ID: 1187232222

View in Genome Browser
Species Human (GRCh38)
Location X:17434160-17434182
Sequence GCTGCCAAGTGGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187232222_1187232232 17 Left 1187232222 X:17434160-17434182 CCATCCACATTCCACTTGGCAGC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1187232232 X:17434200-17434222 CACAGGGAGTTTGGAAGCTGTGG 0: 1
1: 0
2: 3
3: 35
4: 860
1187232222_1187232230 8 Left 1187232222 X:17434160-17434182 CCATCCACATTCCACTTGGCAGC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1187232230 X:17434191-17434213 ACACCTAGTCACAGGGAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1187232222_1187232228 1 Left 1187232222 X:17434160-17434182 CCATCCACATTCCACTTGGCAGC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1187232228 X:17434184-17434206 TTAGGCCACACCTAGTCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 217
1187232222_1187232227 0 Left 1187232222 X:17434160-17434182 CCATCCACATTCCACTTGGCAGC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1187232227 X:17434183-17434205 CTTAGGCCACACCTAGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187232222 Original CRISPR GCTGCCAAGTGGAATGTGGA TGG (reversed) Intronic
904316564 1:29669876-29669898 TCTGGCCAGTGGAATGTGGGTGG + Intergenic
904383223 1:30125326-30125348 TCTGGCCAGTGGAATGTGGGTGG - Intergenic
904755246 1:32765379-32765401 GCTGCCAGATGGTAGGTGGAGGG - Intronic
905061660 1:35145096-35145118 GCTGCCAGGAGCAAGGTGGAGGG + Intergenic
905308663 1:37035034-37035056 GCTGCCAGGAGGAATGGGGTTGG - Intergenic
906280517 1:44550184-44550206 TTTGCCAAGGGGACTGTGGAGGG - Intronic
910259178 1:85279319-85279341 GCTGCTAAGTGGAGAGTAGATGG + Intergenic
911749950 1:101484584-101484606 CTTGCCAAATGGAATGTGGCTGG - Intergenic
911932911 1:103927641-103927663 ATTGCCAAGAGTAATGTGGAAGG + Intergenic
915467366 1:156105397-156105419 GCTGCCAAGTAGAGTAGGGATGG - Intronic
916607748 1:166359631-166359653 GCTGCAAAGGGGACTGTGGATGG - Intergenic
917110634 1:171543803-171543825 GCTGCAAAGTCGAAGGTTGAGGG + Intronic
917219097 1:172708451-172708473 GTTTCCAAGTGGGATGTGGGAGG + Intergenic
917234270 1:172873729-172873751 GCTCCCAAGTGGAATGAAGGAGG - Intergenic
922316924 1:224450779-224450801 GGCTCCAAGTGAAATGTGGAGGG - Intronic
923925687 1:238624790-238624812 GCTGCCAAGTAGAAAATAGATGG - Intergenic
1063974182 10:11402101-11402123 GCTGCAGCGTGGATTGTGGAAGG + Intergenic
1064145589 10:12823870-12823892 GTTGCCAAGCAGAATGTGGCAGG + Intronic
1065982973 10:30920565-30920587 ACTGCCAAGTAAAATGAGGATGG - Intronic
1066754406 10:38696356-38696378 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1068627929 10:59269380-59269402 AATTCCAAGTGGAATGTGTAGGG + Intronic
1069635866 10:69924490-69924512 AATGCCGAGTGAAATGTGGAGGG - Intronic
1071260444 10:83914622-83914644 TTTGGCAAGTGGAAGGTGGATGG - Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072004110 10:91226316-91226338 GCTGTTAAGTGCAATGAGGAAGG + Intronic
1072313920 10:94183509-94183531 GCTGCTAAGTGAGATGGGGAGGG - Intronic
1072314211 10:94186056-94186078 ACTGACAAGTGGAATTTGTAAGG - Intronic
1072737551 10:97889269-97889291 GCTGCCAGCTGGGAAGTGGAGGG + Intronic
1074047630 10:109852916-109852938 GCTGCGAAGTGGAAGGTGTCTGG - Intergenic
1074855731 10:117472058-117472080 TTTGCCAAGTGTAAAGTGGAAGG + Intergenic
1075809614 10:125215487-125215509 GCTGCAATGTGGAATGAGGATGG + Intergenic
1076023741 10:127095106-127095128 CCTGGCAAGTGGATTGTGGGAGG + Intronic
1076246255 10:128949891-128949913 GGTGCCAAGTGGACTGTGCTAGG - Intergenic
1077294764 11:1820999-1821021 GCTGCCAAGGCCAAGGTGGAGGG - Intergenic
1077317755 11:1926959-1926981 GCTGCCAACAGGAAGGTGGGAGG + Intronic
1077337189 11:2010690-2010712 GCTGCCAAGGGGAATGGACAGGG - Intergenic
1078421062 11:11213418-11213440 GATGACAAGGGGACTGTGGAGGG - Intergenic
1078927844 11:15890437-15890459 GCTGCCAGGTGGCCTGAGGAAGG - Intergenic
1079404417 11:20132158-20132180 GGTGCCAGGCCGAATGTGGATGG - Intergenic
1080638872 11:34146969-34146991 GCTGCCTGGTGGAATTTGGAAGG + Intronic
1080748349 11:35129153-35129175 TCTGGCCAATGGAATGTGGATGG + Intergenic
1081283964 11:41245774-41245796 GCGGACAAGTGGAGGGTGGAGGG + Intronic
1084175050 11:67418638-67418660 GCTGCCATGCTGAATGGGGATGG + Intronic
1084543156 11:69799788-69799810 ACTGCTGAGTGGAATGTGGGTGG + Intergenic
1084906067 11:72348618-72348640 GCTGTCATGGGGAATGAGGAGGG - Intronic
1085596891 11:77819708-77819730 GCTGCCAAGATGAAGGGGGAAGG + Intronic
1085824747 11:79833185-79833207 GATGCCAGATGGGATGTGGAGGG - Intergenic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1087267212 11:96073704-96073726 TCGGCTAACTGGAATGTGGAAGG - Intronic
1088127494 11:106446513-106446535 GCTGCCAGGAAGATTGTGGAAGG + Intergenic
1088899978 11:114108548-114108570 GCAGGGAAGGGGAATGTGGAGGG - Intronic
1090153722 11:124413976-124413998 GCTGCCAGGTGGTATGGGGAGGG - Intergenic
1091212373 11:133873127-133873149 CCTGGCAAGTTGAATGAGGATGG - Intergenic
1202820173 11_KI270721v1_random:65872-65894 GCTGCCAAGGGGAATGGACAGGG - Intergenic
1091441286 12:512953-512975 GGTGGAAAGTGGAAGGTGGAAGG - Intronic
1091753672 12:3038257-3038279 GGTGCCAAGGGGAGTGTGGGAGG - Intronic
1094250432 12:28353883-28353905 GGGGCCAATTGGAAGGTGGAGGG + Intronic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1094734995 12:33224169-33224191 GTTGCCAAGGAGAATGTGGCAGG - Intergenic
1097820141 12:64120433-64120455 CCTGAGAACTGGAATGTGGATGG + Intronic
1098447236 12:70578890-70578912 TCTGGCCAGTGGAATGTGGGTGG + Intronic
1100691903 12:97047304-97047326 GCTGGCACGTTGAATGTGGTAGG + Intergenic
1102166829 12:110813514-110813536 GCTGGCAGGTGGGAAGTGGAGGG + Intergenic
1103741288 12:123093570-123093592 GCTGCCGAGTGGCAGGAGGAAGG - Intronic
1104107087 12:125673318-125673340 GGTGCCTATTGGAAGGTGGAGGG + Intergenic
1106020884 13:25914483-25914505 GCTCAGAAGTGGAATGTGGAAGG + Intronic
1106295411 13:28409065-28409087 GCTCCCACTTGGAATGTAGAAGG - Intronic
1107661621 13:42644690-42644712 TCTGACCAGTGGAATGTGAATGG + Intergenic
1107770055 13:43779772-43779794 TCTGGCAAGTGGACTGTGCATGG - Intronic
1108066197 13:46580009-46580031 TCAGTCAAGTGGAATGTGCAAGG + Intronic
1111505052 13:89177684-89177706 ACTTCCAAGTGGAAAGTGAATGG - Intergenic
1112368228 13:98773619-98773641 GCTCTCAGGTGGAAAGTGGATGG - Intergenic
1113716043 13:112508553-112508575 GTTGTGGAGTGGAATGTGGAAGG - Intronic
1115075262 14:29381339-29381361 GTTGCCAACCGGAATGTGGGTGG - Intergenic
1117234816 14:53761523-53761545 GCTGGCAGGTGGAATGTAGAAGG + Intergenic
1119683586 14:76612090-76612112 GCTGGCAAGTAGAATGCTGATGG - Intergenic
1121525524 14:94616454-94616476 GCAGCCCTGTGGAAGGTGGAGGG + Intronic
1124700541 15:31908375-31908397 ACTGCCTAGTGGACTGTGGAAGG - Intergenic
1125091699 15:35800356-35800378 CCTGCACAGTGGAATCTGGATGG + Intergenic
1125419685 15:39492136-39492158 GCTGCCAAGTGCATCCTGGAAGG + Intergenic
1127294152 15:57595088-57595110 GCTGCCAAGGGTTATGTGGCTGG + Intronic
1127379037 15:58412942-58412964 ACTGACAATTTGAATGTGGATGG + Intronic
1128481816 15:68046120-68046142 GCTGCCAATTGGTCTGTGGGCGG - Intergenic
1129088455 15:73122735-73122757 GCTGCGTAGTGGAAAGTGGTGGG + Exonic
1129656156 15:77526941-77526963 GCTGTAAAATGGCATGTGGAGGG + Intergenic
1131491719 15:92868817-92868839 GCTGCCAAGTGGGTTTTTGATGG + Intergenic
1133023332 16:2976505-2976527 GCAGCCAAGTCAAATGTGGAGGG + Intronic
1134842719 16:17414585-17414607 GGTGCCCAGTGGAGTGTGGGAGG - Intronic
1136710520 16:32233517-32233539 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1136728275 16:32380487-32380509 GTTGCCAAGTGGATGGTGGCAGG - Intergenic
1136757391 16:32695894-32695916 GCTGCCAAGGGGCAGATGGATGG - Intergenic
1136810716 16:33174481-33174503 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1136817192 16:33284561-33284583 GCTGCCAAGGGGCAGATGGATGG + Intronic
1136823756 16:33341092-33341114 GCTGCCAAGGGGCAGATGGATGG + Intergenic
1137017215 16:35389787-35389809 GCTGCCAGGGTGAATGTGAAAGG + Intergenic
1138421962 16:56904742-56904764 TTTGCCAAGTGGAATTTGGTAGG - Intronic
1138823367 16:60288144-60288166 GCTCCCAGGTGCACTGTGGATGG - Intergenic
1141126550 16:81404632-81404654 GCTGCAGAGTGGATGGTGGAAGG - Intergenic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1202998163 16_KI270728v1_random:137267-137289 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1203059540 16_KI270728v1_random:956243-956265 GCTGCCAAGGGGCAGATGGATGG - Intergenic
1142985882 17:3695254-3695276 CCTGCCAGGTGGCATGAGGATGG + Intronic
1143213636 17:5208027-5208049 GGTGCCATGTAGAAAGTGGACGG + Intergenic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1147136169 17:38435284-38435306 GATGCCAAGTGGGAGGAGGAAGG + Intronic
1149491944 17:57091441-57091463 GCTGCCAAGGGGTGTGTGGAGGG + Intronic
1150098789 17:62403420-62403442 GCTGCAGTGTGGAAAGTGGATGG - Intronic
1150552503 17:66223730-66223752 TCTGCCAAGTGCACTGAGGAAGG - Exonic
1151526717 17:74674821-74674843 TTTGGCAAGTGGAATGTGGGAGG - Intronic
1151935373 17:77257822-77257844 GCTGCCGGGTGGAAGGTGGACGG + Intergenic
1152731875 17:81976632-81976654 GCTGCCCAGTAGCCTGTGGAAGG - Intergenic
1152811970 17:82386520-82386542 GCTGCCCAGGGGAAGGCGGAGGG - Intergenic
1155065919 18:22268665-22268687 GCTGCCCAGAGGAAAGTGGCGGG - Intergenic
1157446915 18:47753130-47753152 GCTGGCATGTGGCAGGTGGAGGG - Intergenic
1159189094 18:65017935-65017957 GATGCCAAGTGGGATATGAAGGG - Intergenic
1163554663 19:17985121-17985143 GCAGGCAAAGGGAATGTGGAAGG + Intronic
1164881285 19:31734630-31734652 TCTGCCCACTGGAAGGTGGAGGG - Intergenic
1165783757 19:38448664-38448686 GCCCCCAAGCGGGATGTGGAGGG + Exonic
1165864090 19:38925473-38925495 GCTGACAACTGGAGTGTGGTGGG + Intronic
1166837189 19:45674664-45674686 GCCGCCTAGGGGAATTTGGAAGG - Exonic
1167738114 19:51309986-51310008 GATGCAAAGTGGAAAGGGGAGGG + Intergenic
925021634 2:574133-574155 GCTGCCAGCTGGCATTTGGAGGG - Intergenic
925030027 2:643278-643300 GATACAAAGTGGAAGGTGGAGGG - Intergenic
925422751 2:3725593-3725615 GCTGCCAGGTGGATCCTGGAGGG + Intronic
925422807 2:3725858-3725880 GCTGCCAGGTGGATCCTGGAGGG + Intronic
926000183 2:9324458-9324480 GCTGCCAAGTCCAAGGTTGAGGG + Intronic
926240031 2:11078338-11078360 GCTGCAAAGAGGAATTGGGATGG + Intergenic
926580481 2:14629077-14629099 TCTGGCAAATGGAATGTGGGTGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927148037 2:20179789-20179811 GCAGGCAAGTGGGCTGTGGAGGG - Intergenic
932793674 2:74676780-74676802 GCTGCTAAATGGAAAATGGATGG - Intronic
934031808 2:88055420-88055442 GCTTCCGAGTGGAGTGCGGAGGG - Intronic
934157778 2:89219207-89219229 GCTGCCAATTGTCAAGTGGAAGG - Intergenic
934209485 2:89963219-89963241 GCTGCCAATTGCCAAGTGGAAGG + Intergenic
934221422 2:90087491-90087513 AATGCATAGTGGAATGTGGAGGG + Intergenic
934317699 2:91940600-91940622 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
935253150 2:101283154-101283176 GCTGCCAGGTAGAAGTTGGAAGG - Intronic
935819176 2:106877047-106877069 GATGTCAAATGGAATGTGGGAGG - Intronic
937723039 2:125126138-125126160 GCTGCCAGGTGGTATAGGGAAGG + Intergenic
939895367 2:147785017-147785039 TCTGACCAGTGGAATGTGGATGG - Intergenic
941040713 2:160619739-160619761 TCTCCCTAGTGGAAGGTGGATGG - Intergenic
941773365 2:169365483-169365505 GTTGCCAAATGGAAAGTAGATGG - Intergenic
944822191 2:203441879-203441901 GCTTCCTGGTGGAATGAGGATGG + Exonic
945896905 2:215493600-215493622 GCTGCCCAGTGGTATGTGGATGG - Intergenic
947578033 2:231292465-231292487 GTTGCCAACTGCAGTGTGGAAGG + Intronic
948797712 2:240413174-240413196 GCTGCCAGGTGGAAATGGGAGGG + Intergenic
1169479612 20:5967007-5967029 GCTTCCAAGTTGGATGTGGCAGG - Intronic
1171284087 20:23923535-23923557 GGGGCCAAGTGGAAGGTGCAGGG + Intergenic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1172310377 20:33913442-33913464 GCTACCTATTGGAATGTGGGGGG - Intergenic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1173284647 20:41659277-41659299 TCTGACCAGTGGAATGTGGGTGG + Intergenic
1173982877 20:47238606-47238628 AATGCCAAATGGAATGTGCAAGG + Intronic
1174889352 20:54374119-54374141 GCCCCCAGGTGGTATGTGGATGG + Intergenic
1176190888 20:63809113-63809135 CCTGCGAAGGGGAACGTGGAAGG - Intronic
1178721092 21:35009680-35009702 GCTGGCAAGAGGAATGAGCAGGG - Intronic
1180064840 21:45406999-45407021 GGTGTCTAATGGAATGTGGAAGG + Intronic
1180305868 22:11124269-11124291 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1180544387 22:16486452-16486474 GTTGCCAAGTGGATGGTGGCAGG + Intergenic
1181465133 22:23106858-23106880 GCTGCCCAGGGGAATGGGCAGGG + Intronic
1182067552 22:27441503-27441525 GCTGTCATTTGAAATGTGGATGG - Intergenic
1182265276 22:29109871-29109893 GTTGACAAGTGGAATATGTAAGG + Intronic
1182299654 22:29330469-29330491 GTCGCCAAGAGGAACGTGGAGGG - Exonic
1182948630 22:34349826-34349848 GGTGACAAGGGGCATGTGGAAGG + Intergenic
1183666196 22:39247483-39247505 GCTGAGAAATGGAATGAGGAAGG + Intergenic
1184256894 22:43292225-43292247 GCTGCCAAGATGGCTGTGGAAGG + Intronic
1184761445 22:46547050-46547072 GCTGCCAAGAGGATGGGGGAGGG + Intergenic
949346654 3:3083233-3083255 GCTGTCAAATGGACTGTGGGAGG + Intronic
950627439 3:14258677-14258699 GCTGGAAAGTGGTATGTGGCTGG + Intergenic
950689177 3:14642022-14642044 TCTGGCCAGTGGAATGTGGATGG + Intergenic
951948268 3:28167151-28167173 TCTGGCCAGTGGAAAGTGGATGG - Intergenic
952079630 3:29742374-29742396 GTTGGCAAGTGAAATGTTGAAGG - Intronic
952134143 3:30398281-30398303 GCTGCACAGTGGTTTGTGGATGG - Intergenic
952952987 3:38539167-38539189 GCTGCCTAGTGGGAGGTAGAGGG + Intronic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
956725967 3:72156712-72156734 GCTGCCATGTGGATAGTGCATGG + Intergenic
959442105 3:106389943-106389965 GATGCCAGGTGGAATTTGAAAGG + Intergenic
961533972 3:127558031-127558053 ACTGGCAAATGGAAGGTGGAGGG + Intergenic
962345891 3:134618787-134618809 GATGCCAAGGGGACTGTGAAAGG - Intronic
962432167 3:135329640-135329662 GCTGCCATGTGGAGAGTGGTTGG - Intergenic
963902510 3:150746026-150746048 GTAGACAAGTGGATTGTGGATGG + Intronic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
966922107 3:184619220-184619242 GTTGCCAGGTTGAATTTGGAGGG - Intronic
966955300 3:184871018-184871040 GCTGCTTAGTGGCGTGTGGAAGG + Intronic
967113423 3:186315872-186315894 ACTGACCAGTGGAATGTGGAGGG + Intronic
967827539 3:193890178-193890200 GCTGCTTAATGGAATGTGGGCGG - Intergenic
968462711 4:733271-733293 GCTGCCGGGTGGGATGAGGATGG - Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969899677 4:10337375-10337397 GCTCCCAATTGAAATGTGTAGGG + Intergenic
969959442 4:10929015-10929037 GCTCCCAAGAGGAAAGTGGGAGG + Intergenic
970590960 4:17560421-17560443 GCTGGCCAGTGGAATGTAGGTGG + Intergenic
970875374 4:20862957-20862979 GGGGCCTAGTGGAATGTGGAGGG + Intronic
971421076 4:26474694-26474716 GCAGCCTGGTGGAATGAGGACGG + Intergenic
976036683 4:80831532-80831554 GCTGGCATGCGGAATGTGGGAGG + Intronic
977465633 4:97380708-97380730 TCTGCCACTTGGAATGGGGATGG + Intronic
977950170 4:102961888-102961910 GTTGCCAAGTGGATGGTGGCAGG + Intronic
980701828 4:136442121-136442143 GCTGCCAGGAGGCATGGGGAGGG + Intergenic
983500886 4:168498515-168498537 GATACCAAGTGGAATCTGCAAGG + Intronic
984623226 4:181976593-181976615 GCTGTCAACTGAGATGTGGAAGG + Intergenic
987544453 5:19294819-19294841 GCTGGCTAGTGGCATCTGGATGG - Intergenic
988270647 5:29011034-29011056 GCTGCCAAGTGAGTTGTGAAAGG - Intergenic
991256805 5:64622836-64622858 GCTGTGAAGTGGCATCTGGAAGG + Intergenic
996332209 5:122342480-122342502 GCTATTAAGTGGCATGTGGATGG - Intronic
996769254 5:127068647-127068669 GCTGACAAATGTAAAGTGGAAGG + Intronic
997347717 5:133204124-133204146 GCTGGGAAGTGGCATGTGGAGGG + Intronic
997823474 5:137086297-137086319 GCTGGGAACTGGAACGTGGAAGG - Intronic
999740037 5:154542929-154542951 GATACCAGGTGGAAGGTGGAAGG - Intergenic
1000988985 5:167892544-167892566 GCTGCACAGTGGATTCTGGATGG - Intronic
1001325934 5:170724026-170724048 GCTTCCCAGGGGAATATGGATGG - Intronic
1002027412 5:176404846-176404868 GCTGCCCAGGGGGATGTGGGTGG - Intronic
1002046757 5:176545847-176545869 GCTGCCTTGTGGCAGGTGGATGG + Intronic
1002429162 5:179193046-179193068 TCTCCCAAGTGGAAAGTGGGAGG - Intronic
1004218461 6:13724208-13724230 GCTCTCAAGTGAAATGTGTAGGG + Intergenic
1004361508 6:14975315-14975337 TCTGCCCAGTGGCATGGGGAAGG - Intergenic
1004634856 6:17456846-17456868 GCTGCAAAGTCCCATGTGGATGG - Intronic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1005850100 6:29814595-29814617 GCTGCAAAGTGGACAGAGGATGG + Intergenic
1006140075 6:31923218-31923240 GAGGCCCAGTCGAATGTGGAAGG - Intronic
1007408376 6:41647646-41647668 GCTGGGAAGTGGAGTGGGGAGGG - Intronic
1007422435 6:41727845-41727867 GCTTCCAAGTGGCAGGTGGGTGG + Intronic
1008148369 6:47919901-47919923 TCTGGCCAGTGGAATGTGGGTGG + Intronic
1008318998 6:50083572-50083594 GCTGCCATATGGAGTGTGGGTGG + Intergenic
1008653604 6:53588574-53588596 GATGCCAAGTGAAATGTAAAAGG - Intronic
1009042921 6:58202304-58202326 GTTGCCAAGGGTAATGGGGAGGG + Intergenic
1009218759 6:60956547-60956569 GTTGCCAAGGGTAATGGGGAGGG + Intergenic
1014336132 6:120139924-120139946 GCTGCCAAGTCCAAGGTTGAGGG + Intergenic
1016745377 6:147573743-147573765 GCTGGGCAGTAGAATGTGGAGGG + Intronic
1017325540 6:153137445-153137467 TCTCCAGAGTGGAATGTGGAAGG + Intergenic
1017973471 6:159333242-159333264 GCTGCCAAGTGGGAGACGGATGG + Intergenic
1018399822 6:163411630-163411652 GCAGCCAAGTGGGCTGTGGGAGG + Intergenic
1018851496 6:167643731-167643753 GCCTCCAGGTGGAATGAGGAGGG + Intergenic
1019748611 7:2714730-2714752 GCTGCCAAGTGGAATTTGGCTGG + Exonic
1019843660 7:3475043-3475065 GTTGCCATGTGGAAAATGGACGG - Intronic
1019906655 7:4070000-4070022 GATGCTAAGAGGACTGTGGATGG - Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1023856289 7:44186124-44186146 GCTCAGAAGTGGAATGAGGATGG - Intronic
1024969115 7:55052613-55052635 GATGCCTGGTGGAATGAGGAAGG + Intronic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1026978952 7:74515604-74515626 GCCCCCAAATGGAATGAGGAAGG - Intronic
1027226533 7:76247349-76247371 GCTGCCAAGTGGCTTGTAGGGGG - Intronic
1030360709 7:108592830-108592852 GCTGCCAAATTTAATATGGAGGG + Intergenic
1032915308 7:136482976-136482998 GCTGCCAAGTGGTTTGAGGATGG + Intergenic
1033439605 7:141366956-141366978 GATGCTAAATTGAATGTGGAGGG + Intronic
1033992485 7:147305498-147305520 GCTGACAAGTGGATTCTGAATGG - Intronic
1034860935 7:154594193-154594215 GCAGCTAAGTGGATTATGGATGG + Intronic
1039288361 8:36067291-36067313 GCTGGCCAGTGAAATGTGGGTGG - Intergenic
1041216822 8:55608881-55608903 GCTGGCAGGAGGAATGGGGAGGG + Intergenic
1041281275 8:56212314-56212336 ACTGCCAGGTGCAAAGTGGAAGG - Intronic
1043008565 8:74852517-74852539 GCTGCCAAATGAAATTTGTAGGG - Exonic
1043433263 8:80214667-80214689 GTTGCCAAGTGGATTGTTAAGGG - Intronic
1044218364 8:89639670-89639692 TCTGCCAAGTGTCATGAGGATGG + Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049698439 8:143994978-143995000 ACTGCCAAGTGAAATGTGCCAGG + Intronic
1052760752 9:32588609-32588631 TCTGGCAAATAGAATGTGGATGG - Intergenic
1053538000 9:38945482-38945504 GCTGCTAAATGGAATGTATATGG + Intergenic
1054628134 9:67418439-67418461 GCTGCTAAATGGAATGTATATGG - Intergenic
1055128856 9:72751638-72751660 CCTGTCATGTGGAATGTAGAAGG - Intronic
1057039092 9:91834335-91834357 GCTGCCAAATGACTTGTGGATGG - Intronic
1057042004 9:91854690-91854712 GCTGCAAAGTGGAAGGCGGTTGG + Intronic
1057056323 9:91964037-91964059 GCTGCCTGGCTGAATGTGGAAGG - Intergenic
1057562390 9:96138786-96138808 GCTGCCAAGAGGACTGTGTCAGG + Intergenic
1059557146 9:115292887-115292909 GCTGCCAAGAGAAATGAGGCTGG - Intronic
1186713062 X:12220562-12220584 GCTGACCAATGGAATGTGGTAGG - Intronic
1187029546 X:15471551-15471573 GCTTACAAATGGGATGTGGAAGG - Intronic
1187232222 X:17434160-17434182 GCTGCCAAGTGGAATGTGGATGG - Intronic
1190338783 X:49280016-49280038 GCAGTCAAGAGGAATGAGGATGG - Intronic
1194341554 X:92712220-92712242 GCTTGCAATTGGCATGTGGAGGG + Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1197746859 X:129937292-129937314 TATGCCAGGTGGAATGTGCAAGG - Intergenic
1199086432 X:143634616-143634638 GCAGGCAAGTGGGAGGTGGAGGG + Intronic
1200037261 X:153339970-153339992 GCTGCCAAACAGAATGTAGAGGG - Intronic