ID: 1187227348

View in Genome Browser
Species Human (GRCh38)
Location X:17386310-17386332
Sequence CTCTGGTTGTCCTCTACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187227338_1187227348 21 Left 1187227338 X:17386266-17386288 CCTTCAACCAGGCTTCCTAATGC No data
Right 1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG No data
1187227342_1187227348 -1 Left 1187227342 X:17386288-17386310 CCAAGTTTCCAGGCCATTCCCAC No data
Right 1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG No data
1187227339_1187227348 14 Left 1187227339 X:17386273-17386295 CCAGGCTTCCTAATGCCAAGTTT No data
Right 1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG No data
1187227341_1187227348 6 Left 1187227341 X:17386281-17386303 CCTAATGCCAAGTTTCCAGGCCA No data
Right 1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG No data
1187227344_1187227348 -9 Left 1187227344 X:17386296-17386318 CCAGGCCATTCCCACTCTGGTTG No data
Right 1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187227348 Original CRISPR CTCTGGTTGTCCTCTACCAC AGG Intronic