:45093912-45093934 TTGTATATGCATCATAAAAAAGG + Intergenic
991214662 5:64148626-64148648 TTGTTAAAGAAAAATAAAGATGG + Intergenic
991443473 5:66675827-66675849 GTCTACATGATGAATAAAGAAGG + Intronic
992157042 5:73965837-73965859 ATGGACATGAATGATAGAGATGG + Intergenic
993631516 5:90291890-90291912 TGTTACATGAATAATGTAGAAGG + Intergenic
993750433 5:91659108-91659130 TTGTAAGTGAATAATAATGGGGG - Intergenic
993877119 5:93320680-93320702 TTGTACATGATTAAAAAGGATGG - Intergenic
994253257 5:97562299-97562321 CTATACATGAATAAAGAAGAGGG - Intergenic
994479407 5:100314650-100314672 TTGTATATGGTTAATAAAAAGGG - Intergenic
994818470 5:104615921-104615943 ATTTGCATGAATAAAAAAGAAGG + Intergenic
994932820 5:106210927-106210949 TTCTACATCAAGGATAAAGAGGG + Intergenic
995172298 5:109130012-109130034 TTATACATGAATAGTTTAGAAGG + Intronic
995199156 5:109408028-109408050 TTCAACAAGAGTAATAAAGAGGG + Intronic
995584212 5:113630232-113630254 TTGCACAGGGATAACAAAGAAGG - Intergenic
996346705 5:122495481-122495503 GTAAAAATGAATAATAAAGAGGG + Intergenic
996612756 5:125403211-125403233 TTATACATCAACAATTAAGATGG - Intergenic
996850766 5:127949337-127949359 TTCCAAATGTATAATAAAGAAGG + Intergenic
997983098 5:138482333-138482355 TTGTACATGGGGAATGAAGATGG - Intergenic
1004111424 6:12722387-12722409 TTGCACATGACTAATACAGAAGG - Intronic
1005095215 6:22107143-22107165 TTACACATGAATAAGCAAGATGG + Intergenic
1006762540 6:36475971-36475993 TGGACCATGAAGAATAAAGAGGG - Intronic
1008000625 6:46356271-46356293 TTGTCCATGAATATCAGAGAAGG - Intronic
1008059413 6:46981504-46981526 TTATAAATGAATAATATTGAAGG + Intergenic
1008685360 6:53920391-53920413 TTATACATCATTAAAAAAGAAGG + Intronic
1008712241 6:54241782-54241804 TTGTAGATTAAGAATAAAGAAGG + Intronic
1009293213 6:61910091-61910113 TTTTACCGGAATAGTAAAGAAGG + Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009614183 6:65984013-65984035 TTGAAAATGAATAATAAATTTGG + Intergenic
1009728721 6:67570773-67570795 TTGAAAATGAAGAATAAAGTTGG + Intergenic
1011099087 6:83701777-83701799 TTAAAAATGAATAATAAAGAAGG + Intronic
1011827756 6:91330678-91330700 GGTTACATAAATAATAAAGATGG + Intergenic
1011869849 6:91880100-91880122 TTGTACAGTAATATTTAAGATGG + Intergenic
1012450799 6:99350672-99350694 TTGTTAATAAATAATAAATATGG + Intergenic
1012567164 6:100672170-100672192 TTTGAAATAAATAATAAAGAGGG - Intronic
1012882613 6:104808842-104808864 TTGTAGAAGAATAATAGATATGG - Intronic
1012971026 6:105730904-105730926 TTTTACAAGAATAAAAAATAAGG + Intergenic
1013171172 6:107637441-107637463 TTGTAGATGTAAAATCAAGAAGG - Intronic
1013343124 6:109234916-109234938 TTGTACATGAAAAAATAAGATGG + Intergenic
1013351972 6:109314021-109314043 TGGTCCATGATCAATAAAGAAGG + Intergenic
1013579347 6:111517704-111517726 TAGCATATGCATAATAAAGATGG + Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1013918804 6:115374952-115374974 TTGTACCTGAATATAAAACATGG + Intergenic
1014399877 6:120975144-120975166 TTGCATTTGAAGAATAAAGAAGG - Intergenic
1015474400 6:133644014-133644036 TTGTCCATTAATATTAAATAGGG - Intergenic
1015729004 6:136329168-136329190 TAATACATGAATTAAAAAGAAGG - Intergenic
1017377106 6:153783953-153783975 TTGGATATGAATGATAAAGATGG - Intergenic
1018875638 6:167820039-167820061 TGGTAGATGACAAATAAAGAGGG - Intergenic
1020048976 7:5068943-5068965 TTCTATATAAATTATAAAGACGG + Exonic
1020344621 7:7149537-7149559 TTTTAAATAAATAATAATGAGGG + Intergenic
1020663981 7:11016358-11016380 TTGTATATAAAGAATAAAAAAGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021175979 7:17449944-17449966 ATGTACCTGAACAGTAAAGATGG + Intergenic
1021242449 7:18220524-18220546 TTGTACAAGAGTAAGAGAGAAGG + Intronic
1022859299 7:34350496-34350518 ATTTACACGAACAATAAAGAGGG + Intergenic
1023015576 7:35966925-35966947 TTGTGTATGAATGAAAAAGAGGG + Intergenic
1024065356 7:45727758-45727780 TTGTGTATGAATGAAAAAGAGGG - Intergenic
1024089868 7:45926926-45926948 ATTTACATGTCTAATAAAGAAGG - Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1026333444 7:69373209-69373231 TCTTACATGAAGAAAAAAGAAGG + Intergenic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1030596764 7:111549170-111549192 TTGAAGATTAATAGTAAAGAAGG - Intronic
1030778457 7:113566538-113566560 TTGTACATGACTGAGAAATATGG - Intergenic
1030953930 7:115827136-115827158 TTAGACATGAATATTAAATAGGG + Intergenic
1031295746 7:120001134-120001156 TTGAAGATGAAAAATAAAGGTGG - Intergenic
1031619312 7:123916832-123916854 TTGTATATAAAAAATAAAGGAGG + Intergenic
1032934082 7:136709163-136709185 TGGTACCTGAATGGTAAAGATGG - Intergenic
1033252311 7:139771434-139771456 AAGTACAAGAAAAATAAAGACGG + Intronic
1033395788 7:140972659-140972681 TTGAAGATGATGAATAAAGAAGG + Intergenic
1033711026 7:143944714-143944736 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1033711065 7:143945445-143945467 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1034279362 7:149841748-149841770 TTGTACAGGAAAGATAGAGAGGG - Intronic
1040348625 8:46538845-46538867 TTGTACATTAAACAAAAAGAGGG - Intergenic
1040669201 8:49667139-49667161 TTTTAAATGAATTATAGAGAAGG - Intergenic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1042311586 8:67383988-67384010 TTCTAGTTGAATAATAAAAAAGG + Intergenic
1042439518 8:68809864-68809886 TTGTGTAGGCATAATAAAGATGG + Intronic
1042748575 8:72133885-72133907 GTGTACGGGAATGATAAAGAAGG + Intergenic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043594352 8:81866413-81866435 TTGTAAATGAATAAAAATTAAGG + Intergenic
1044549911 8:93500508-93500530 TTGTAGATTAAAAAGAAAGAAGG + Intergenic
1044844665 8:96368786-96368808 TTGTAAAAGAATAATAAAGTGGG - Intergenic
1045027556 8:98102663-98102685 TTGAACATGAATATTAGAGAAGG - Exonic
1046264404 8:111813081-111813103 TTGTACAGCAAAAAAAAAGATGG + Intergenic
1047102952 8:121699495-121699517 TTATAGCTGAATCATAAAGAAGG - Intergenic
1047662673 8:127054616-127054638 TTCTAAATGAAGAAAAAAGAAGG + Intergenic
1049593896 8:143474716-143474738 TTGTCCATCAAAAAAAAAGAGGG - Intronic
1050302077 9:4269761-4269783 TTGTCTGAGAATAATAAAGAGGG + Intronic
1050813318 9:9777747-9777769 TTGTATACTAATATTAAAGAAGG + Intronic
1050854643 9:10337238-10337260 GTGTACATATATAATAATGAGGG - Intronic
1051137358 9:13937346-13937368 TTGCACATTAAAAAAAAAGAAGG + Intergenic
1051198182 9:14586807-14586829 TTGGCCATAAATAATAAATATGG - Intergenic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051597019 9:18834402-18834424 TTATAAATGAATAACAAAGAAGG - Intronic
1052213941 9:25941744-25941766 GTGAAAATGAATAATAAAAATGG + Intergenic
1052712448 9:32073347-32073369 TAGTAAATCAATAATTAAGATGG - Intergenic
1055128662 9:72749783-72749805 TTTTACAGGAATAAGAAAGATGG + Intronic
1056861309 9:90185637-90185659 TTGAAAATGAAGAATAAAGATGG - Intergenic
1057784436 9:98075981-98076003 TTGTTGATGAATACTAGAGAAGG + Intronic
1057946693 9:99336542-99336564 TTGTACATGAATATTTTACAAGG + Intergenic
1058598796 9:106646421-106646443 GTGGACATGTCTAATAAAGAGGG - Intergenic
1059222513 9:112638202-112638224 TTGAAAAAGAAAAATAAAGAAGG + Intronic
1059827681 9:118050115-118050137 TTGAACATCTCTAATAAAGAAGG + Intergenic
1061520099 9:131112721-131112743 TTTTACATGAAGAAGAGAGAAGG + Intronic
1061554027 9:131355430-131355452 TTGAAAAAGAATAATAAAGGTGG - Intergenic
1185958139 X:4514704-4514726 TTCTACATGAATGAATAAGAAGG + Intergenic
1186770911 X:12817214-12817236 GTGTCCCTGAATAATAAAGAAGG + Intronic
1187186247 X:16989001-16989023 TTGAAAAAGAATAATAAAGCAGG + Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187412717 X:19064641-19064663 CTGTAGATTAAAAATAAAGATGG - Intronic
1187497676 X:19809694-19809716 TTTTCCATGAATATTAATGATGG - Intronic
1187598772 X:20803485-20803507 ATATATATGAATAATAAAGTAGG + Intergenic
1188328205 X:28833709-28833731 TTGTACATGAAATCTATAGAAGG - Intronic
1188784591 X:34329625-34329647 TTTTCCATTAATAATAAATAAGG + Intergenic
1189052515 X:37661383-37661405 CTGAACATGAATGATAAAGGAGG - Intronic
1190795836 X:53740905-53740927 TTGGAAAAGAATAATAAAGTAGG - Intergenic
1191119194 X:56885724-56885746 TTGTGGATGAATTATAAAGCAGG - Intergenic
1191996050 X:67096101-67096123 TAATAGAAGAATAATAAAGATGG - Intergenic
1193105948 X:77672157-77672179 TTGTACTTGAAAAACAAAGGTGG - Intronic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1194911647 X:99652297-99652319 TTGTACCTCAATATCAAAGAAGG + Intergenic
1195017543 X:100794090-100794112 TTCTACAGGAATACTAAAGAAGG - Intergenic
1195287556 X:103399870-103399892 ATGTTCATGAATAATAAATATGG - Intergenic
1195462946 X:105147791-105147813 TTGTACATGAATATTCATAATGG - Intronic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197578318 X:128250539-128250561 CTGTACATCATTAATAAACATGG + Intergenic
1197794079 X:130282133-130282155 TTGTATATCAATTATAGAGAAGG - Intergenic
1198745352 X:139884401-139884423 TTGTCCATGTAAAATAAAAACGG + Intronic
1199066139 X:143420862-143420884 TTGTAGACAAATAATAAAAATGG - Intergenic
1199087241 X:143641545-143641567 TTCTAGAATAATAATAAAGAGGG + Intergenic
1199891660 X:152089204-152089226 TTGTAGAAGAATTATAAGGAAGG - Intergenic
1201470443 Y:14328108-14328130 TGTTACATTAATAATAATGATGG - Intergenic