ID: 1187227203

View in Genome Browser
Species Human (GRCh38)
Location X:17384997-17385019
Sequence GGAAATAAAAATAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1188
Summary {0: 1, 1: 1, 2: 7, 3: 105, 4: 1074}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187227201_1187227203 -5 Left 1187227201 X:17384979-17385001 CCTATCTTAATAATAAGTGGAAA 0: 1
1: 0
2: 2
3: 20
4: 310
Right 1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG 0: 1
1: 1
2: 7
3: 105
4: 1074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187227203 Original CRISPR GGAAATAAAAATAATGAGGT AGG Intronic
900529078 1:3144032-3144054 GGAAATCAAAGAAATGAAGTGGG - Intronic
900786086 1:4651581-4651603 CGAAATAATAATAATAAGCTGGG + Intergenic
900867697 1:5280153-5280175 GAAAAAAAAAATACTGATGTTGG - Intergenic
901210355 1:7521059-7521081 AAAAATAAAAAAAATGTGGTGGG + Intronic
901718269 1:11174405-11174427 GGAAATAAAAAATGTGAGATGGG - Intronic
901743096 1:11355307-11355329 ATAAATAAAAATAATGTGGAGGG + Intergenic
901835547 1:11921844-11921866 AAAAATAATAATAATGAGGCTGG - Intronic
901899622 1:12348321-12348343 AAAATTAGAAATAATGAGGTAGG - Intronic
902360414 1:15939396-15939418 GGCAATGACAATCATGAGGTGGG - Exonic
902872251 1:19321559-19321581 AAAAAAAAAAAAAATGAGGTTGG - Intronic
903088589 1:20887714-20887736 GGAAATAAAGATCATCAGATTGG + Intronic
903695160 1:25201051-25201073 GGGACTAAATATGATGAGGTGGG - Intergenic
903988964 1:27251660-27251682 GGAAAAAACAATAATTAGCTGGG + Intronic
903994140 1:27294801-27294823 TGAAATAAAAAGACTGAGCTAGG - Intronic
904136092 1:28313716-28313738 TAAAATAAAAATAAAAAGGTGGG + Intergenic
904257472 1:29264497-29264519 AAAAAAAAAAAGAATGAGGTTGG - Intronic
906093820 1:43206119-43206141 AAAAATAAAAATAATAAGCTGGG - Intronic
906284561 1:44578307-44578329 AGAAATACAAAAAATGAGCTGGG - Intronic
906813062 1:48849086-48849108 GGAAAGGAAAATAATGAAGAAGG + Intronic
906823226 1:48950882-48950904 GGAACTGAAAATAATGGGGATGG - Intronic
906921587 1:50070377-50070399 GAAAATGAAAATGATGAGGCAGG - Intronic
907031480 1:51176714-51176736 TGAAATGAAATTAATGAGGCAGG - Intergenic
907077214 1:51589870-51589892 AAAAATAAAAATAATTAGCTGGG + Intronic
908136396 1:61137946-61137968 AGAAAAAAAAAAAAAGAGGTGGG - Intronic
908335294 1:63116494-63116516 GTAATTAAAAATATTGAGTTAGG - Intergenic
908459953 1:64339637-64339659 GAAAATAAAAACAATTAGCTGGG - Intergenic
908676153 1:66606373-66606395 AGAAATAGAAATAAAGAGCTTGG - Intronic
908680199 1:66652331-66652353 GAAAATAAAAATAGCGAGGGAGG + Intronic
908954245 1:69601718-69601740 GAAAATAAAAATATTGGGTTAGG + Intronic
909057558 1:70840114-70840136 GTAAATGAAAATTATTAGGTTGG - Intergenic
909305128 1:74065169-74065191 GGCAATAAAAATAATTGGTTTGG - Intronic
909346822 1:74599457-74599479 GGAAAAATAAATAATGTGCTAGG + Intronic
909497911 1:76300081-76300103 GGACAGAAAAATATGGAGGTGGG + Intronic
909629063 1:77751847-77751869 GGAAATACAAAAAATTAGCTGGG - Intronic
909781679 1:79556697-79556719 GGAAAGAAACATATTGAGGAAGG + Intergenic
909937770 1:81573544-81573566 GGGAATGAAAATAGTGAAGTAGG + Intronic
909937842 1:81574325-81574347 GGAAATTAAAATCATGTGTTAGG + Intronic
910027370 1:82671890-82671912 GGAAATGAGAATAATAATGTAGG - Intergenic
910200950 1:84697963-84697985 AGTAATAATAATAATGAGATTGG + Intergenic
910405448 1:86884637-86884659 AAAAGTAAAAATACTGAGGTTGG - Intronic
910917216 1:92302303-92302325 GGAAAAAAGAAAAATGAGGATGG + Intronic
911239071 1:95445462-95445484 GGAAAAAATAAAAATGAAGTAGG + Intergenic
911263269 1:95712561-95712583 GAAAATAGAAAGAAAGAGGTGGG - Intergenic
911507824 1:98775473-98775495 GGAAATCAAAACAATGAGTCTGG + Intergenic
911863177 1:102981380-102981402 GAAAATAAAAATTTTGAGGGGGG + Intronic
911889307 1:103346661-103346683 TGAAATCAAGATAATAAGGTAGG + Intergenic
912100829 1:106202068-106202090 GAAAATACAAGTAATGAGATAGG + Intergenic
912233471 1:107822352-107822374 GGAAAAAAAAATAATTAAATGGG + Intronic
912784671 1:112589383-112589405 GGAAAGAAAAGAAATCAGGTTGG - Intronic
913443829 1:118928352-118928374 TTAAATAAAAATTGTGAGGTAGG - Intronic
913517878 1:119620204-119620226 GGTAATAGAAATAATGAGAGAGG + Exonic
913571738 1:120127209-120127231 GCCAATAAAAAGAATGAGGCAGG + Intergenic
914048178 1:144107675-144107697 GGAAGAAAAAATAATGAGGCAGG + Intergenic
914131006 1:144857773-144857795 GGAAGAAAAAATAATGAGGCAGG - Intergenic
914292658 1:146288831-146288853 GCCAATAAAAAGAATGAGGCAGG + Intergenic
914341944 1:146767193-146767215 AAAAATAAAATTAATGATGTAGG + Intergenic
914553702 1:148739614-148739636 GCCAATAAAAAGAATGAGGCAGG + Intergenic
914766320 1:150640704-150640726 GGAAAAAAAAAAAATTAGCTGGG + Intergenic
915257180 1:154642802-154642824 TAAAATAAAAAGAATGAGTTTGG - Intergenic
915341878 1:155181077-155181099 GAAAATGAAAATAATTAGCTGGG + Intronic
915387120 1:155505110-155505132 GAAAATATAAATAATGAGGCCGG - Intronic
915615533 1:157034931-157034953 GGAAATAAGAGTAATGGAGTTGG + Intronic
915648261 1:157289290-157289312 GGAAATAAAAGAAAGGAGTTTGG + Intergenic
916014029 1:160732624-160732646 GGAAAAAATAATAATAAGGCAGG + Intergenic
916230696 1:162538441-162538463 TGAAATAAAAATATTGATGGTGG - Intergenic
916439602 1:164810104-164810126 GGAAGTAAAATTTATGAGTTTGG - Intronic
916950021 1:169770501-169770523 AGAATTAACTATAATGAGGTAGG + Intronic
917335326 1:173919404-173919426 GAAAATAATAATAATAAGCTGGG + Intergenic
917622121 1:176807359-176807381 GAAAATCAAAATACTTAGGTAGG - Intronic
918445609 1:184614008-184614030 AGAAATAAAAATAAAGAGATGGG + Intronic
918970536 1:191410637-191410659 GAACAGAAAAATAATGAGGAAGG + Intergenic
919157371 1:193783723-193783745 GGATATGAAAATAAAGAGATGGG - Intergenic
919685692 1:200481653-200481675 GGAGATGAGAATAAAGAGGTGGG + Intergenic
920023474 1:202974300-202974322 GGAAATAAAAATAACAAAGGAGG + Intergenic
920063192 1:203242926-203242948 GGAAATTAAAAGAATGATGAAGG + Intronic
921879425 1:220237532-220237554 AGAAATTAAAATAATGAGTTAGG + Intronic
922303533 1:224324587-224324609 GAAAATAGAAATAATTAGCTGGG - Intronic
922316950 1:224451004-224451026 GGAAATAGAAAATATGAGGCTGG - Intronic
922520616 1:226247831-226247853 GAAAATAAAAAAAATTAGCTGGG - Intronic
922609679 1:226916298-226916320 GGAAAAAAAAATCATGAGGCTGG - Intronic
922709919 1:227819684-227819706 GGAAATAAATTTAATGAAGGAGG - Intronic
923652284 1:235884951-235884973 AAAAATAAAAATAATTAGCTAGG - Intergenic
924030461 1:239880650-239880672 AAAAATAAAAATAATTAGCTAGG - Intronic
924138271 1:240994122-240994144 TGAAAGAAAAATAATGTGGGAGG - Intronic
924185359 1:241483737-241483759 GGAAAAAAAAAAAATGAGAAAGG - Intergenic
924545157 1:245019802-245019824 AAAAATAAAAATAATTAGCTGGG + Intronic
924552183 1:245089214-245089236 GGTAAGCAAAATGATGAGGTTGG + Intronic
924596957 1:245454763-245454785 AGAAAGAAAAAAAATGGGGTAGG - Intronic
924899277 1:248378113-248378135 GGAAATAAATAGTATGAAGTGGG - Intergenic
1062859734 10:802226-802248 AAAAATAAAAATAATTAGCTGGG - Intergenic
1062870485 10:898702-898724 GGAAAGAAAAAGAATGAGTTTGG + Intronic
1063123570 10:3121980-3122002 GGAAATACAAAAAATTAGCTGGG - Intronic
1063632286 10:7745586-7745608 GAAAATAAAAATAATTAGCAGGG + Intronic
1063694695 10:8322438-8322460 TAGAATAAAAATAATGAGCTTGG - Intergenic
1063704280 10:8415719-8415741 TGAAAAAAAAATGATGGGGTTGG + Intergenic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1064065237 10:12175772-12175794 AAAAATACAAAAAATGAGGTGGG + Intronic
1064219880 10:13431484-13431506 GGAAGTAGTAATAATTAGGTGGG - Intergenic
1064340267 10:14479251-14479273 GAAAAGAAAAAAAAAGAGGTGGG + Intergenic
1064393907 10:14964777-14964799 GGAAAAAAAAAAAATGAACTGGG - Intronic
1064490666 10:15852464-15852486 TAAAACAAAAATAATGAAGTTGG + Intronic
1064490916 10:15856134-15856156 GGAAGAAAAATTAATGATGTTGG + Intronic
1064536801 10:16365728-16365750 AAAAATAAAAATAATTAGCTGGG - Intergenic
1064554206 10:16532466-16532488 GCAATTAAAAATAATGAGTAGGG + Intergenic
1065165588 10:22973706-22973728 GAAAATAAAAATAATATAGTGGG - Intronic
1065274478 10:24072184-24072206 AAAAATAAAAATAATTAGCTGGG - Intronic
1065729797 10:28700383-28700405 AGAAAAAAAAATTATTAGGTAGG - Intergenic
1065850687 10:29785174-29785196 GAAAATTAAAATAAATAGGTGGG + Intergenic
1066070505 10:31804467-31804489 GAAAATAAAAATAGTCAAGTGGG - Intergenic
1066372629 10:34830108-34830130 TAAAATAATAATAATGGGGTAGG + Intergenic
1067117823 10:43448833-43448855 AAAAATAAAAAAAATGAGCTGGG + Intronic
1067121665 10:43477653-43477675 GAAAAAAAAAAAAATGAGGTCGG + Intronic
1067481239 10:46599243-46599265 TGAAATAAAAATACTAAGATTGG - Intergenic
1067613512 10:47742488-47742510 TGAAATAAAAATACTAAGATTGG + Intergenic
1067677448 10:48396081-48396103 GGAGAAAAAAATAATGACTTGGG + Intronic
1068399069 10:56505462-56505484 GGAAAAAATAATAATGGTGTAGG + Intergenic
1068533457 10:58213971-58213993 GGAAATAGAAATAACGAGTTTGG + Intronic
1068547590 10:58366737-58366759 AAAAATAAAAATAATAAGCTGGG - Intronic
1068577454 10:58700173-58700195 GGAAATAAACACAGTGAGGTGGG + Intronic
1068723367 10:60272771-60272793 GGAATTAAAAAAAAAAAGGTGGG - Intronic
1068948633 10:62755258-62755280 GGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1069002707 10:63283525-63283547 GAAAATAAAAAAAATTAGCTGGG - Intronic
1069220021 10:65871544-65871566 GGAAATAAACAAAATGAGCATGG - Intergenic
1069419632 10:68235479-68235501 AGAAATAAAATTAATTAGCTGGG + Intergenic
1070208423 10:74288152-74288174 GGCAATAAAATTAATGCGGAAGG + Intronic
1070397873 10:76027860-76027882 GGAATTAAAAATAATATTGTAGG - Intronic
1071216480 10:83408484-83408506 GGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1071628920 10:87202581-87202603 TGAAATAAAAATACTAAGATTGG + Intergenic
1071703316 10:87966237-87966259 GGATATAAAAATAATGTCATAGG + Exonic
1071948458 10:90675277-90675299 AGAAAAAAAAATAATGAGTTTGG - Intergenic
1072060048 10:91800695-91800717 AGTAATAAAAATTATGAAGTGGG + Intronic
1072091417 10:92131500-92131522 GAAAATAAAAATATTTAGCTTGG + Intronic
1072172220 10:92876256-92876278 GGAGATAAAAGTAATCATGTAGG + Intronic
1072194823 10:93108351-93108373 GGAAAAAAAAATACTGTGGATGG - Intergenic
1072675534 10:97463002-97463024 GGAAAAAAAAATAGTAATGTTGG + Intronic
1073528247 10:104206477-104206499 GGAAATAATATTAATGGAGTAGG + Intronic
1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG + Intergenic
1073722567 10:106189872-106189894 ACAAATAAAAATAAAGAGATAGG - Intergenic
1074091206 10:110257893-110257915 GGAAAAAAAAATAAGGGGGGAGG + Intronic
1074119623 10:110484241-110484263 AAAAATAAAAATAATTAGCTAGG - Intergenic
1074460003 10:113628166-113628188 TAAAATAAAAATGAAGAGGTTGG - Intronic
1074714378 10:116204540-116204562 GGAAATATAAATGATGAGCCTGG + Intronic
1074849841 10:117430930-117430952 TAAAATAAAAATAATTAGCTGGG - Intergenic
1075003259 10:118813250-118813272 AGAAATAAAAATAAATAAGTAGG + Intergenic
1075130936 10:119739022-119739044 GAAAAAAAAAAAAATGAGGTGGG + Intronic
1075565885 10:123503893-123503915 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1076280044 10:129238903-129238925 GTAAATATTAATAATGAGCTGGG + Intergenic
1077512996 11:2981246-2981268 GAAAAAAAAAAAAATGAGGCTGG + Intronic
1078241400 11:9533985-9534007 GGAAAAAAAAAAAAGGAGGGTGG - Intergenic
1078393762 11:10959438-10959460 AGAATGAAAAATAATGAGGAAGG + Intergenic
1078404742 11:11060535-11060557 GAAAAAAAGAAAAATGAGGTGGG + Intergenic
1079330873 11:19532007-19532029 AGAAAGAAAAAAAATTAGGTTGG + Intronic
1080024141 11:27596149-27596171 GGAAAAAAAAAAAAAAAGGTGGG + Intergenic
1080122547 11:28693938-28693960 TGTAATAAAAAAAAGGAGGTCGG - Intergenic
1080552285 11:33382932-33382954 AGAAAATAAAATAAGGAGGTAGG + Intergenic
1080606978 11:33871405-33871427 AAAAATAAAAATAATTAGCTGGG + Intronic
1080808650 11:35680499-35680521 GCAAATAAAAAGAATGAGGTAGG - Intronic
1081097771 11:38961097-38961119 GGACATAAAGTTAATGAAGTAGG + Intergenic
1081288249 11:41299411-41299433 GAAATTAAAAATAATAAAGTGGG - Intronic
1081311014 11:41572473-41572495 GGAAACAAAAATTATGAAGCTGG + Intergenic
1081479645 11:43473721-43473743 AAAAATAAAAATAATTAGCTAGG + Intronic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081838154 11:46174959-46174981 AAAAATAAAAAAAATGAGCTTGG - Intergenic
1082033218 11:47622157-47622179 GGAAAATAAAATAATGGGCTGGG - Intronic
1082919274 11:58474615-58474637 GAAAATAATAAAAATGGGGTGGG + Intergenic
1083529241 11:63403444-63403466 GGAAATAATAATAATGGAGGTGG - Intronic
1083563242 11:63691415-63691437 CAAAATAAAAATAATTAGGTCGG - Intronic
1083863223 11:65437546-65437568 GAAAAGTAGAATAATGAGGTAGG - Intergenic
1083982172 11:66181371-66181393 GAAAATAAAAAAAATTAGCTGGG - Intronic
1084026529 11:66453768-66453790 TGAAATAAAAATAAAGAGGCTGG - Intronic
1085089692 11:73700418-73700440 GGAAAAATAAATAATTAGCTGGG + Intronic
1085099127 11:73785699-73785721 AAAAATAAAAATAATTAGCTGGG + Intergenic
1085102621 11:73814396-73814418 AGAAAAAAAAAGAGTGAGGTGGG + Intronic
1085810408 11:79675576-79675598 AAAAATAAAAATAATTAGCTGGG - Intergenic
1085917278 11:80904238-80904260 GGAAATAAAAAAAATGACACAGG + Intergenic
1086365144 11:86101418-86101440 GGAAAGAAGACTAATTAGGTAGG - Intergenic
1086518277 11:87640056-87640078 TCAAAGAAAAATAATGAGGCAGG - Intergenic
1086775671 11:90829920-90829942 TAAAATAAAAACAATGAAGTAGG - Intergenic
1087029904 11:93692616-93692638 GGAAAAAAAAAAAATTAGCTGGG - Intronic
1087362056 11:97172852-97172874 TAAAATAAAAATAATTTGGTTGG + Intergenic
1087386460 11:97475191-97475213 GGAAATAAACATTAAGCGGTAGG + Intergenic
1087454517 11:98366405-98366427 AGATATGAAAATAGTGAGGTAGG + Intergenic
1087570090 11:99915827-99915849 GTAAATAAAAATAAAGAGTGTGG + Intronic
1087692531 11:101338168-101338190 GGAGATAACAAGGATGAGGTGGG + Intergenic
1088142044 11:106629216-106629238 AGAAGTAAATATAATGAGTTTGG + Intergenic
1088280235 11:108127710-108127732 GTAAATATGACTAATGAGGTAGG + Intronic
1088528130 11:110778669-110778691 GGAAATAAAATTAGAGAGTTAGG + Intergenic
1088696031 11:112366583-112366605 GGAAATCAAATGAATGAGATAGG + Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1089234549 11:117012132-117012154 AGAAATAAAAATAATTAGCCAGG - Intronic
1089425223 11:118368020-118368042 GCTATTAAAAATAGTGAGGTAGG + Intronic
1089487660 11:118859444-118859466 GAAAATAAATACAATAAGGTAGG - Intergenic
1089839433 11:121402025-121402047 GAAAAAAAAAAGAATGAAGTTGG - Intergenic
1090122417 11:124045709-124045731 GCAACTAAAAAAAGTGAGGTTGG - Intergenic
1090157374 11:124455047-124455069 GGAGATAAGAAAGATGAGGTTGG - Intergenic
1090580874 11:128157296-128157318 GGAAAAGAAAAGAATGAGGAGGG + Intergenic
1090862038 11:130662563-130662585 GGAAATAAAAATCATTAAGTTGG + Intergenic
1091042947 11:132299132-132299154 GAAAATAAAAAAAATTAGCTGGG + Intronic
1091096943 11:132832213-132832235 GCAAAAAAAAAAAAAGAGGTTGG - Intronic
1092303770 12:7278968-7278990 GGAAATCAAAATAATGATACAGG - Intergenic
1092471048 12:8781418-8781440 GGAAAAAAAATTACTGAGGGTGG + Intronic
1092571364 12:9726154-9726176 GGAAATACAAAGAATGAATTTGG + Intronic
1092774549 12:11931043-11931065 GGAAAGCAAAATAATGAGGCTGG - Intergenic
1092816091 12:12313424-12313446 GGAAAAAAAAAAAAAGAGGCTGG - Intergenic
1093729185 12:22548472-22548494 GGAAATTAAAATTGTGAGCTTGG - Intergenic
1093853266 12:24067225-24067247 TCAAATAAAAATAAAGAGCTGGG + Intergenic
1093917777 12:24824593-24824615 TGAAATAAAAACATTTAGGTGGG - Intronic
1094325001 12:29228140-29228162 GGAAAAAAAAAAAAAGAAGTAGG + Intronic
1094583045 12:31751959-31751981 AAAAAAAAAAAAAATGAGGTCGG + Intergenic
1094616727 12:32042823-32042845 AAAAATAAAAATAATTAGTTGGG - Intergenic
1095548453 12:43401948-43401970 GGTAAAGAAAATAATGAGTTAGG - Intronic
1096319582 12:50599454-50599476 GAAAATACAAAAAATTAGGTGGG + Intronic
1096363459 12:51008041-51008063 AAAAATAAAAATAATGAGCCTGG + Intronic
1096430814 12:51541358-51541380 CAAAAGAAAAATCATGAGGTTGG - Intergenic
1096688055 12:53301971-53301993 AAAAATAAAAAAAATGAGGCTGG - Intronic
1096876873 12:54636235-54636257 GAAGATAAAATTAATGGGGTGGG + Intergenic
1097143304 12:56921752-56921774 GGAAATAAAAAAAAACAGGGAGG + Intergenic
1097146708 12:56945559-56945581 GGAAATAAGAATAATAATTTTGG - Intergenic
1097235014 12:57533473-57533495 GGAAACATAGAGAATGAGGTCGG + Intronic
1097682036 12:62658063-62658085 AAAAAAAAAAAAAATGAGGTGGG + Intronic
1097816827 12:64083570-64083592 GAAAATGATAATAATGAGTTTGG - Intronic
1097992217 12:65847935-65847957 GGAAATACAAATCATTAGTTTGG - Intronic
1098050013 12:66443417-66443439 GAAAAAAAAAATATTGCGGTAGG - Intronic
1098391387 12:69973190-69973212 AAAAATAAAAATAAGGAGATTGG - Intergenic
1098555548 12:71814739-71814761 AGAAAAAAAAATAAAGAGGGAGG + Intergenic
1098610887 12:72456491-72456513 GAAAAAACAAATAATGAGGAAGG + Intronic
1098613653 12:72494578-72494600 GGAAATAAGAGTAAGGATGTTGG - Intronic
1098822939 12:75255817-75255839 GGAAATAGAAGAAATGGGGTGGG - Intergenic
1098861320 12:75713851-75713873 GGAGATAATAATAATGGTGTTGG + Intergenic
1098987342 12:77026620-77026642 GGAAATAAAAATTTTCAGTTAGG - Intronic
1099208632 12:79757756-79757778 AAAAATAACAATAATGAGGATGG - Intergenic
1099305170 12:80945142-80945164 CTAAATAAAAATATTCAGGTTGG - Intronic
1099727244 12:86447749-86447771 GCAAATATAGATATTGAGGTAGG + Intronic
1099912055 12:88846214-88846236 TTAAAAAAAAATAATTAGGTGGG - Intergenic
1100328814 12:93566973-93566995 GAAAATAAAAATAATCTGGTTGG + Intergenic
1100424004 12:94465266-94465288 GGAAGTAAAGTGAATGAGGTAGG + Intergenic
1100519971 12:95365192-95365214 AGAAAAAAAAAAAATTAGGTGGG - Intergenic
1100556152 12:95695956-95695978 GGAAAGAAAAAGAAAGAGGGAGG - Intronic
1100812577 12:98353963-98353985 AGAAATGAAACTAATTAGGTTGG - Intergenic
1100863400 12:98830929-98830951 AAAAAAAAAAATTATGAGGTAGG - Intronic
1101151372 12:101885685-101885707 AAAAATAAAAAAAATTAGGTGGG - Intronic
1101465072 12:104940306-104940328 AAAAATAAAAATAATAAGGCTGG - Intronic
1102163786 12:110789939-110789961 GGAAAAAAAAAAAATTAGCTGGG + Intergenic
1102282343 12:111628326-111628348 GGACATAGAAATTAGGAGGTAGG + Intergenic
1102342979 12:112138248-112138270 AAAAATAAAAATAAAAAGGTAGG + Intronic
1102836252 12:116063355-116063377 AAAAATAAAAATAATTAGCTGGG + Intronic
1102855774 12:116292056-116292078 GGAAATAAAAAGCAAGAGGCAGG - Intergenic
1102894687 12:116589289-116589311 AAAAATAAAAATAATGAGCCAGG + Intergenic
1103054823 12:117810470-117810492 AGAAATTAAAATAATTAGCTGGG - Intronic
1103223439 12:119266196-119266218 GGAAAGAAAGACAAAGAGGTAGG - Intergenic
1103401448 12:120645828-120645850 GGAAAAAAAAGAAATGAGGAAGG + Intronic
1103542429 12:121675388-121675410 AAAAATAAAAATAATGAGGCCGG - Intergenic
1103691258 12:122775907-122775929 ATAAACAAGAATAATGAGGTTGG - Intronic
1103878330 12:124146665-124146687 TAAAATAAAAATAATGAAATAGG - Intronic
1104249268 12:127075487-127075509 GAAAATTAAAATAATGTGGATGG + Intergenic
1105372612 13:19814923-19814945 AAAAATAAAAAAAATTAGGTGGG + Intergenic
1105466399 13:20645384-20645406 GAAAATAAAAATAATTTGGCTGG - Intronic
1105904417 13:24791906-24791928 GGGAATAAAATTAATCAGATAGG + Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106060978 13:26291583-26291605 GTAATCAAAAATCATGAGGTAGG - Intronic
1106663919 13:31831739-31831761 AAAAATAAAAATAATGCTGTTGG + Intergenic
1106670245 13:31897520-31897542 TAAAATAAAAGTAATGAGGCTGG - Intergenic
1106802082 13:33266507-33266529 GGAAATACAGATGATAAGGTTGG - Intronic
1107089523 13:36462130-36462152 TAAAAAAAAAATAATGAGGAAGG - Intergenic
1107648060 13:42515950-42515972 GGAATTAAAAATAATGCAATGGG + Intergenic
1107800904 13:44107252-44107274 CGAAGTAAATATAATCAGGTGGG - Intergenic
1108397109 13:50000051-50000073 GGTAATAAAAGTTATGGGGTAGG - Intronic
1108783180 13:53862077-53862099 GGAAATAAAAAATATGACGCTGG - Intergenic
1108799466 13:54077021-54077043 AGAAATAAAAATAATCTGCTGGG + Intergenic
1108840398 13:54605955-54605977 GGAAATAATAATTATGAACTCGG + Intergenic
1109119782 13:58440313-58440335 AGAACTACAAATAATAAGGTTGG - Intergenic
1109507871 13:63330858-63330880 GATAAGAAAAAAAATGAGGTAGG - Intergenic
1109658706 13:65429747-65429769 GAAAACAAAAATAATGAATTAGG - Intergenic
1109729639 13:66395300-66395322 GGAAATAAATAAACTGAGTTTGG + Intronic
1110049402 13:70875422-70875444 GGAGATAAAAAGAATTAGATGGG + Intergenic
1110075340 13:71233893-71233915 GGAATTAAAATTAATGAGCAGGG + Intergenic
1110182425 13:72633655-72633677 GGAAATACAAAAAATTAGCTGGG - Intergenic
1110210730 13:72969041-72969063 AAAAATAAAAATAATGAGAGTGG + Intronic
1110819192 13:79894656-79894678 GGTAATAAATATAATGACTTTGG + Intergenic
1110883377 13:80601143-80601165 AAAAATAAAAATAATAAGCTGGG - Intergenic
1111033060 13:82632709-82632731 GGAAAGAAAGAGAATGTGGTGGG - Intergenic
1111362875 13:87198430-87198452 GGAAACAAAAATAATTATGGAGG + Intergenic
1111766865 13:92542312-92542334 GGGAATAAATATGGTGAGGTTGG - Intronic
1111794756 13:92904819-92904841 TGAAAAAAAAATTATGAGGATGG - Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1112503655 13:99960353-99960375 GCAAATAAAAGTACTTAGGTGGG + Intergenic
1112557635 13:100483253-100483275 GGAAAAAAAAAAAAGGAGCTGGG + Intronic
1112667920 13:101598099-101598121 GTACATAAAGATAATGAAGTTGG - Intronic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1112947564 13:104950090-104950112 TGAAACAAAAAGAATGAGGCTGG + Intergenic
1113076768 13:106474696-106474718 TGAAATAAATGTAATGAGGCAGG + Intergenic
1113511597 13:110859785-110859807 GGAAATAAAAATGATTGGGTAGG - Intergenic
1114155098 14:20093543-20093565 GGAAATAAACATACTGAGAAAGG - Intergenic
1115116622 14:29888142-29888164 AAAAATAAAAATAATTAGGCAGG + Intronic
1115381452 14:32744784-32744806 AGGAATAAAAACAATGAAGTAGG - Intronic
1115382759 14:32758435-32758457 AGAAACAAAAAAAATGAGGCTGG + Intronic
1115410080 14:33064384-33064406 GGAAATAAAAGTTATGAGTAGGG - Intronic
1115647602 14:35380500-35380522 TGAAAAAAATATAATCAGGTTGG + Intergenic
1115898861 14:38122332-38122354 AAAAATAAAAATAATTAGCTGGG + Intergenic
1115952757 14:38739772-38739794 GGAAATACAAATAATTAGCCAGG + Intergenic
1116032626 14:39591054-39591076 GGAAACATAAATATTGTGGTAGG - Intergenic
1116317363 14:43415503-43415525 GGGAATAAAAATGGTGAAGTGGG + Intergenic
1116466738 14:45242029-45242051 GGACTTAAAAAAAATCAGGTGGG - Exonic
1116674319 14:47886233-47886255 AGAACTAAAAATAATATGGTTGG - Intergenic
1116797448 14:49407117-49407139 AGAAATAAAAAAAAAGATGTAGG - Intergenic
1117052429 14:51874569-51874591 GAAAATAAAAAAAATTAGCTGGG + Intronic
1117157688 14:52957084-52957106 TTAATTAAAAATAAAGAGGTGGG + Intergenic
1117283194 14:54260519-54260541 AGAAATAAAAATCATGAGTTAGG - Intergenic
1117386609 14:55220507-55220529 AAAAATAAAAATAATTAGCTGGG - Intergenic
1117627898 14:57658997-57659019 GGAAAGAAAGAAAATAAGGTTGG + Intronic
1117826498 14:59709950-59709972 GGAAATAAAATTAAAAAGGAAGG - Intronic
1117877082 14:60263667-60263689 AGAAATAAAAACAATTGGGTGGG - Intronic
1118135551 14:63022258-63022280 GGAGATAAAAGTAATGCGATTGG - Intronic
1118177728 14:63458561-63458583 GGTAATAAATATAATGATGTAGG - Intronic
1118230715 14:63946265-63946287 AAAAATAAAAATAATTAGCTGGG + Intronic
1118311385 14:64696075-64696097 GGAAACTAAGATATTGAGGTGGG + Intergenic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1118567945 14:67163143-67163165 AAAAATAAAAAAAATTAGGTGGG + Intronic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1118652268 14:67909619-67909641 GTCACTAAAAATAATGATGTGGG + Intronic
1118712681 14:68535412-68535434 GAAACTAAAAATAATGAAGAAGG - Intronic
1118931699 14:70247800-70247822 GGAAGTAAAAATAAAAAGATGGG + Intergenic
1118953465 14:70457324-70457346 GGAAGTAAAAATAAAAAGATGGG - Intronic
1118981702 14:70722300-70722322 GAAAATACAAAAAATTAGGTGGG + Intergenic
1118992009 14:70805763-70805785 GTAAATAAAAATAATTGGCTGGG + Intronic
1119352434 14:73977117-73977139 GGAAAAAAAAAAAACAAGGTTGG - Intronic
1119412968 14:74447111-74447133 AGAAATAAAAATAATATGCTAGG + Intergenic
1119584334 14:75818465-75818487 GAAAAGAAAAATAATGATATAGG - Intronic
1119617677 14:76109588-76109610 GGAAATAAAAAGCATGTGTTGGG + Intergenic
1119759883 14:77142733-77142755 GGAAATAGAAATAAGAAGGTGGG - Intronic
1119783439 14:77294858-77294880 GGAAATAAAAATAAAGCATTTGG + Intronic
1119830289 14:77696347-77696369 GAAAATAAAAAAAATTAGCTGGG - Intronic
1120189416 14:81426915-81426937 GCACATAAAAATAAAGCGGTAGG - Intronic
1120461342 14:84800609-84800631 GGTAATAAATAAAATTAGGTAGG - Intergenic
1120589185 14:86355228-86355250 GGAGATACAGGTAATGAGGTGGG + Intergenic
1120600583 14:86500844-86500866 GTAAATAAAAATAAAGATGATGG + Intergenic
1120685127 14:87529143-87529165 GGAGTAAAAAAAAATGAGGTGGG - Intergenic
1120777293 14:88451824-88451846 AGAAATAAAAAAAATGATATAGG - Intronic
1120859281 14:89240278-89240300 GGAAAAAAAAAAAATGAGCATGG + Intronic
1120904853 14:89611508-89611530 ATAAAGAAAAATAATGAGGCCGG + Intronic
1121664547 14:95661929-95661951 GCAAATAAGAATAATGTGGCCGG - Intergenic
1121876778 14:97459878-97459900 AGAAATAAAAAAAATTAGCTAGG + Intergenic
1122005149 14:98697360-98697382 GGAAATGAAGATAATGAAGGAGG + Intergenic
1122223972 14:100261987-100262009 ATAAATAAAAATAATTAGCTGGG + Intronic
1123418110 15:20107268-20107290 GGGAGAAAAAATAATGAGGCAGG + Intergenic
1123527328 15:21113790-21113812 GGGAGAAAAAATAATGAGGCAGG + Intergenic
1123721910 15:23067876-23067898 AGAAAAAAAAAAAATGAGCTGGG - Intergenic
1124031332 15:26015304-26015326 GGAAAAAAAAAAAAAAAGGTTGG - Intergenic
1124147925 15:27146516-27146538 ACAAATAAAAATATTGAGGGAGG - Intronic
1124480669 15:30076421-30076443 ACAAATAAAAATAATTAGGCTGG + Intergenic
1124719090 15:32096642-32096664 GGAAAAAGAAATAATGTGATGGG + Intronic
1124908464 15:33894647-33894669 AGAAATACAAAAAATTAGGTGGG + Intronic
1125437991 15:39668607-39668629 GGCAATAAAAGGAATGAAGTTGG - Intronic
1125568865 15:40699056-40699078 AGAAATAAAAATGATAAAGTAGG - Intronic
1125658126 15:41375000-41375022 GGAAAAAAAAAAAATTAGCTAGG - Intronic
1125678801 15:41517701-41517723 GGAAAGAAAACTTATGAAGTGGG + Intronic
1125689157 15:41582519-41582541 GGAAAAAAAAAAAATTAGCTGGG + Exonic
1126225801 15:46267470-46267492 TGAAAAAAAACTAATGATGTAGG - Intergenic
1126442399 15:48703610-48703632 GGAAATAAAGATAATAACTTAGG - Intergenic
1126471826 15:49020666-49020688 GAAAATAAAAAAAATTAGCTGGG - Intronic
1126551515 15:49935982-49936004 AGAAAAAAAAATAAATAGGTTGG - Intronic
1126681094 15:51202854-51202876 GGAAACAAATATAAGGAGGAAGG + Intergenic
1126731663 15:51689626-51689648 ACAAATAAAAATAATTAGCTGGG + Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1126904473 15:53349546-53349568 GGAAATAAGCAAAATGAGCTTGG + Intergenic
1127111288 15:55673837-55673859 AGAAGAAAAAATAATGAGGGAGG + Intronic
1127442799 15:59027831-59027853 GGAAAAAAAAAAAAAAAGGTGGG - Intronic
1127743212 15:61935045-61935067 GTAATTAAAGATAATGAGGCTGG - Intronic
1128245613 15:66130707-66130729 GGAAAGAAAAAGAAAGAGGGAGG + Intronic
1128263146 15:66246649-66246671 AAAAATAAAAATAATTAGCTGGG + Intronic
1128451501 15:67808325-67808347 ATAAATAAAAATAGTGAGCTAGG + Intergenic
1128500477 15:68223743-68223765 GGAAAAAAAAAAAAAGAGGGGGG + Intronic
1128817026 15:70617866-70617888 GAAAATAAAAATTAGGTGGTGGG - Intergenic
1129020197 15:72509894-72509916 GGAAAAAAAAAAAAAAAGGTGGG - Intronic
1131161985 15:90111709-90111731 AAAAAAAAAAAGAATGAGGTAGG + Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1131229644 15:90650665-90650687 GGAAATAAAATGACTGGGGTGGG + Intergenic
1131672696 15:94636680-94636702 AAAAATAAAAAAAATGAGCTGGG + Intergenic
1131690212 15:94819043-94819065 GTGAATAAAAATAATGAGAAAGG - Intergenic
1132069904 15:98767144-98767166 GTAACTAAAAATAATGATCTAGG - Intronic
1132124529 15:99211076-99211098 GGAAATAAGAATATACAGGTTGG + Intronic
1132149579 15:99450075-99450097 GGTATAAAAAAGAATGAGGTTGG + Intergenic
1132324288 15:100954212-100954234 GGAAATTAAAAACATGAGTTAGG - Intronic
1132345497 15:101105869-101105891 GGGAAAGAAAATAATGAGGGTGG + Intergenic
1132370791 15:101296520-101296542 GGAAAAAAAAAAAATGAGCCAGG - Intergenic
1132763222 16:1521223-1521245 GAAAATACAAAAACTGAGGTAGG - Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133633393 16:7643323-7643345 GGAAATAAAAATAGTCATCTAGG - Intronic
1133943595 16:10330202-10330224 GAAAATAAAAAAAATTAGCTGGG - Intronic
1133984290 16:10656410-10656432 AAAAATAAAAATAATTAGCTGGG - Intronic
1134259059 16:12636210-12636232 AAAAATAAAAATAATTAGCTGGG + Intergenic
1134756487 16:16672054-16672076 AAAAATAAAAAAAATTAGGTAGG + Intergenic
1134989582 16:18687109-18687131 AAAAATAAAAAAAATTAGGTAGG - Intergenic
1135065895 16:19309536-19309558 GGAAATAAGATTAATAAGTTTGG + Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135263986 16:21005673-21005695 GAAAAAAAAAAAAATGAGGCTGG - Intronic
1135624879 16:23985775-23985797 GAAAATAAGGATAATGAGGGTGG + Intronic
1135686518 16:24502319-24502341 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1135884895 16:26296681-26296703 GGAAATAAAAATAGTGGGAATGG - Intergenic
1136042677 16:27592848-27592870 AGAAATAAAAATAATAAGCTGGG - Intronic
1136072971 16:27799618-27799640 GGAAAGAAAAATGATGATGCAGG + Intronic
1136928464 16:34396774-34396796 GGAAGTAGTAATAATTAGGTGGG + Intergenic
1136976110 16:35015030-35015052 GGAAGTAGTAATAATTAGGTGGG - Intergenic
1136987264 16:35119104-35119126 TGAAATTAAAATGATAAGGTTGG - Intergenic
1137011366 16:35324037-35324059 TAAAATAAAAATAATTAGCTGGG + Intergenic
1137666530 16:50252837-50252859 GAAAATATAAGTAATAAGGTGGG + Intronic
1137986460 16:53112587-53112609 GGAATTAAAAATATTGACTTAGG - Intronic
1138049497 16:53761255-53761277 TGAAAAAAAAAAAATGAGCTGGG - Intronic
1138108474 16:54304733-54304755 GGAAATGAAAAGAATGAAATGGG + Intergenic
1138243543 16:55448228-55448250 AAAAATAAAAATAATTAGCTGGG + Intronic
1138856200 16:60696482-60696504 AGAAATAAAAATAAGGAGTAGGG - Intergenic
1139042908 16:63019740-63019762 GAAAATAGTAAGAATGAGGTTGG + Intergenic
1139135332 16:64196862-64196884 GACAATGAAAATAATGATGTTGG - Intergenic
1139203360 16:65002117-65002139 GGAAAAATAAATAAAGTGGTTGG - Intronic
1139408069 16:66735418-66735440 GAAAATTAGAATGATGAGGTAGG - Intronic
1139412857 16:66779435-66779457 AAAAATAAAAATAATAAGCTGGG + Intronic
1139500437 16:67359799-67359821 GGAAGTGAAGATAATGAGTTTGG + Intronic
1139556805 16:67717488-67717510 GCAAATAAAAATAATAATGAGGG + Intronic
1139604728 16:68010031-68010053 GGAAAAAAAAATAAGATGGTTGG - Intronic
1139604984 16:68011860-68011882 AAAAATAAAAATAATTAGTTAGG - Intronic
1139992331 16:70950232-70950254 AAAAATAAAATTAATGATGTAGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140288457 16:73627271-73627293 GGAGATAAAATTGAAGAGGTTGG + Intergenic
1140583370 16:76257238-76257260 GGAAAGAAGCATAATGAGTTGGG - Intergenic
1140590711 16:76348965-76348987 GAATATAAAAATAATGAAGCAGG + Intronic
1141051096 16:80764708-80764730 GAAAATAATAATAATTAAGTGGG + Intronic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141484774 16:84331461-84331483 AGTAATAATCATAATGAGGTTGG - Intergenic
1141683218 16:85555947-85555969 GCAAATAAAAAAAAGGAGGGGGG - Intergenic
1142320746 16:89381169-89381191 AAAAATAAAAATAATAAGCTGGG + Intronic
1143224058 17:5285430-5285452 AGAATAAAAAATAATGAAGTAGG - Intronic
1143261474 17:5602057-5602079 CGAAAAAAAAAAAAAGAGGTGGG - Intronic
1143700254 17:8653955-8653977 GGAAATATACAAAATGAGCTTGG + Intergenic
1143849959 17:9803401-9803423 GGATATAAGAATAATGATGCTGG - Intronic
1144214794 17:13045724-13045746 GGAAAAAAAAAAAATGAGCCGGG + Intergenic
1144820400 17:18069316-18069338 AGAAATAAAAAAAATTAGGTGGG - Intergenic
1144868928 17:18356336-18356358 AAAAATAAAAATAAATAGGTGGG - Intronic
1145754975 17:27383716-27383738 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1145859674 17:28198623-28198645 GGAAAAAAAAATAGTGAAGATGG - Intergenic
1145988544 17:29063975-29063997 AAAAATAAAAATAATTAGCTAGG - Intergenic
1146002835 17:29141436-29141458 GGAAAAAAAAAAAATGGGGTGGG + Intronic
1146886472 17:36474292-36474314 AGAAAAAAAAAAAATGAGTTTGG + Intergenic
1147285446 17:39399616-39399638 GGTAAAAAAAAGAATAAGGTGGG - Intronic
1147814790 17:43201307-43201329 AGAATTAAAAATAATTAGTTTGG - Intronic
1148164442 17:45473290-45473312 AGAAAAAAAAAGAATGAGGCTGG + Intronic
1148273034 17:46278783-46278805 AAAAATAAAAATAATGACATTGG - Intronic
1148533509 17:48418127-48418149 AAAAATAAAAATAATTAGCTGGG + Intronic
1148973887 17:51509927-51509949 AAAAATAAAAATAATTAGTTGGG + Intergenic
1149023261 17:51994845-51994867 GGATATGGATATAATGAGGTAGG - Intronic
1149460020 17:56821068-56821090 ATAAATAAAAATAATTAGCTGGG - Intronic
1149717715 17:58809681-58809703 GGCAATGAAAAAAATGAGGGGGG - Intronic
1150046590 17:61919568-61919590 GAAAATAAAAAAAATTAGCTGGG - Intronic
1150525937 17:65922854-65922876 GTAAATAAAAATATTAAGGAAGG - Intronic
1150763022 17:67979548-67979570 GATAATAAAAATAATGACATTGG + Intronic
1150896146 17:69213310-69213332 GAGAATAAAAACAATCAGGTGGG + Intronic
1150905801 17:69335640-69335662 GAAAATAAAAACTATGAGGGAGG - Intergenic
1150988489 17:70227377-70227399 GGGAATAAAATAAATGATGTTGG + Intergenic
1151831752 17:76556877-76556899 CAAAATAAAAATAATCAGCTGGG + Intergenic
1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG + Intergenic
1152174727 17:78780346-78780368 AGAAATAAAAATAATTAGCAGGG + Intronic
1152207880 17:78984862-78984884 GAAAATATAAAAAATGAGCTGGG + Intergenic
1152209031 17:78993248-78993270 GGAAAGAAAAGAAACGAGGTCGG + Exonic
1152677585 17:81649551-81649573 GAAAATAACAATAATGAGGCTGG - Intergenic
1152985284 18:315501-315523 GGAAAAAAAAAAAATTAGCTGGG - Intergenic
1152988248 18:338908-338930 GGAAATCCAAATAATGAAGATGG + Intronic
1153423494 18:4935943-4935965 GTAAACAAAAATAATGAAGCTGG - Intergenic
1153523631 18:5975342-5975364 GGAAATAAAAAAAATGCAGTCGG + Intronic
1153555830 18:6312346-6312368 GGAAATATCAATAAAGAAGTTGG - Intronic
1153613290 18:6909724-6909746 GGAAATAGAAAGAATGAATTTGG - Intronic
1153678705 18:7479762-7479784 TGATATAAAAAGAATGATGTTGG - Intergenic
1154013494 18:10595681-10595703 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154095567 18:11411859-11411881 GTACATAAAAGTAAAGAGGTTGG - Intergenic
1154152718 18:11919276-11919298 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154198952 18:12286232-12286254 AAAAATAAAAATAAAGAGCTTGG + Intergenic
1154995930 18:21640387-21640409 GAAAAAAAAAAAAATCAGGTGGG - Intergenic
1155269046 18:24121843-24121865 TGATCTAAAAATAATGGGGTTGG + Intronic
1155525119 18:26708017-26708039 ACAAATAAAAATAATTAGCTGGG - Intergenic
1155551097 18:26966069-26966091 AGAAATAAAAACAATTAGTTGGG - Intronic
1155628979 18:27869228-27869250 CAAAATAAAAATAAATAGGTGGG + Intergenic
1155925855 18:31653912-31653934 GTAAAAAAAAAAAATGAGATGGG - Intronic
1156124242 18:33883596-33883618 GGAAATCAAAATAACAATGTGGG + Intronic
1156368421 18:36450630-36450652 TAAAATAAAAATAATTAGCTGGG + Intronic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1157647485 18:49290889-49290911 GCAATTAAAAATAATAAGGAAGG + Intronic
1158062860 18:53367194-53367216 CAAAATAAAAATAATTAAGTGGG - Intronic
1158295430 18:55992032-55992054 GCAAAGAATAATAAAGAGGTAGG + Intergenic
1159123188 18:64193550-64193572 GGCAAGGAAAATAATGATGTAGG + Intergenic
1159128056 18:64247793-64247815 AGAAAGAGAAAGAATGAGGTTGG - Intergenic
1159208460 18:65284300-65284322 AAAAATAAAAATAATTAGCTGGG + Intergenic
1159254006 18:65921886-65921908 GTAAATAAAAATAAAAATGTAGG - Intergenic
1159493557 18:69170433-69170455 GGAAATCAAAATAATTGGGTGGG - Intergenic
1159824481 18:73189804-73189826 GGAAATACAAAGACTGAGGAAGG + Intronic
1160446352 18:78930093-78930115 GGAATTAATAACAATGAGTTAGG - Intergenic
1160479852 18:79228863-79228885 AAAAATAAAAAAAATTAGGTGGG + Intronic
1160700337 19:503597-503619 AAAAGTAAAAATAATGTGGTCGG + Intronic
1160758225 19:769266-769288 GGAAATACAAAAAATTAGCTGGG + Intergenic
1160916772 19:1500401-1500423 GAAAATAAAAATAAAAAGGCTGG + Intergenic
1161092726 19:2370486-2370508 AAAAATAAAAATAATGAGCCAGG - Intergenic
1161405101 19:4087093-4087115 GGAAAAAAAAATACCGAGCTGGG + Intergenic
1161435346 19:4259538-4259560 AGAAATAAAAACAATTAGCTGGG - Intronic
1161488105 19:4546561-4546583 TAAAATAAAAATAAAGAGGCAGG - Intronic
1161532273 19:4797106-4797128 TGGAAGAAAAATAATGAAGTAGG + Exonic
1161537039 19:4825998-4826020 TAAAATAAAAATAATTAGCTGGG + Intronic
1161640961 19:5422773-5422795 AAAAATAAAAATAATGAGCCTGG - Intergenic
1161960140 19:7518761-7518783 AAAAATAAAAATAAAGAAGTGGG + Intronic
1162363520 19:10233642-10233664 TAAAATAAAAATAAAGAGGCTGG + Intergenic
1162444879 19:10716725-10716747 TAAAATAAAAATAATTAGCTGGG + Intergenic
1162517645 19:11158877-11158899 GAAAAAAAAAATAATTAGCTGGG - Intergenic
1162712011 19:12602387-12602409 AAAAATAAAAATAATTAGTTGGG + Intronic
1162754565 19:12849679-12849701 AAAAATAAAAATAATTAGCTAGG + Intronic
1162992299 19:14311453-14311475 AAAAATAAAAATAATTAGCTGGG + Intergenic
1163354670 19:16802297-16802319 AAAAATAAAAATAATGAGCTGGG + Intronic
1163444047 19:17336530-17336552 GTAAATAAAAATATTGAGCAGGG + Intronic
1163535352 19:17873459-17873481 GGAAAAAAAAATATTGTGGCAGG + Intronic
1164031190 19:21407186-21407208 GAAAATACAAATAATTAGTTGGG + Intronic
1164090157 19:21943672-21943694 TGAAACAAAAAAAATGAGATAGG + Intronic
1164106399 19:22109871-22109893 TGAAACAAAAAGGATGAGGTAGG - Intergenic
1164185453 19:22863724-22863746 GTAAATAAAAATAATGTGGTAGG - Intergenic
1164314805 19:24077930-24077952 GAAAATAAAAAAAAAGAGCTTGG + Intronic
1164389195 19:27803409-27803431 TGAAATAAAAATGATAAGGTTGG + Intergenic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
1165135265 19:33663888-33663910 TAAAATAAAAAGCATGAGGTAGG + Intronic
1165364093 19:35353326-35353348 AAAAATAAAAATAATTAGCTGGG + Exonic
1165401920 19:35606515-35606537 TGAAATAAAAATAACAAGGAGGG - Intergenic
1165452022 19:35889379-35889401 ACAAATAAAAATAAAGATGTGGG + Intronic
1165632595 19:37314270-37314292 AAAAATAATAATAATTAGGTGGG - Intronic
1166273395 19:41733320-41733342 AGAGACAAAAATAATGAGCTGGG + Intronic
1166758279 19:45208309-45208331 AGAAATAAAAATAATCAGTCAGG + Intronic
1166770665 19:45280187-45280209 GAAAATACAAAAACTGAGGTGGG + Intronic
1166774736 19:45305499-45305521 GGGAAAAAAAAAAGTGAGGTGGG - Intergenic
1167131545 19:47589483-47589505 GGAAATAAAAATAATAAAGTGGG + Intergenic
1167176329 19:47866948-47866970 AAAAAAAAAAATAGTGAGGTTGG + Intergenic
1167882065 19:52467865-52467887 GGGAAAAAAAATAAAAAGGTTGG + Intronic
1168225993 19:54995586-54995608 GGAAAAAATAAAAAAGAGGTAGG + Intronic
1168716968 19:58534850-58534872 GAAAAAAAAAAGAATTAGGTCGG - Intronic
1202687630 1_KI270712v1_random:60570-60592 GGAAGAAAAAATAATGAGGCAGG + Intergenic
925457206 2:4026308-4026330 AGAAGTAAAAATATTGATGTGGG + Intergenic
925570736 2:5310075-5310097 GGAAATAATTATAATGAGTGAGG + Intergenic
925940401 2:8811716-8811738 AGAAAAAAAGATAATTAGGTAGG + Intronic
925955431 2:8959280-8959302 GGAAATTTAAAAATTGAGGTTGG - Intronic
926417393 2:12663399-12663421 GGAACAAAAAATAAGGAGTTGGG - Intergenic
926609149 2:14928292-14928314 AGAGATAAAAATAATGACTTTGG - Intergenic
926659725 2:15451209-15451231 GAAAATAAAAATAATTAGCTGGG - Intronic
926990524 2:18675354-18675376 AGAAATAAAAAAAATGTGGGAGG - Intergenic
927087723 2:19688000-19688022 GGAAATAAAAATAGGTAGGCAGG + Intergenic
927584468 2:24288046-24288068 GGAAACAAAAATAAACAAGTGGG - Intronic
927896039 2:26782745-26782767 GGAAATAAAAACAATTAGCTGGG - Intronic
927985161 2:27405064-27405086 AAAAAAAAAAAAAATGAGGTAGG - Intronic
928418614 2:31119854-31119876 GTCATTAAAAATAATGAGCTAGG + Intronic
928553692 2:32399946-32399968 AAAAATAAAAATAATTAGCTGGG - Intronic
928592402 2:32831119-32831141 GCAAATTAAAATAAAGAGATAGG + Intergenic
928738690 2:34323819-34323841 GGAAGTAAAGACAATCAGGTGGG - Intergenic
928779076 2:34799201-34799223 TGAAATGAAAATAATAAGATGGG - Intergenic
928978461 2:37114135-37114157 AAAAATAAAAATAATTAGCTGGG + Intronic
928985312 2:37174848-37174870 GGTAATAAAAAAAAATAGGTAGG - Intronic
930246389 2:48987503-48987525 AAAAATAAAAATAATCAGGTGGG - Intronic
930379975 2:50615388-50615410 GGAAATGAAACTGAAGAGGTAGG - Intronic
930422638 2:51173713-51173735 GGAAATAAAAATCTTGATATTGG - Intergenic
930655001 2:53999068-53999090 GGAAATACAAAAAAGGATGTGGG + Intronic
930655604 2:54004285-54004307 GCAAATTAAAATGATGAGGTAGG - Intronic
930995705 2:57714972-57714994 GGAAACAAAAGTCATGAAGTTGG + Intergenic
931064002 2:58563915-58563937 AGAAATAAAAAATGTGAGGTAGG - Intergenic
931356507 2:61541685-61541707 AAAAATAAAAATAATGAGATAGG + Intergenic
931527455 2:63172519-63172541 AAAAATAATAATAAAGAGGTAGG + Intronic
931579488 2:63758113-63758135 GGAAATACAATTTATTAGGTTGG - Intronic
931587672 2:63845906-63845928 ATTAATAAAAATATTGAGGTAGG + Intronic
931779256 2:65565480-65565502 AGAAAAAAAAATAATAAGCTGGG - Intergenic
932044523 2:68334586-68334608 CCAAATAACAATAATGAAGTTGG - Intergenic
932150372 2:69365588-69365610 GGATTCAAAAATAATAAGGTAGG - Intronic
932185047 2:69687345-69687367 ACAAATAAAAATAATTAGCTGGG + Intronic
932346630 2:70999937-70999959 AGAAATAAAAAAAATTAGCTGGG + Intergenic
932426703 2:71642202-71642224 GGAAAGAAAAATAAAGATTTAGG + Intronic
932499448 2:72170642-72170664 AAAAATAAAAAAAATTAGGTGGG + Intergenic
932510735 2:72286703-72286725 GGGAATACGAATAATGAGGGAGG + Intronic
933055493 2:77658031-77658053 GAAAATAAAAATAATTTAGTAGG - Intergenic
933289421 2:80421156-80421178 GGAAAAAAAAATAATGCTGATGG + Intronic
933364639 2:81334965-81334987 GGATATAAGAATTATGAGGTAGG + Intergenic
933669758 2:84995611-84995633 AGAAATAAAAATGATAAAGTTGG - Intronic
933958723 2:87395015-87395037 GGAAGAAAAAATAATGAGGCAGG - Intergenic
934166979 2:89302703-89302725 GGACATAAATATAATTAGGGTGG - Intergenic
934200299 2:89879751-89879773 GGACATAAATATAATTAGGGTGG + Intergenic
934242853 2:90287021-90287043 GGAAGAAAAAATAATGAGGCAGG - Intergenic
934270323 2:91529662-91529684 GGAAGAAAAAATAATGAGGCAGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934676893 2:96255817-96255839 GGAAAAAAAAAAAATTAGCTGGG + Intronic
934683946 2:96306645-96306667 GCAAGTAAAAATAAGGAGATGGG - Intergenic
935477262 2:103537880-103537902 AAAAATACAAAAAATGAGGTAGG - Intergenic
935682489 2:105650025-105650047 AAAAATAAAAATAATTAGCTGGG + Intergenic
936041318 2:109151999-109152021 GGAAATTTAAATAATCAGCTGGG - Intronic
936599573 2:113882531-113882553 AGACATAAAAATACTGATGTCGG - Intergenic
936630576 2:114198586-114198608 AAAAATAAAAATTATGAGATTGG - Intergenic
936706682 2:115083506-115083528 GGACACAAATATAATGAGGAGGG - Intronic
936764799 2:115833918-115833940 AGAAAGAAAAATAAGAAGGTGGG - Intronic
937417357 2:121726510-121726532 AAAAAAAAAAAAAATGAGGTGGG - Intergenic
937948886 2:127368324-127368346 AAAAATAAAAATAAGGCGGTCGG + Intronic
938026871 2:127957001-127957023 AGAAATGAAAATATTGAGTTGGG + Intronic
938034380 2:128024317-128024339 GGAAAAAAAAAAAATTAGGTTGG + Intronic
938152189 2:128896903-128896925 GGAAATACAAAAAATTAGCTGGG + Intergenic
938170082 2:129068354-129068376 TGAAATAAAAATAAAGAAGTTGG - Intergenic
938657416 2:133448249-133448271 GGAAAAAAAAAAAAAGAGGGAGG + Intronic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
938804743 2:134795788-134795810 AGGAATAAAAATAATGAACTCGG - Intergenic
938893454 2:135728001-135728023 GTAATTAAAAATTATTAGGTTGG + Intergenic
938932384 2:136098199-136098221 GGAGATGAAATTTATGAGGTGGG - Intergenic
939274241 2:139979376-139979398 TGAGATAAAATTAATGAGGACGG - Intergenic
939308832 2:140445616-140445638 GGGAATAATAATAATAAGGCAGG + Intronic
939325790 2:140686515-140686537 TAAAATAATAATAGTGAGGTTGG + Intronic
939498711 2:142953466-142953488 GGAAATAAATATAATGAAGATGG + Intronic
939529862 2:143344881-143344903 GAAAATATAACTAATGAGGAAGG + Intronic
939558295 2:143703394-143703416 GGAAAAAAAAATAAAAAGGAAGG - Intronic
939730519 2:145778861-145778883 GGAAACAAAAATTATGATGAAGG - Intergenic
940170414 2:150824089-150824111 GGAAAGAAAAAAAATGAATTAGG + Intergenic
940320155 2:152368181-152368203 GGAATTAAAGATAATGATTTAGG + Intronic
940708193 2:157129840-157129862 TGAAAAAAAAATAATAAGCTAGG + Intergenic
940833353 2:158492939-158492961 GAAAATAAATATTATTAGGTAGG - Intronic
940918693 2:159285543-159285565 AAAAATAAAAATAATTAGCTGGG + Intronic
941004659 2:160235722-160235744 AGAAATAAAAACAATGAACTGGG + Intronic
941052558 2:160750881-160750903 GGAAATAAATATGAATAGGTAGG - Intergenic
941104039 2:161332121-161332143 GGAAATTAAAATATTTAGGAGGG + Intronic
941473342 2:165918013-165918035 GAAAATGATAAAAATGAGGTGGG + Intronic
941893855 2:170610030-170610052 GGAAATAAAATTCTTGAGGTGGG - Intronic
942033432 2:171987238-171987260 AAAAATAAAAATAATTAGCTGGG + Intronic
942120064 2:172767969-172767991 AAAAATAAAAAAAATGAGCTGGG - Intronic
942177888 2:173352521-173352543 GGATATAAAAATAATGAAAAAGG + Intergenic
942701594 2:178717399-178717421 GGAAATAAAAATCACCATGTTGG - Intronic
942768474 2:179486015-179486037 GGAAAAAAAAATAATCACGTGGG + Intronic
943066838 2:183096530-183096552 TGAAAAAAACAAAATGAGGTCGG - Exonic
943094258 2:183409751-183409773 AGAAAAAAAAAAAAGGAGGTTGG - Intergenic
943326694 2:186507524-186507546 GAAAGTATAAATAATGAGTTAGG + Intronic
943393257 2:187297812-187297834 AGAAATTAAATTAATGGGGTTGG + Intergenic
943395096 2:187324001-187324023 AAAAAGAAAAATAATGAGGATGG - Intergenic
943434424 2:187846989-187847011 GAAAATTAAAGTAATCAGGTGGG + Intergenic
943454797 2:188092199-188092221 GTAAATAAAAACAAAGGGGTAGG + Intergenic
943816198 2:192258768-192258790 GGACATCAATATAAGGAGGTGGG + Intergenic
943900053 2:193422278-193422300 GGAAATAAGAGAAATGAGGATGG - Intergenic
944204172 2:197140038-197140060 AAAAATAAAAAAAATTAGGTGGG - Intronic
944447847 2:199809389-199809411 GGAATTAAAAATAAAGAGTTTGG - Intronic
944450208 2:199834749-199834771 GGAAATAAGAGTATTGGGGTAGG - Intronic
944660855 2:201920424-201920446 TTAAATATAAAAAATGAGGTGGG + Intergenic
944713133 2:202353863-202353885 GAAAGAAAAATTAATGAGGTTGG - Intergenic
945011931 2:205473572-205473594 TGAAATAAAAATAAACAGGAAGG + Intronic
945489261 2:210435696-210435718 GGAGAAAAAAATAAAGATGTAGG - Intronic
945608282 2:211964485-211964507 GTTAATAAAAATAATGACATAGG + Intronic
945734778 2:213585926-213585948 GGAAAAAAAAAGAAGGAGGAGGG - Intronic
945761974 2:213924591-213924613 GGAAATGAAAATAAAGATGAGGG - Intronic
945843582 2:214916602-214916624 GGAGAAAAAAATAATGTGGAAGG - Intergenic
946065628 2:216985027-216985049 AAAAATAAAAATAATTAGCTTGG + Intergenic
946294580 2:218773694-218773716 GAAAATACAAAAAATGAGCTGGG - Intergenic
946833388 2:223747691-223747713 GGAAATAAAAATAAGAAGTTTGG - Intergenic
947114465 2:226754011-226754033 AAAAATAAAAATAATTAGGCAGG - Intronic
947269336 2:228316713-228316735 TGAAATAAAAACAATTATGTTGG - Intergenic
947287702 2:228535299-228535321 GGAAATAAAAGAAATGTTGTGGG + Intergenic
947920776 2:233870519-233870541 GCAAATAAAAATGAAGAGTTTGG + Intergenic
948851536 2:240710400-240710422 AGAAATAAAAATAATCTGGCTGG + Intergenic
948937425 2:241176434-241176456 GAAAAAAAAATTAATGAGATAGG - Intronic
1168780509 20:485340-485362 GGAAATACAAAAAATTAGCTGGG - Intronic
1168817232 20:747162-747184 GAAAATACAAAAAATTAGGTGGG + Intergenic
1168974907 20:1957446-1957468 GCAAATGAAAACAATGGGGTAGG + Intergenic
1169031644 20:2413694-2413716 GGAAATAAAAAGAATGAAGTTGG + Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169201915 20:3714905-3714927 ATAAATAAAAATAACTAGGTAGG + Intergenic
1169242642 20:3997585-3997607 GAAAAAAAAAATAATTAGCTGGG - Intronic
1169898819 20:10532934-10532956 AAAAATAAAAATAATTAGCTGGG - Intronic
1170118670 20:12888643-12888665 TAAAATAAAAATAATTAGCTGGG + Intergenic
1171184523 20:23115429-23115451 GGCAATAAAGAAAAAGAGGTAGG - Intergenic
1171257576 20:23701709-23701731 GGAAAGAAAAACAATGACGTAGG + Intergenic
1171934579 20:31261799-31261821 GGATATAAAACTACTGAGGCAGG - Intergenic
1172360604 20:34310212-34310234 AAAAATAAAAATAATTAGCTGGG - Intronic
1172571954 20:35977515-35977537 AAAAATAAAAATAATTAGCTAGG + Intronic
1172735309 20:37122479-37122501 AAAAATAAAAATAATTAGCTGGG + Intronic
1173237738 20:41263226-41263248 TGAAATAATGATAATGAAGTTGG + Intronic
1173280288 20:41620845-41620867 TGAAATAACATAAATGAGGTGGG + Intergenic
1173784127 20:45780234-45780256 AAAAATAAAAATAATTAGCTGGG - Intronic
1173962359 20:47084546-47084568 AGAAATAAAAATAAAGAAATGGG + Intronic
1173983190 20:47240713-47240735 GAAAATAAAAAAAATTAGCTGGG - Intronic
1174009218 20:47436137-47436159 AGAAATAAAAATAAAGGGGAAGG - Intergenic
1174213645 20:48899489-48899511 AGAAAGAAAAAGAAAGAGGTAGG - Intergenic
1174232916 20:49061331-49061353 AAAAATACAAATAATTAGGTAGG - Intronic
1174250593 20:49216715-49216737 GGAGATAAAAAGAATGACATGGG + Intergenic
1174495839 20:50942026-50942048 GAAAAGAAAAATAATCAGGTAGG - Exonic
1174980805 20:55392486-55392508 GGAAATAATAGTAGAGAGGTAGG - Intergenic
1175111705 20:56653062-56653084 GGAAAAAAAAATAAAAAGGCCGG - Intergenic
1175191669 20:57215889-57215911 AAAAAAAAAAAAAATGAGGTTGG - Intronic
1177182822 21:17761737-17761759 GGAAATAAAAATAAATAACTGGG + Intergenic
1177262267 21:18746537-18746559 GGAAAAAAAAATGATGATGATGG - Intergenic
1177274838 21:18896575-18896597 GGAAAAAAAAAAGATGAGGCAGG + Intergenic
1177275452 21:18907166-18907188 AGAAAGAAAAATGATGTGGTAGG - Intergenic
1177384034 21:20385789-20385811 GGAATTTAAAATAATGATGAGGG - Intergenic
1177386476 21:20415847-20415869 GCAAATAAAACAAAGGAGGTAGG - Intergenic
1177634124 21:23764921-23764943 GGAAATAAAATTATTGACTTTGG + Intergenic
1177919951 21:27140158-27140180 GAAAATAAAGATGATGATGTTGG - Intergenic
1177920410 21:27144965-27144987 TGTAATAAAAATAGTGTGGTTGG + Intergenic
1178868435 21:36350430-36350452 AGAAAATAAAAAAATGAGGTGGG + Intronic
1179018107 21:37612000-37612022 GGAAATAAAAATATATAGATTGG + Exonic
1179207504 21:39295907-39295929 GGAAATAAAAACAATGAAAATGG + Intronic
1179230914 21:39502978-39503000 GGAAAAAAAAAAAAAGAGCTTGG - Intronic
1179317793 21:40260308-40260330 GGAAATTGAAATAAATAGGTGGG + Intronic
1179346080 21:40558785-40558807 GGTGATAAAAATAACGAGGATGG - Intronic
1180860031 22:19073101-19073123 AAAAATAAAAATAATTAGCTGGG + Intronic
1181032667 22:20155779-20155801 GAAAATAAATAAAATGAGCTTGG - Intergenic
1181122095 22:20677260-20677282 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1181327653 22:22062606-22062628 TCAAAGCAAAATAATGAGGTAGG + Intergenic
1181350223 22:22249988-22250010 GGAAGAAAAAATAATGAGGCAGG + Intergenic
1182403069 22:30098142-30098164 GGAAATAAAAATATAGAACTGGG + Intronic
1182592911 22:31396186-31396208 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1183178422 22:36241421-36241443 GAAAACAAAAATAAAGAGATGGG - Intergenic
1183682301 22:39339648-39339670 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1184000731 22:41671549-41671571 GGAAAAGGAAATTATGAGGTGGG + Intergenic
1184013380 22:41766709-41766731 GGAAATAAAAATAATTAGCCAGG - Intronic
1184157794 22:42679912-42679934 TAAAATAATAATAATGAGATGGG - Intergenic
1184600987 22:45543275-45543297 GGAAAAAAAAGAAATGAGGCTGG + Intronic
949174705 3:1045948-1045970 GGAAAATAAATTATTGAGGTAGG - Intergenic
949258053 3:2073540-2073562 GGAAATACGTATAAAGAGGTAGG + Intergenic
949384720 3:3488480-3488502 AGAAGTAAAAAAAATGAGATGGG + Intergenic
949486179 3:4541433-4541455 GGAAAAAAAAATACTGAGCAAGG - Intronic
949519168 3:4834050-4834072 AAAAATAAAAATAATTAGCTCGG - Intronic
949611303 3:5706543-5706565 GGGAAAAAAAAAAATGGGGTTGG - Intergenic
949685933 3:6570692-6570714 GAAAATAAAAAAAATTAGCTGGG - Intergenic
949937882 3:9131071-9131093 GGAATTAGAAATAATGAGATGGG - Intronic
950039371 3:9910067-9910089 GGATAGAAAGATAATGAGGTTGG + Intronic
950220745 3:11194009-11194031 GGAAATAAAAATGATGTTGCTGG + Intronic
950416125 3:12869830-12869852 GGAAATGAAAAAAAATAGGTGGG - Intronic
950815053 3:15692153-15692175 AAAAAAAAAAAAAATGAGGTTGG + Intronic
950991817 3:17447556-17447578 GAAAATAGAAATTATTAGGTGGG - Intronic
951297113 3:20951195-20951217 TGAAAGTAAAATAATGAGGGTGG - Intergenic
951349332 3:21586231-21586253 TGGAATACAAATATTGAGGTGGG + Intronic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951615395 3:24537897-24537919 GGAAAGAAAGAGAATGAGGGAGG + Intergenic
952448184 3:33404114-33404136 TAAAATAAATATAATGAGGCCGG + Intronic
952487455 3:33828828-33828850 GGAAATAAAAATACTGACCAGGG - Exonic
953166049 3:40465865-40465887 GAAAATAAAATTAATAAGGTGGG + Intergenic
953368860 3:42370306-42370328 AGAAGGAAAAATAAGGAGGTGGG - Intergenic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953686514 3:45082287-45082309 GGAAATAAAAATAATAGTCTTGG - Exonic
953690793 3:45117248-45117270 GGAAATAATAATAATTAGGTAGG - Intronic
954560169 3:51549875-51549897 GGAAAGAAAAATGAAGAGATAGG - Intronic
954738792 3:52729813-52729835 AGAAATAAAAAGAATTGGGTGGG + Intronic
954744021 3:52776734-52776756 AAAAATAAAAATAATCAGCTGGG + Intergenic
955081925 3:55665729-55665751 GGAAAGACAAATCATAAGGTGGG + Intronic
955318603 3:57958847-57958869 GGACAGAAAAAGAATGAGGAAGG - Intergenic
955549084 3:60063894-60063916 GCTATTAAGAATAATGAGGTAGG + Intronic
955773073 3:62405547-62405569 AAAAATAAAAATAAAAAGGTAGG + Intronic
956293499 3:67686989-67687011 GTAAAAAAAAATTCTGAGGTTGG - Intergenic
957360940 3:79156806-79156828 GGAAAGTAAACTATTGAGGTTGG + Intronic
957562371 3:81838990-81839012 GTAATTAAAAAAAATAAGGTAGG + Intergenic
957938102 3:86969666-86969688 ATAAATAAATAAAATGAGGTTGG - Intronic
958071142 3:88613574-88613596 GAAAGTATAAATAATGAGGACGG + Intergenic
958126657 3:89365234-89365256 GGAAAAAGGAATAAAGAGGTTGG + Intronic
958513063 3:95073899-95073921 CGAGAAAAAAATAATGAAGTTGG + Intergenic
958693495 3:97498477-97498499 GGAGAAAAAAATAAAGGGGTAGG + Intronic
958715747 3:97778140-97778162 TAAAATCAAAATAATGAAGTTGG + Intronic
958951034 3:100416346-100416368 GGAAATAAACAAAATGACCTTGG - Intronic
959041421 3:101426638-101426660 GAAAATAAAAAAAATTAGCTGGG - Intronic
959054644 3:101555142-101555164 GGAACTAAAAAAAATTAGCTGGG - Intergenic
959134712 3:102403047-102403069 GTAAATAATAATAATAAAGTAGG - Intronic
959644535 3:108682898-108682920 GAAAATAAAAATAAAGTGTTAGG + Intronic
959877378 3:111400722-111400744 GGCAATGAAAAAAATGAGATGGG + Intronic
959890423 3:111549120-111549142 GGAAATGAAAATAAGGGGGAAGG - Intronic
959929139 3:111959421-111959443 GGAAATAAAAATCATGGGTTGGG + Intronic
959970512 3:112404098-112404120 AGTTATAAAAATAAAGAGGTAGG - Intergenic
960338430 3:116445895-116445917 GGAAAGAAGAAAAAGGAGGTGGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960694992 3:120387494-120387516 GGAAAAAAAAAGAATGAGGTAGG + Intergenic
961054332 3:123775181-123775203 AGAAATAAAAAAAATTAGCTGGG - Intronic
961095009 3:124146895-124146917 GAAAAGAAAAAAAAAGAGGTGGG + Intronic
962470010 3:135698486-135698508 GTAAATAAAGATAGTTAGGTGGG + Intergenic
962635741 3:137329850-137329872 AGAAAGAAAAATAATGAACTGGG + Intergenic
963081565 3:141399852-141399874 GGAGATTAAATGAATGAGGTAGG + Intronic
963084500 3:141424358-141424380 AGAAATAAAAAAAATTAGCTGGG + Intronic
963546884 3:146671415-146671437 GGAAATAATAATAATAATATAGG - Intergenic
964067076 3:152593330-152593352 GGAGAAAAAAAGAATGAGGAGGG + Intergenic
964328038 3:155568856-155568878 GGAAATAAAAATGAAAAGCTAGG + Intronic
964354665 3:155839139-155839161 GAAAATAAAAATAATTAGCCAGG + Intronic
964357184 3:155861612-155861634 GGAGAAAAAAAGAAGGAGGTGGG - Intergenic
964439765 3:156695522-156695544 GGAATTAAAGATAGTGATGTTGG - Intronic
964700702 3:159562777-159562799 GGAGATAAAATTAATGAACTGGG + Intronic
964827269 3:160842350-160842372 GGAAATAAAACTAGAGAGGTAGG + Intronic
964934688 3:162068419-162068441 TTAAATAAAAAGAATGAGGGAGG + Intergenic
965064689 3:163831183-163831205 AGAAATAAAAATAATTAGCTGGG - Intergenic
965172945 3:165291983-165292005 AAAAATAAAAAAAATGATGTGGG - Intergenic
965464837 3:169016003-169016025 TTAAATAAATATTATGAGGTAGG + Intergenic
965543023 3:169889408-169889430 AAAAATAAAAATAATTAGCTGGG - Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966130028 3:176626906-176626928 GGAAGTAAATAGAATGAGATTGG + Intergenic
966514018 3:180796764-180796786 AGAAATACAAAGAATGGGGTGGG - Intronic
966583653 3:181597349-181597371 GAAAATAAAAAGATTGAAGTTGG - Intergenic
966612924 3:181886131-181886153 AAAAATAAAAATAATTAGCTGGG + Intergenic
966800425 3:183758358-183758380 GGAAAAAAAAATAATAATGTTGG + Intronic
966829535 3:183995010-183995032 CAAAATAAAAATAATTAGCTGGG - Intronic
967059129 3:185855739-185855761 AGAAAAAAAAAAAATTAGGTGGG + Intergenic
967173502 3:186842628-186842650 GGAAATGACAATTGTGAGGTGGG + Intergenic
967251590 3:187545676-187545698 GAAAATAAAAATAATTAGCCAGG - Intergenic
967434042 3:189423858-189423880 GCAAATAAAATTAATGTGGTTGG - Intergenic
967618915 3:191607792-191607814 AAAAATAAATAAAATGAGGTAGG + Intergenic
967720161 3:192807637-192807659 TGGAAGAAAAATAATGAAGTAGG + Intronic
967846689 3:194048921-194048943 AGAGATTAAAATAATGAGGCAGG - Intergenic
967895395 3:194391833-194391855 AAAAATAAAAAAAATGAGCTGGG - Intergenic
968226027 3:196972775-196972797 TGAAATAAAAATAATTAGCCAGG - Intergenic
968420805 4:483078-483100 GAAAATGAAAATAATAAAGTGGG + Intronic
968768433 4:2487578-2487600 AAAAATTAAAATAATGAGGCTGG - Intronic
969907492 4:10410809-10410831 GGAAAAAAAAAAAAGGAGCTGGG + Intergenic
969933653 4:10659041-10659063 GAAAATACAAAAAATGAGCTGGG + Intronic
970072767 4:12180282-12180304 GAACCTCAAAATAATGAGGTTGG - Intergenic
970300648 4:14678366-14678388 GGAAATAAATATAATCAGTGGGG - Intergenic
970692489 4:18635461-18635483 GGAAAAAAAAATGAGGAGGTGGG - Intergenic
971789642 4:31152720-31152742 AAAAATAGAAATAATGAGTTTGG - Intergenic
972230949 4:37072154-37072176 GGAAATAAAACTAATTATATGGG + Intergenic
972536313 4:40002745-40002767 GGAAATAAAAACAAAGCAGTTGG - Intergenic
972613282 4:40674975-40674997 GGAAAAAAAAAAAATTAGCTAGG - Intergenic
972837326 4:42888842-42888864 GGATATAATAATAATAAAGTTGG - Intergenic
972920071 4:43927954-43927976 GGAAAAAAGAATAATAATGTTGG + Intergenic
973266332 4:48214854-48214876 AAAAATAAAAATAATTAGGCCGG + Intronic
974256437 4:59461366-59461388 AAAAATAAAAATAATGAGAAAGG - Intergenic
974396678 4:61345191-61345213 GGATTTAAAAATAATTATGTTGG + Intronic
974555109 4:63436207-63436229 AAAAAGAAAAATAATGAAGTTGG + Intergenic
975032471 4:69638224-69638246 GGAAATAAAAATATAAAGGGAGG + Intronic
975653488 4:76618141-76618163 GAAAATTAAAATAATTAGCTGGG + Intronic
975873467 4:78807989-78808011 GGAAATAACAAAAATTAGGGTGG - Intronic
976251003 4:83051913-83051935 GGAAATCAGAATAATGTGGAGGG + Intronic
976725062 4:88207838-88207860 TGAAAAAAACAAAATGAGGTTGG - Intronic
976785516 4:88815239-88815261 CAAAGTGAAAATAATGAGGTGGG - Intronic
976916848 4:90386624-90386646 GCAAATAAAAATAAATAAGTAGG + Intronic
977008362 4:91602252-91602274 GGAAATAATGACAATGAGTTAGG - Intergenic
977437478 4:97017777-97017799 TTGAACAAAAATAATGAGGTTGG - Intergenic
978068369 4:104434763-104434785 AGAATTAAAAATGATCAGGTTGG - Intergenic
978124738 4:105122254-105122276 GAAAATATAAAAAATGAGCTGGG + Intergenic
978517933 4:109588977-109588999 TGAAAAAAAAATAATGAGAAGGG + Intronic
978543168 4:109840930-109840952 GCAAATAATAATAATGATGATGG - Intronic
978664973 4:111171849-111171871 AGTAACAAATATAATGAGGTTGG + Intergenic
978897950 4:113912501-113912523 GGAAAAAAAAAGAATATGGTGGG + Intronic
978952633 4:114579487-114579509 TGAAAAAAAAATAATAAGATAGG - Intergenic
979412296 4:120393993-120394015 GAAAAAAGAAATAATGTGGTGGG - Intergenic
979588838 4:122453660-122453682 GGAAATAAAAAAAAAAAAGTAGG - Intronic
979634025 4:122936989-122937011 AAAAATAAAAATAATTAGTTGGG + Intronic
979685626 4:123507931-123507953 GGAAAAAAAAAAAATTAGCTGGG + Intergenic
979959991 4:127007182-127007204 AGAAATAAACATCATGGGGTAGG + Intergenic
980096301 4:128494627-128494649 GGAAATAACAATAATGTGTATGG - Intergenic
980272553 4:130605079-130605101 GCAATTAAAAAGAATTAGGTAGG - Intergenic
980939659 4:139261452-139261474 AAAAAAAAAAATAGTGAGGTAGG - Intergenic
981164325 4:141539698-141539720 GAAAATAAAAAAAATTAGCTGGG - Intergenic
981314478 4:143328429-143328451 AAAAATAAAAATAATTAGCTGGG - Intergenic
981488284 4:145311698-145311720 GGAAGTAAAAATCATGAGTGTGG + Intergenic
981978256 4:150758732-150758754 GAAAATAAAAAGAATTAGTTGGG - Intronic
982054741 4:151537032-151537054 AAAAATAAAAATAATTAGCTGGG - Intronic
982241328 4:153302654-153302676 GGGATTAAAAGTAATGAGGTTGG + Intronic
983120058 4:163872742-163872764 GATAATAAAAATGATGAAGTCGG + Intronic
983223949 4:165068919-165068941 AGAAATAAAAAAAATTAGCTGGG - Intergenic
983252786 4:165363524-165363546 GGCAATACAAATATTGTGGTTGG + Intronic
983374648 4:166910223-166910245 AGAAATAAAAATGATGATTTAGG + Intronic
983840406 4:172450649-172450671 GGAGAGAAAAGGAATGAGGTTGG - Intronic
984014571 4:174410601-174410623 AGGAATAAAAATAATTAGCTGGG + Intergenic
984118148 4:175708209-175708231 GGAAATCTAAACAAAGAGGTGGG + Intronic
984167824 4:176323332-176323354 GAAACTACAAATAATGAGATTGG - Intronic
984207584 4:176804280-176804302 GGAAGAAAAAATAATGATGAGGG - Intergenic
984207813 4:176807140-176807162 GGAAATAAAGACAATGAGCATGG + Intergenic
984466258 4:180102223-180102245 TGAAATGAAAATACTGAGATTGG - Intergenic
984532613 4:180934960-180934982 TGAAATACAAAAAATTAGGTTGG + Intergenic
984933130 4:184865940-184865962 GGAAATAGAATTAGTGAGGATGG + Intergenic
985198514 4:187459531-187459553 GGACACAAGAATAATGAGATTGG - Intergenic
985313575 4:188630820-188630842 GAAAATGAAAATGGTGAGGTTGG - Intergenic
986092855 5:4527448-4527470 GTAAATTAAAACAAGGAGGTAGG + Intergenic
986657926 5:10033579-10033601 GGAACAAAATAGAATGAGGTGGG + Intergenic
986904835 5:12484232-12484254 GGTATTAAAAATAATGAAGTAGG + Intergenic
986936658 5:12896382-12896404 GGAAATAAATACAATGGAGTTGG + Intergenic
987023015 5:13894546-13894568 GGAGATATAAATAATGAAATGGG - Intronic
988288839 5:29258197-29258219 CGAAAAAAAAAAAAGGAGGTGGG + Intergenic
988409502 5:30868948-30868970 GAAAATAAAAATAAAAAGCTTGG + Intergenic
988889943 5:35604700-35604722 AGAAACAAAAATAAAGAGATGGG + Intergenic
989796488 5:45480628-45480650 GGAAATTAAAATAACTAGGAAGG + Intronic
989963037 5:50438898-50438920 GGAAAAAAAAAAAAAAAGGTAGG - Intronic
990363852 5:55049186-55049208 GAAAATAAAGATAATAAGGCTGG + Intergenic
990632597 5:57686885-57686907 ACAAATAAAAATAAAGAGGCTGG - Intergenic
990914248 5:60886014-60886036 GGAAATATAAATAATGTAGTTGG - Intronic
991037654 5:62144283-62144305 GGAAAGCAAAATAATTAGGGTGG - Intergenic
991090457 5:62689387-62689409 AAAAATAAAAATAATTAGCTGGG + Intergenic
991370196 5:65910554-65910576 GAAAAAAAAAAGAATGAGATTGG + Intergenic
991408624 5:66325489-66325511 GGAAATAAAATTAATGAAATCGG + Intergenic
991684703 5:69170912-69170934 TCAATTAAAAAGAATGAGGTTGG - Intronic
992036006 5:72776952-72776974 AGAATTAAAAAGAATGAGGAAGG + Intergenic
992731892 5:79679410-79679432 GGAAAAAAAAATATAGAGGTGGG + Intronic
992913592 5:81424013-81424035 GGAAGTTAAAAGAGTGAGGTTGG + Intronic
993011788 5:82491594-82491616 GGCAATAAAAACCAAGAGGTTGG + Intergenic
993628642 5:90257058-90257080 GGAGATTAAAATAAACAGGTAGG + Intergenic
993718386 5:91297655-91297677 AAAAATAAAAAAAATTAGGTGGG + Intergenic
993962078 5:94310541-94310563 AGACATAAAAGTAATGTGGTGGG + Intronic
994205430 5:97029785-97029807 GGAAAGAAGAAAAATGAGGGAGG + Exonic
994557939 5:101328718-101328740 GGAAATAAAAATAATTATGGAGG + Intergenic
994998310 5:107094288-107094310 GGGAATAAAAATAATGAGACGGG + Intergenic
995276197 5:110280626-110280648 GGAAATAAAAGTATTCAGTTAGG - Intergenic
995646119 5:114314110-114314132 GGACATGAACAAAATGAGGTGGG + Intergenic
996210792 5:120807061-120807083 AGAAATAAAGAAACTGAGGTAGG - Intergenic
996388250 5:122932471-122932493 TAAAATAAAAATAAACAGGTAGG + Intronic
996694425 5:126378011-126378033 AGAAAGAAAAAGAATAAGGTTGG - Intronic
997574849 5:134966865-134966887 AAAAATAAAAAAAATTAGGTGGG - Exonic
998871090 5:146552616-146552638 GAAAAGAAAAATAATAAGGTAGG - Intergenic
999513289 5:152275528-152275550 GGAAATAATATCAAAGAGGTAGG - Intergenic
999522161 5:152361831-152361853 TGAAATCTAAATAATGAGTTGGG + Intergenic
999594578 5:153188439-153188461 AAAAATAAAAAAGATGAGGTTGG + Intergenic
999630671 5:153567836-153567858 GGAGATAAAAATAGAGAGGTAGG + Intronic
999733158 5:154491711-154491733 GAAAATACAAATAATTAGCTGGG - Intergenic
1000479151 5:161750152-161750174 GGAAAGAAAATAAATGGGGTTGG - Intergenic
1000572098 5:162927408-162927430 GAAAATAAAAATAATTTTGTTGG + Intergenic
1000688814 5:164288509-164288531 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1001031664 5:168267684-168267706 TAAAATAATAAAAATGAGGTTGG - Intergenic
1001585402 5:172830765-172830787 GGAAAAAAAAATAATGAGGATGG + Intergenic
1001637746 5:173224495-173224517 AGAAATAAGGAAAATGAGGTGGG - Intergenic
1002178524 5:177416981-177417003 AAAAATAAAAATAAAGAGGAAGG - Intronic
1002882545 6:1265606-1265628 GGAAAAAATAATAATTAGGAAGG + Intergenic
1003366274 6:5477857-5477879 AAAAATAAAAAAAATGAGCTGGG + Intronic
1003579871 6:7330089-7330111 TTAAATAAAAACAATGAGGCAGG + Intronic
1003685685 6:8299622-8299644 GAAAAAAATAATAATGAGGCTGG - Intergenic
1003750458 6:9049336-9049358 AATATTAAAAATAATGAGGTCGG - Intergenic
1004040398 6:11969611-11969633 GGAATTAGAAATAAAGAGGGTGG - Intergenic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004115558 6:12763559-12763581 TGAAGTGAAAATATTGAGGTGGG + Intronic
1004330592 6:14717120-14717142 GGAAGCAAAAGTCATGAGGTTGG + Intergenic
1004335567 6:14761577-14761599 GGAAATAAAATGAATCAGGTGGG + Intergenic
1004877550 6:19970823-19970845 AAAAATAAAAATGATGGGGTGGG + Intergenic
1005276326 6:24222529-24222551 GGAAATAAAAATGTTAATGTGGG + Intronic
1005422032 6:25661078-25661100 GGAAAAAAACATAATGAGAAGGG - Intronic
1005618511 6:27598433-27598455 TTAAATAAAAATAATCAAGTAGG + Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1005707766 6:28472480-28472502 ATAAATAAAAATAATGAAATTGG + Intergenic
1005980186 6:30830570-30830592 GGAAAGAAAAAAAAAGAAGTTGG - Intergenic
1006782279 6:36640087-36640109 AGAAAAAAAAAAAATGAGGAGGG - Intergenic
1008216471 6:48795969-48795991 GCAAATAAAAATATTGGGGAAGG - Intergenic
1008970521 6:57362072-57362094 GGAACTAAAAATATTGAATTGGG + Intronic
1009159490 6:60263894-60263916 GGAACTAAAAATATTGAATTGGG + Intergenic
1009397625 6:63218383-63218405 GGAAATATAAATAATAAGGCTGG - Intergenic
1010200593 6:73278524-73278546 GAAATTAAAAATAAAGAGCTAGG - Intronic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010536079 6:77032398-77032420 GGAAATAAGAATAATTAGTGGGG + Intergenic
1010833508 6:80558811-80558833 GGAAATAAAAATATTGACTTGGG + Intergenic
1010916886 6:81631053-81631075 GGAAATAAAAATATTAATGAAGG - Intronic
1010924620 6:81729195-81729217 GAAATTAAAAATAATTAGCTTGG + Intronic
1011080985 6:83489999-83490021 AAAAATAAAAATAATTAGCTGGG + Intergenic
1011088690 6:83571103-83571125 TGAAAAAAAAAAAAAGAGGTGGG - Intronic
1011172902 6:84526024-84526046 GGAAATAAGATTAGTGAGGTAGG + Intergenic
1011471853 6:87716136-87716158 GTAAATAAAAAGAATGTGGCTGG + Intergenic
1011719294 6:90138798-90138820 GGAAACAAACACAATGAGCTGGG + Intronic
1011765335 6:90613391-90613413 AAAAATAAGAATAATCAGGTGGG - Intergenic
1013058599 6:106609741-106609763 TGAACTGACAATAATGAGGTCGG - Intronic
1013530209 6:111012329-111012351 AGAAATAAAAAAAATTAGCTGGG - Intronic
1013784025 6:113759268-113759290 AGAAATTAAAAGAATGAGATGGG + Intergenic
1013798162 6:113908537-113908559 AGAAAGAAAAATAATTAGCTGGG + Intergenic
1013942851 6:115686255-115686277 AGAAATAAAAATAATGAAAAAGG - Intergenic
1014214349 6:118738367-118738389 GAAAATACAAATAATTAGCTGGG + Intergenic
1014281305 6:119445182-119445204 CAAAATAAAAGTAATGAGATAGG + Intergenic
1014370384 6:120599713-120599735 GGAAATTAAGTTACTGAGGTTGG + Intergenic
1014466154 6:121759507-121759529 AGAAACAAAAATAAGGAAGTGGG - Intergenic
1014485942 6:121999328-121999350 GGAAAAAAAATTATTCAGGTTGG - Intergenic
1014909750 6:127077659-127077681 GGACATAAAGAGAATAAGGTAGG + Intergenic
1015055950 6:128903738-128903760 GGAAATTAAGATAAAGAGCTTGG + Intronic
1015142633 6:129952586-129952608 GGAGATAAAAGTAATAAGCTTGG + Intergenic
1015195045 6:130516494-130516516 TGAAATAAAAACAAGGATGTTGG - Intergenic
1015834098 6:137400705-137400727 GGAAATAAAAATGATCATATAGG - Intergenic
1015874046 6:137804610-137804632 GGCAGGAAAAATAATGAGTTTGG + Intergenic
1015879274 6:137855208-137855230 GGAAATAAAAATAGTTATTTAGG + Intergenic
1016154803 6:140792044-140792066 GGAAAAAGAAATAATGGAGTAGG - Intergenic
1016209665 6:141514656-141514678 AGAAATAAAAATCATGCAGTTGG + Intergenic
1016310828 6:142731624-142731646 GATAATAATAATAATGAGGCTGG + Intergenic
1016866395 6:148771983-148772005 GGAAAAAAAAATATTGAAGGAGG - Intronic
1017404214 6:154099489-154099511 GGAAAGAAAAAGAAAGAGGAAGG + Intronic
1017521958 6:155210310-155210332 GGAAAGAAAAAGAAAGAGGAGGG - Intronic
1017827170 6:158090375-158090397 GCAACAAAAAATAATGTGGTGGG - Intronic
1017917992 6:158847434-158847456 GGAAAGAAAGAAAATGAGATGGG - Intergenic
1017973217 6:159330845-159330867 GGAAATAAATACAATGATGGAGG + Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018194292 6:161341344-161341366 GGAAAAAAAAATTAGGAGGCTGG - Intergenic
1018301440 6:162406861-162406883 CTAAATAAAAATACTGGGGTGGG - Intronic
1018312017 6:162519658-162519680 GGAAATAGAATAAATGAGATGGG - Intronic
1018545208 6:164928263-164928285 GGAAATAAATTTGATGCGGTAGG + Intergenic
1019454795 7:1121271-1121293 GAAAATAAAAACAATGTGGTGGG + Intronic
1019902494 7:4033017-4033039 TGAAATAAAAGTAATGAGGGTGG + Intronic
1020166460 7:5811394-5811416 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1021323003 7:19234656-19234678 AGAAAAAAAATTAATGAGATGGG - Intergenic
1021493758 7:21249231-21249253 GGCAATGAAAATATTGATGTGGG + Intergenic
1021590966 7:22261445-22261467 AAAAATAAAAAAAATTAGGTAGG + Intronic
1021876225 7:25052096-25052118 TGAAATAAAAATAAATAGGCCGG + Intergenic
1021919864 7:25474029-25474051 AAAAATGAAAAAAATGAGGTTGG + Intergenic
1022372182 7:29782441-29782463 GGATATAAATATATTTAGGTAGG + Intergenic
1022389685 7:29932724-29932746 AGACATACAAATAAGGAGGTGGG + Intronic
1022436088 7:30387091-30387113 GGAAACAAACATGATGAGGTAGG - Intronic
1022751008 7:33225633-33225655 GGAAATATAAAAGATGAGGCAGG - Intronic
1022839408 7:34148800-34148822 GGAAACACAAAGAATGTGGTGGG + Intronic
1022970456 7:35512140-35512162 GGAAATAGAAACAATTTGGTTGG + Intergenic
1023053800 7:36275759-36275781 GGAAATAAAAATAATAAAGGTGG - Intronic
1023227258 7:37983692-37983714 AGAAAAAAAAATGATGAGGTGGG + Intronic
1023381595 7:39613724-39613746 GGAAAGAAAAAAAGGGAGGTGGG - Intergenic
1024084790 7:45884258-45884280 GAAAATAAAAATAATTAGCCAGG - Intergenic
1024404663 7:48964406-48964428 GGAAATAAAAATAAAAATGTTGG - Intergenic
1025738126 7:64172740-64172762 GAAAATACAAATGATGAAGTTGG - Intronic
1026415975 7:70181420-70181442 TGAAATAAAAATAAGAAGATAGG - Intronic
1026458162 7:70590940-70590962 TTAAATAAAAATAATGTAGTGGG - Intronic
1026559652 7:71437870-71437892 AAAAATAAAAATAATTAGCTGGG - Intronic
1026677272 7:72438273-72438295 AAAAATAAAAATAATGAGCCAGG - Intronic
1026764444 7:73151369-73151391 AAAAATAAAAATAATTAGCTGGG + Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1027040914 7:74961133-74961155 AAAAATAAAAATAATTAGCTGGG + Intergenic
1027082724 7:75241240-75241262 AAAAATAAAAATAATTAGCTGGG - Intergenic
1027409908 7:77905384-77905406 AAAAATAAAAATAATTAGCTGGG - Intronic
1027520334 7:79198725-79198747 GAAAATAAAAAAAATTAGCTGGG + Intronic
1027904860 7:84166275-84166297 GGAAAAAAAAAAAAAGAGGCCGG + Intronic
1028040636 7:86048844-86048866 AAAAATAAAAGTAATGAGGGAGG + Intergenic
1028174011 7:87631689-87631711 AGATATAAAAATAAAGAGGCCGG - Intronic
1028258218 7:88627384-88627406 GGAAATACAAACAATAAGTTGGG - Intergenic
1028683707 7:93568869-93568891 GGAAAAAAAAATAATGTCTTTGG - Intronic
1028981718 7:96974492-96974514 GGGAAGAAATATAAGGAGGTAGG + Intergenic
1029485000 7:100834868-100834890 AAAAATAAAAATAATGGGCTGGG + Intronic
1029496723 7:100899155-100899177 AAAAATAAAAATAATTAGCTGGG + Intergenic
1029912620 7:104170889-104170911 AGAGGTAAAAATAATCAGGTAGG - Intronic
1030564292 7:111133532-111133554 AGAAAGAAAAATCAGGAGGTGGG + Intronic
1030631366 7:111899537-111899559 GGAAATAGAAATACTGAGAAGGG + Intronic
1031030476 7:116728813-116728835 GGATATAAAAACAATCTGGTGGG - Intronic
1031216163 7:118895024-118895046 GGAAAGAAAAAGATTGAGGTAGG + Intergenic
1031538249 7:122961232-122961254 AAAAAAAAAAATAATGAGCTTGG - Intergenic
1031716448 7:125114567-125114589 ATAAATATATATAATGAGGTAGG - Intergenic
1031942001 7:127798883-127798905 GAAAATTAAAATAATTAGCTGGG + Intronic
1032298203 7:130661798-130661820 GGAAAAGAAAATGATGAGCTCGG + Intronic
1032334575 7:131013078-131013100 GGAAAGAAAACTAATCAGTTTGG - Intergenic
1032551827 7:132791392-132791414 GCACATGAAAAAAATGAGGTTGG + Intronic
1032702673 7:134396404-134396426 TGAATTAAAAATTCTGAGGTAGG - Intergenic
1033133531 7:138765908-138765930 GAAAATAAAAATAATCAGCTGGG - Intronic
1033321094 7:140340282-140340304 AAAAAAAAAAAGAATGAGGTTGG - Intronic
1033627871 7:143128470-143128492 AAAAATAAAAATAATTAGCTGGG + Intergenic
1033974119 7:147078908-147078930 GAAAATAAAAAAAATTAGCTGGG - Intronic
1034051556 7:147989478-147989500 GGATATAAGAATGATGATGTTGG - Intronic
1034641405 7:152606741-152606763 AGAAATACAAAAACTGAGGTGGG + Intergenic
1035082801 7:156231924-156231946 GGAAATACAAAAAATTAGCTGGG + Intergenic
1035348365 7:158224302-158224324 GAAAATAAAAATAAAGTGGAAGG + Intronic
1035571249 8:674461-674483 GAAAATAAAAAAAATTAGCTGGG - Intronic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1035715709 8:1753229-1753251 CCTAATAAAAATAATGAGGTGGG - Intergenic
1035835437 8:2746281-2746303 GAAAAAAAAAATAATGTGGAGGG + Intergenic
1036080527 8:5550349-5550371 TGAAATAAAAATAAAAAAGTGGG - Intergenic
1037136503 8:15468937-15468959 TGACTTAAAAATAATGAGGGAGG + Intronic
1037350159 8:17944689-17944711 GAAAATAAAAATATCTAGGTAGG - Intronic
1037413604 8:18623477-18623499 GGAAAAAAAAAAAATTAGCTGGG + Intronic
1037474717 8:19245667-19245689 GAACATAAAATAAATGAGGTGGG - Intergenic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1037714915 8:21389148-21389170 AAAAATAAAAAGAATGAGGGGGG - Intergenic
1038172349 8:25147681-25147703 AGAAATACAAAAACTGAGGTGGG + Intergenic
1038521864 8:28240641-28240663 GGAGATAAGATTAATGAGGATGG + Intergenic
1038616793 8:29102940-29102962 GGAAATAAAAATGATTTTGTCGG + Intronic
1039361700 8:36884073-36884095 GGAATTAATAATAAAGAGGTGGG - Intronic
1039803630 8:40980988-40981010 AAAAATAAAAATAATTAGCTGGG + Intergenic
1040711816 8:50198025-50198047 GGAAATAAATATAATGACATTGG - Intronic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1041307644 8:56479230-56479252 AAAAATAAAAATAATTAGCTTGG + Intergenic
1041567101 8:59291142-59291164 GGAAACAAAAATAATCAAGCAGG + Intergenic
1041695623 8:60733072-60733094 GGAAAAAAAAAAAATTAGCTGGG + Intronic
1041940281 8:63380180-63380202 GGAAATATCAATAAAGAGCTAGG - Intergenic
1042093896 8:65190801-65190823 GGAAATAAAAATAATTGAGGGGG + Intergenic
1042222375 8:66486320-66486342 GGAATTAGAAAGAATGAGGCTGG + Intronic
1042600782 8:70497444-70497466 AAAAAAAAAAAAAATGAGGTTGG + Intergenic
1042883517 8:73521724-73521746 GGAAAAACAACTAATGAGGTAGG + Intronic
1042958946 8:74282073-74282095 GGAAATCAAAAGGATTAGGTAGG - Intronic
1043170860 8:76964912-76964934 AAAAATAAAAATAATTAGCTGGG - Intergenic
1043460157 8:80451749-80451771 GGAAATACAAAAAATTAGCTGGG - Intergenic
1043478156 8:80625538-80625560 AGAAAAAAAAATTGTGAGGTTGG - Intergenic
1043497671 8:80820739-80820761 AAAAATAAAAATAATTAGCTGGG + Intronic
1043781693 8:84344490-84344512 GAAAGTAAATATAATGAGGTAGG - Intronic
1043920840 8:85981462-85981484 GGAAAAAAAAATGATGATATTGG + Intergenic
1044121773 8:88406169-88406191 AGAAATAAAAATATTGAAATTGG + Intergenic
1044333932 8:90953771-90953793 AAAAATAAAAATAATTAGCTGGG + Intronic
1044702854 8:94979934-94979956 GAAAATAAAAAAAATCAGCTTGG + Intronic
1044905203 8:96993389-96993411 GTATACAAAAATAATGATGTGGG + Intronic
1045029208 8:98118719-98118741 GGAAAGAAAAAAAATGAGGCCGG - Intronic
1045099535 8:98830241-98830263 GTAAATAAAAATAAAGTGGAGGG + Intronic
1045303311 8:100933995-100934017 AAAAATACAAAAAATGAGGTGGG + Intronic
1045356931 8:101397540-101397562 GGTAATAATAATAATGTGTTAGG - Intergenic
1045746897 8:105432939-105432961 AAACATAAAAATAATTAGGTGGG + Intronic
1046409985 8:113829020-113829042 GCAAAAAAACATAAAGAGGTAGG - Intergenic
1046456296 8:114468047-114468069 AGAAAAAAAGAGAATGAGGTTGG + Intergenic
1046552565 8:115734900-115734922 GGAAAGAAAGAGAATCAGGTAGG - Intronic
1046648660 8:116813018-116813040 AAAAATAAAAAAAATGAGGCTGG + Intronic
1047039038 8:120972198-120972220 GGAAAGAAAAAAAATGAGCCAGG - Intergenic
1047815819 8:128461133-128461155 AGAAATAATAATAATGATGATGG + Intergenic
1047958392 8:129993230-129993252 GAAAATAAAAAAAATTAGCTAGG + Intronic
1048102108 8:131364181-131364203 GGAAATAAAAATAAACATGGAGG + Intergenic
1048200226 8:132367242-132367264 GGAAAAAAAAATACTGATGTGGG - Intronic
1048249812 8:132853759-132853781 GGAAATTAAAACAATAAGATAGG - Intergenic
1048475223 8:134736746-134736768 AGAAATAAAAAAAATTAGCTGGG - Intergenic
1048919551 8:139215444-139215466 GAAAAAAAAAATGAGGAGGTTGG + Intergenic
1049627461 8:143631940-143631962 AGAAAAAAAGAAAATGAGGTAGG - Intergenic
1050044279 9:1527142-1527164 GGAAATAAGAAGAGGGAGGTTGG + Intergenic
1050191334 9:3029661-3029683 AAAAATAAAAATAATTAGCTGGG - Intergenic
1050320264 9:4445471-4445493 ACAAATAAAAATAATTAGCTAGG + Intergenic
1050863344 9:10465383-10465405 GGAAATACATATAATGAACTGGG + Intronic
1050913805 9:11106806-11106828 GGAAATAAAAAAAAGGAAGTTGG + Intergenic
1051021649 9:12551858-12551880 AGAAAGAAAAAGAAAGAGGTAGG + Intergenic
1051078095 9:13264607-13264629 GGAAATAAATATAATGCAATGGG - Intronic
1051187017 9:14470938-14470960 GGAAACAGAAATGATGAGGCAGG + Intergenic
1051226885 9:14908551-14908573 AGAAAAAAAAAAGATGAGGTTGG + Intronic
1051420067 9:16880390-16880412 GGAAATACAAAAAATTAGCTGGG - Intergenic
1051637991 9:19198227-19198249 TGAAAAAAAAAAAATGAAGTTGG + Intergenic
1051700737 9:19820553-19820575 ATAAATAAAAATAAAGAGTTAGG + Intergenic
1051708468 9:19905399-19905421 GAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1052468482 9:28861846-28861868 TGAAATAAATATAAAGAAGTTGG + Intergenic
1052758873 9:32569377-32569399 AAAAATAAAAAAAATGAGCTGGG - Intronic
1052958779 9:34276104-34276126 TGAATTAAGAATAATGAGGCTGG + Intronic
1053110913 9:35459339-35459361 GGAAAAAGAAAAAAAGAGGTGGG - Intergenic
1053439293 9:38102876-38102898 TATAATAAAAATAATTAGGTGGG + Intergenic
1054968323 9:71055254-71055276 GGTTATAAAAATAATAATGTGGG + Intronic
1055190450 9:73514897-73514919 AAAAATACAAATAATGAGATAGG + Intergenic
1055192038 9:73536892-73536914 GGAACTAGAAACAATAAGGTAGG + Intergenic
1055345451 9:75331838-75331860 GTAAAAAAAAAAAATGATGTTGG + Intergenic
1055806412 9:80099095-80099117 GTCACTAAAAATAATGAAGTAGG - Intergenic
1057020431 9:91693222-91693244 GCAAAGAAAAACAATGAGGATGG - Intronic
1057727369 9:97577490-97577512 TAAAATGAAAATAATGAGGATGG + Intronic
1057759117 9:97858661-97858683 GGTAAGAAAAATAAAGAGGGAGG + Intergenic
1058150224 9:101455485-101455507 AGAAATTAAAATAAAGAGCTTGG - Intergenic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1058697731 9:107573993-107574015 AAAAATAAAAATAATTAGCTGGG - Intergenic
1059093741 9:111390105-111390127 GGAAACAAAGAAAAAGAGGTAGG + Intronic
1059177014 9:112176338-112176360 TGAAAAAAAAAAAATTAGGTGGG + Intergenic
1059558540 9:115307913-115307935 GGAAATAAAATTTAAGATGTGGG + Intronic
1060500391 9:124149374-124149396 GAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1060511475 9:124237708-124237730 TTAAATAAAAATATTGAGCTAGG + Intergenic
1060646301 9:125283352-125283374 AAAAATAAAAATAATAAGCTGGG - Intronic
1060697438 9:125721419-125721441 GAAAAAAAAAATAATGAAATTGG + Intergenic
1060987431 9:127827856-127827878 AAAAATACAAAAAATGAGGTGGG + Intronic
1061341171 9:129982821-129982843 GAAAATAATAAAAATGAGCTGGG - Intronic
1062246228 9:135567855-135567877 GAAAATAAAAAAAATCAGCTGGG + Intergenic
1185534230 X:846763-846785 GGAAGAAAAAATAATAAGGCAGG - Intergenic
1185682392 X:1899265-1899287 GAAAAAAAAAAGAGTGAGGTAGG - Intergenic
1185808733 X:3084984-3085006 GGTATTAAAAATATTGAGTTAGG + Intronic
1185981969 X:4789706-4789728 GTAAATATAATTAATGAGGCTGG + Intergenic
1186720968 X:12303406-12303428 GGAAATAAAAATGATAGGTTTGG + Intronic
1186870319 X:13765010-13765032 GGGAATACAAATAATGTGATAGG + Intronic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1187327089 X:18300804-18300826 GAAAAAAAAAATCATTAGGTTGG + Intronic
1187904550 X:24053852-24053874 GGAAATAAATATTATGAGGCCGG - Intergenic
1188755601 X:33957694-33957716 TAGAATAAAAATAATTAGGTTGG - Intergenic
1189412597 X:40786492-40786514 GGAAATAAAAGTGATGAGGAGGG - Intergenic
1189822612 X:44885019-44885041 AAAAATAGAAATGATGAGGTCGG - Intronic
1190525740 X:51327836-51327858 GGGAAAAAAAACAATGAGGGAGG + Intergenic
1190752165 X:53372160-53372182 GGACATAAAAACAAGAAGGTGGG - Intergenic
1190898741 X:54647746-54647768 GCAAATTAAAACAATGAGGCCGG - Intergenic
1190912090 X:54782118-54782140 GGAAAAATAACTAATGGGGTTGG + Intronic
1191764077 X:64677658-64677680 TTAAATAAAAATATTGAGATAGG - Intergenic
1192314522 X:70041625-70041647 GGAAGGAAAAAAAAGGAGGTGGG + Intronic
1192347861 X:70326450-70326472 AGAAAAAAGAAAAATGAGGTAGG - Intronic
1192593009 X:72376713-72376735 AGAAATAATAAAAATTAGGTGGG - Intronic
1192749952 X:73979101-73979123 GAACATAAAAATAATGAGCCAGG - Intergenic
1192773931 X:74222440-74222462 AAAAATAAAAATAAAAAGGTTGG + Intergenic
1192875382 X:75223984-75224006 GAAAAAAGAAATAATGAGCTTGG - Intergenic
1192894238 X:75423645-75423667 AAAAATAAAAATAATTAGCTGGG - Intronic
1193223518 X:78954962-78954984 GGAGAGAAAAATAAAGAGGGTGG - Intronic
1193484411 X:82069088-82069110 TGGAATAAAAACAAAGAGGTTGG + Intergenic
1193559001 X:82994436-82994458 TGAAAAAAAAATAATGAGATAGG - Intergenic
1193614737 X:83673203-83673225 GTAAAAAAAAAGAATGAGTTAGG - Intergenic
1193762229 X:85481182-85481204 GGACATAAAAATAATGAAAGGGG - Intergenic
1193889147 X:87021649-87021671 GCAAACAAAAATAGTGAAGTAGG + Intergenic
1193972927 X:88079416-88079438 TGAAAGCAAAATTATGAGGTCGG + Intergenic
1194280574 X:91948324-91948346 GGAATTGGAAATAATGTGGTGGG - Intronic
1195829923 X:109045636-109045658 AAAAATAAAAATAATTAGCTGGG - Intergenic
1196050510 X:111298910-111298932 GGGAAGAAAAATCAGGAGGTAGG + Exonic
1196177488 X:112655726-112655748 AAAAATAAAAATAATTAGCTGGG - Intronic
1196364244 X:114905800-114905822 GGAAATATCAATGAGGAGGTGGG - Intronic
1196785292 X:119416552-119416574 GAAAAGAAAAACAATGAGGAGGG - Intronic
1197214821 X:123858336-123858358 GTAAATAAAAATAAATAGGCCGG - Intergenic
1197924031 X:131627711-131627733 GGAAATAGAAGTCATCAGGTTGG - Intergenic
1197988666 X:132294230-132294252 GGAAATAAAATGAATGAAATGGG - Intergenic
1198424611 X:136504171-136504193 TGAAATAAAAATAATGGGCAGGG - Intronic
1198472258 X:136958371-136958393 GGAAATTAAAATAAGAAGGCTGG + Intergenic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1198765707 X:140077458-140077480 GGAATTCAAAAGCATGAGGTTGG + Intergenic
1198775579 X:140175782-140175804 GGAAATAAATGAAATGAGGAAGG + Intergenic
1199121700 X:144061697-144061719 GGAAATAAAAAACATGATATAGG + Intergenic
1199179257 X:144834341-144834363 AGAAATAAAAAGAATGGGCTGGG + Intergenic
1199478299 X:148270383-148270405 GGAATTAAAAATGAGGAGTTAGG + Intergenic
1199489757 X:148385382-148385404 GGAAAGAGAAATAATGACATGGG + Intergenic
1200160271 X:154003899-154003921 AAAAATAAAAATAATTAGCTGGG + Intergenic
1200598050 Y:5171820-5171842 GGAATTGGAAATAATGTGGTGGG - Intronic
1200721177 Y:6608055-6608077 GTAAATAAAAGAAATGAGGGTGG - Intergenic
1200806411 Y:7437797-7437819 AGAAAGAAAAAAAATTAGGTAGG - Intergenic
1201334527 Y:12865896-12865918 TGCATTTAAAATAATGAGGTTGG + Intergenic
1201531629 Y:14996059-14996081 GGAAATGAAAATAAGTATGTAGG - Intergenic
1201541301 Y:15108093-15108115 GGAAATAAAAATATTCAATTAGG - Intergenic
1201624099 Y:15994916-15994938 AAAAATAAAAATAATTAGCTGGG + Intergenic
1201643979 Y:16207107-16207129 GGAAATGAAAATTATGACTTAGG + Intergenic
1201658836 Y:16378214-16378236 GGAAATGAAAATTATGACTTAGG - Intergenic
1201714362 Y:17028067-17028089 GGAAAACAAAAGAATGAGCTGGG - Intergenic
1202371436 Y:24199427-24199449 AGAAATAAAAATAAAAAGGAAGG + Intergenic
1202499349 Y:25470688-25470710 AGAAATAAAAATAAAAAGGAAGG - Intergenic