ID: 1187234695

View in Genome Browser
Species Human (GRCh38)
Location X:17456281-17456303
Sequence TTGTTCATCTAGAAGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187234692_1187234695 0 Left 1187234692 X:17456258-17456280 CCAAATTATAAAATGAAGTCCAT 0: 1
1: 0
2: 1
3: 33
4: 382
Right 1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 182
1187234691_1187234695 16 Left 1187234691 X:17456242-17456264 CCTGGGAGATCTTATGCCAAATT 0: 1
1: 0
2: 4
3: 7
4: 141
Right 1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 182
1187234689_1187234695 18 Left 1187234689 X:17456240-17456262 CCCCTGGGAGATCTTATGCCAAA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 182
1187234690_1187234695 17 Left 1187234690 X:17456241-17456263 CCCTGGGAGATCTTATGCCAAAT 0: 1
1: 0
2: 2
3: 8
4: 116
Right 1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187234695 Original CRISPR TTGTTCATCTAGAAGAGTCT GGG Intronic
902939634 1:19791474-19791496 TTGTGCAGCTGGAAGAGTTTGGG - Intronic
907801489 1:57770152-57770174 TTCTCAATCTAGAAGAGCCTTGG + Intronic
909969088 1:81958081-81958103 TTGTACATTTAGTAGAGACTGGG - Intronic
910945519 1:92587780-92587802 TTTTTCATTTAAAAGAGTGTAGG - Intronic
911874292 1:103139283-103139305 TTGTTCATCTGGTAGAATTTGGG - Intergenic
914871080 1:151474482-151474504 TTGTGCATTTAGAAGGATCTCGG + Intergenic
917239472 1:172932212-172932234 TTGATCATTTAAAAGTGTCTAGG + Intergenic
917297106 1:173531678-173531700 TTCTTCATCTACAACTGTCTTGG + Intronic
920124825 1:203685532-203685554 TTTTTCATCCTAAAGAGTCTAGG - Intronic
923370961 1:233311952-233311974 TTGTACATTTAGTAGAGACTGGG - Intergenic
923485598 1:234427986-234428008 TTGTTTCTCTTGAAGAGTCCTGG - Intronic
923830522 1:237550578-237550600 TCGGTCATCCAGAAGAGTGTAGG - Exonic
923925164 1:238618741-238618763 ATGTTCAGCAGGAAGAGTCTGGG + Intergenic
924484636 1:244468967-244468989 CTTTTCATCAAGAAGAGTCACGG - Intronic
1063240822 10:4167563-4167585 CTGTTCATCTCCAGGAGTCTGGG - Intergenic
1063742894 10:8844202-8844224 GTGTTCTTCTAGAAGGGTCTAGG + Intergenic
1068683950 10:59849843-59849865 TTTTCCATCTGGAAGATTCTTGG - Intronic
1068920399 10:62477331-62477353 TTTTTCCTCTAGAAAAGTTTAGG - Intronic
1068944847 10:62719555-62719577 TTGGTAATCTAGAAGAGTTTTGG - Intergenic
1073374705 10:103023210-103023232 CTGATCATTTAAAAGAGTCTGGG - Intronic
1075202324 10:120415252-120415274 TTGCTTAGCCAGAAGAGTCTAGG - Intergenic
1081876185 11:46409930-46409952 CTGGTCATCTGGAAGAGCCTGGG + Intronic
1084582780 11:70034523-70034545 TTATTCATCTAGAAGAGAAGAGG + Intergenic
1087487435 11:98773467-98773489 TTGTTTACATAGAAGATTCTGGG + Intergenic
1087497885 11:98913646-98913668 TTGGTCATGTAGAAGCATCTCGG + Intergenic
1087850473 11:103022628-103022650 TTGTATATTTAGAAGAGTCGAGG + Intergenic
1088157721 11:106829076-106829098 TTGTTCGTCGAGCAGACTCTTGG - Intronic
1089808281 11:121111432-121111454 TTTTTTATCCAGAAGAGTCTTGG + Intronic
1089932026 11:122322378-122322400 TTGTTTATGTAGAAAAGGCTTGG - Intergenic
1091928952 12:4379308-4379330 TTGTCCATCTACAGGAGGCTTGG - Intronic
1092056805 12:5514152-5514174 TTGTTAATCTAGAACGGTGTTGG - Intronic
1092403454 12:8197641-8197663 TTGATGCTCAAGAAGAGTCTTGG - Intergenic
1096551111 12:52372247-52372269 TTGTTCACCTAGAAAAGTGCTGG + Intergenic
1097915120 12:65013090-65013112 TTGTTCATCAAGAAGGTCCTTGG + Intergenic
1098077537 12:66748939-66748961 TTGTTTATATAGAGAAGTCTGGG - Intronic
1099278312 12:80607336-80607358 TTGTTGATCTAAAGGAGTTTTGG - Intronic
1100802815 12:98251322-98251344 TTTTTCATCTAGATTTGTCTGGG - Intergenic
1101672826 12:106892576-106892598 TTTCTCAGCTAGAAGAGTCCTGG - Intergenic
1102939498 12:116926834-116926856 CTGTTCATCTAGAAGTCTCGGGG - Intronic
1108845453 13:54673660-54673682 TTTTTAATTTAGAAAAGTCTAGG + Intergenic
1110330611 13:74268013-74268035 TTGTTCCTCCTGAAGACTCTAGG - Intergenic
1112285776 13:98103235-98103257 TTGGTCAGATAGAATAGTCTGGG - Intergenic
1114297219 14:21340766-21340788 TTGTTCTTTTATAAGAGTATTGG - Intronic
1114356289 14:21912802-21912824 TTCTTTATCTACAACAGTCTTGG + Intergenic
1117712773 14:58549688-58549710 ATATTCATCTACAAGACTCTGGG + Intronic
1118005674 14:61562574-61562596 TAGGTCAGCTGGAAGAGTCTTGG + Intronic
1123854095 15:24389102-24389124 TTGTTTATCTTGAAGAATCTTGG + Intergenic
1126761742 15:51975961-51975983 TTCTTCATATAAAAGAGTTTGGG + Intronic
1127666932 15:61156922-61156944 ATGTTCATCTTGAAGAACCTGGG + Intronic
1128125281 15:65187682-65187704 ATGTTTATCGAAAAGAGTCTTGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1132401687 15:101512246-101512268 TTCTTCATCTAGAAGATTTGCGG + Intronic
1132581904 16:688657-688679 TTGTTCACCTGGAGGAGACTAGG - Intronic
1137717469 16:50607295-50607317 TTGTTCATCAAGAAGAGGACTGG + Intronic
1139564327 16:67763867-67763889 TTGTACATTTAGAAGAGACAGGG + Intronic
1140745304 16:77975575-77975597 CTGCTCCTCTAGAATAGTCTGGG + Intronic
1143915066 17:10285550-10285572 TTCCTCCTCTGGAAGAGTCTGGG + Intergenic
1144277815 17:13691228-13691250 ATGTTCACCTAGAAAAGTATAGG - Intergenic
1144601092 17:16614629-16614651 TTGGTCCTCTGGAAGAGTGTGGG - Intergenic
1144957990 17:19029204-19029226 TTGATCATATAGTAGAGTCAGGG + Intronic
1144977168 17:19145316-19145338 TTGATCATATAGTAGAGTCAGGG - Intronic
1145176300 17:20703272-20703294 TTGTTCTTTTAGTAGAGACTGGG - Intergenic
1146774569 17:35601567-35601589 GTGTTCATCTATATGAATCTTGG - Intronic
1149453190 17:56766179-56766201 GTGTTGATCTTAAAGAGTCTGGG - Intergenic
1149764135 17:59260527-59260549 TTTTTTTTTTAGAAGAGTCTCGG - Intronic
1151849203 17:76680234-76680256 TTTTTCATCTAGAGGAATCTCGG - Intronic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154404526 18:14077044-14077066 TTTTTTTTCTAGAAGAGTCGGGG - Intronic
1155365643 18:25046849-25046871 TTATTCGTGTAGAAGAATCTTGG + Intergenic
1156073228 18:33238131-33238153 TTATTCATGTTGATGAGTCTTGG - Intronic
1156758095 18:40553105-40553127 TTTTTCATTCAGGAGAGTCTGGG + Intergenic
1157101971 18:44738973-44738995 GTATTCATTTAGAAGACTCTAGG + Intronic
1157404565 18:47412186-47412208 TAGTTCATCAAGAAGAGACAAGG + Intergenic
1157893488 18:51441511-51441533 TTGTTCATCTAGAAGGTGCAGGG - Intergenic
1164583227 19:29448103-29448125 TTGATCAAATAGAAGATTCTAGG - Intergenic
1164850799 19:31482597-31482619 CTGATCATTTAAAAGAGTCTTGG - Intergenic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1168675973 19:58278498-58278520 TTGTTCATATAAAAGACTTTGGG - Intronic
925241672 2:2336561-2336583 ATGCTCATTTAGAAGAGTTTTGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928221002 2:29402689-29402711 TTGTTCAGCTACAGAAGTCTAGG + Intronic
930650796 2:53962684-53962706 TTGTTCATTTAGGACAGACTAGG - Intronic
931814555 2:65887984-65888006 TTCTCCATCTGGAAGAGACTGGG - Intergenic
932475918 2:72005768-72005790 TTGTTCATCTAGGAGTCTTTGGG + Intergenic
933113456 2:78434595-78434617 TAATTCATCTAGAATAGTTTGGG + Intergenic
936062407 2:109303767-109303789 TTCTACATCTCGATGAGTCTGGG + Intronic
939257258 2:139759893-139759915 GTGTGCATCTAGAAATGTCTGGG + Intergenic
939814347 2:146875506-146875528 TTGTTAATCTAGTAGAGATTGGG + Intergenic
941104710 2:161340181-161340203 TTTTTCATCTAGAGGAATCTCGG - Intronic
941545315 2:166842834-166842856 CTCTTCATCTTGAAGAGTCAGGG + Intergenic
942668683 2:178350258-178350280 ATGTTTAACAAGAAGAGTCTAGG + Intronic
943445046 2:187974269-187974291 TTCTTCATCTAGAAGAGGGTGGG + Intergenic
946688947 2:222296789-222296811 GTGTTCATCAAGAAGTGTCCAGG + Intronic
1168974945 20:1957796-1957818 TTGTTCCTCTAGAAGAGATCTGG + Intergenic
1174214236 20:48903908-48903930 TTGTTCTTCTAGATGACTCTAGG - Intergenic
1174642353 20:52055536-52055558 TTGTTCTTCTATTAGAGACTGGG - Intronic
1175092092 20:56512998-56513020 TTGTTCATACAAAAGGGTCTAGG + Intronic
1180869738 22:19139369-19139391 TTGTTCATCTGGGAGTGACTTGG - Intronic
1181954860 22:26580765-26580787 TTGTTAAACAAGAGGAGTCTGGG + Intronic
1183120056 22:35723253-35723275 TTGAGCATCTACAAGAGACTTGG - Intronic
1185161357 22:49231819-49231841 TTGTTCATCTAAAAATGTGTGGG - Intergenic
951374220 3:21893172-21893194 TTGTTGATGTGGAAGAGTATTGG + Intronic
953524491 3:43677374-43677396 TTGTACTTTTAGAAGAGACTGGG - Intronic
954960687 3:54562166-54562188 CTGTTCCTCTACAAGAGTTTTGG + Intronic
956178665 3:66498798-66498820 TTGTTCATGGAGCAGTGTCTCGG + Intronic
960649053 3:119925838-119925860 TTGTTCATCTGGAATAATTTTGG - Intronic
962668705 3:137683095-137683117 GTGTTTATATAGAAAAGTCTTGG + Intergenic
963872005 3:150427068-150427090 TTGCTCATCTCTAAGAATCTTGG + Intronic
965393781 3:168136657-168136679 TTGTTTATCTAAAACAGTGTGGG + Intergenic
965892621 3:173533679-173533701 TTGATCATGTAGAAAGGTCTTGG + Intronic
967146561 3:186611668-186611690 TTTTTCATCTGGAAGAATCATGG + Intergenic
969730396 4:8952925-8952947 TTGTATTTCTAGAAGAGACTGGG + Intergenic
969762615 4:9200215-9200237 TTGATGCTCAAGAAGAGTCTTGG + Intergenic
971147605 4:23995809-23995831 TTGTTCCTCTAGTAGACTATAGG + Intergenic
971660516 4:29408274-29408296 TTGGTTATTTAAAAGAGTCTGGG - Intergenic
973747016 4:53973673-53973695 TTGTTCATAAGGAAGAGTCTTGG - Intronic
975671048 4:76781053-76781075 ATGGTCATCTCGAAGAGTGTTGG - Exonic
976916258 4:90378960-90378982 TTATTTTTCTAGAAGAGACTAGG - Intronic
979474845 4:121143311-121143333 TGATTCATCTAGATGAGGCTGGG - Intronic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
986464076 5:8004011-8004033 TTGTTCCTCTGGGAAAGTCTTGG + Intergenic
987883328 5:23778527-23778549 TTGTTAACCAAAAAGAGTCTTGG + Intergenic
989550269 5:42726764-42726786 CTCTTCATCTAGAAGATCCTTGG - Intergenic
994829697 5:104763794-104763816 TTGATCATCTAAAAGATTCAAGG + Intergenic
996938580 5:128976010-128976032 TTGTTGATCTAGCTGAGTCTAGG + Intronic
998528683 5:142865312-142865334 TTCTTCATCTAGAAGAGGTCAGG + Intronic
1001063695 5:168517556-168517578 TAGAGCATCTAGAAGAGTATCGG - Intronic
1001728579 5:173929754-173929776 TGGTTCATATAGAACAGCCTTGG + Intronic
1002834797 6:856884-856906 TTCTTCAGCTAGAAGATTTTAGG - Intergenic
1003916429 6:10790912-10790934 TTGATCGTTTAAAAGAGTCTGGG + Intronic
1004111829 6:12726248-12726270 TTTTTGATATAGAATAGTCTGGG + Intronic
1005851577 6:29827377-29827399 TTTTTCTTCTAGAAGAGTACAGG + Intronic
1005858962 6:29887286-29887308 GTTTTCTTCTAGAAGAGTCCAGG + Intergenic
1005866514 6:29942067-29942089 TTTTTCTTCTAGAAGAGTCCAGG + Exonic
1006239240 6:32663179-32663201 TTGTTCATCTTCAACAGACTGGG + Intronic
1007143567 6:39603237-39603259 ATGTTCATATAGAAGGGGCTTGG + Intronic
1010403799 6:75479566-75479588 ATTTTCATTTAAAAGAGTCTTGG + Intronic
1011858830 6:91729390-91729412 TGGTTAATCTAGAAGCTTCTGGG + Intergenic
1012581657 6:100877624-100877646 TGGTTCATACAGCAGAGTCTAGG + Intronic
1013084504 6:106844816-106844838 CTGTTCAAATAGAAGAGTATGGG - Intergenic
1013834411 6:114316725-114316747 TTGTTCATCTAGGAAGGTTTTGG - Intronic
1014179755 6:118371873-118371895 TTTTGCATCAAGAAGATTCTAGG - Intergenic
1014898406 6:126932319-126932341 TTTCTCATCTAGAAAATTCTTGG - Intergenic
1016655060 6:146509268-146509290 TTGTTCATATATAACAGTATAGG - Intergenic
1018471917 6:164105131-164105153 TTGTCCTTCAGGAAGAGTCTTGG - Intergenic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027150411 7:75729611-75729633 TTGTACTTTTAGAAGAGACTAGG - Intronic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027694520 7:81392963-81392985 TTGAACATCTGGAACAGTCTTGG - Intergenic
1028106987 7:86889903-86889925 TTGTTCAGCTAGTTGAGTCTGGG + Intronic
1028610688 7:92707796-92707818 TTGTTAAGTTGGAAGAGTCTGGG - Intronic
1028939378 7:96503846-96503868 TTCTTCAGCTAGAAGAGTAAGGG + Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1030090609 7:105854513-105854535 TTTTTCCTCTATAAGGGTCTGGG - Intronic
1030139482 7:106290397-106290419 TTCTTGATCTAGAAGAGTCCAGG - Intergenic
1030256573 7:107516024-107516046 TTTTTCTTTAAGAAGAGTCTTGG - Intronic
1030921424 7:115393524-115393546 TTCATTTTCTAGAAGAGTCTTGG + Intergenic
1031489613 7:122370702-122370724 TAATTCAACTAGAAAAGTCTTGG - Intronic
1031572802 7:123379871-123379893 TTATTCATCTAGTAGGCTCTGGG - Intergenic
1033992160 7:147301731-147301753 TTGTTCATCTACAACATTCCAGG - Intronic
1036272703 8:7321952-7321974 TTGATGCTCAAGAAGAGTCTTGG + Intergenic
1036348645 8:7988396-7988418 TTGATGCTCAAGAAGAGTCTTGG - Intergenic
1036843913 8:12148865-12148887 TTGATGCTCAAGAAGAGTCTTGG - Intergenic
1036865283 8:12391185-12391207 TTGATGCTCAAGAAGAGTCTTGG - Intergenic
1037163773 8:15802002-15802024 CTGTTCTTCGAGAAGAATCTTGG + Intergenic
1037284187 8:17279224-17279246 CTGTTTATCTTGTAGAGTCTTGG + Intronic
1041298406 8:56386338-56386360 TTGTACTTCTAGAAGACTCCAGG - Intergenic
1042348600 8:67752225-67752247 TTATTCCTCTGTAAGAGTCTTGG - Intergenic
1042917001 8:73885286-73885308 TTGTGAACATAGAAGAGTCTGGG + Intergenic
1043109414 8:76159945-76159967 TTGTTCATTTAGAAGCTTCCTGG - Intergenic
1043840360 8:85095151-85095173 TTTTTCATCTAGTTGGGTCTGGG - Intergenic
1045365806 8:101475055-101475077 TTGTTCATATAGACCAATCTTGG - Intergenic
1045641082 8:104251657-104251679 TAGTTCATCTAAAAGTATCTGGG - Exonic
1046753540 8:117950050-117950072 TTGTTTATTTAGTAGAGTCAGGG - Intronic
1051794321 9:20847669-20847691 TTTTCCATGTAGAAGAGTTTTGG + Intronic
1052040274 9:23730688-23730710 TTGTTCTTCTATAAAGGTCTGGG - Intronic
1052230532 9:26145629-26145651 TTCTTCCTCTAGAACAGGCTTGG + Intergenic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1055169027 9:73232101-73232123 CTGTTCATCTAGAACAGAGTTGG - Intergenic
1060102368 9:120851761-120851783 TTGTTTACCTGGAAGAGTGTGGG + Intergenic
1185744877 X:2564591-2564613 TTGTTCATCTAAGAGAATGTGGG - Intergenic
1187021353 X:15386019-15386041 TTGTTCATCTAGCAGATCATGGG - Intronic
1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG + Intronic
1187620516 X:21047906-21047928 TTGTTCAGATAGAAGCATCTGGG - Intergenic
1188637253 X:32449666-32449688 TTGTTCAGCTACAAGAGAGTTGG + Intronic
1188802488 X:34549250-34549272 TTGTTCATTTGGAACATTCTAGG - Intergenic
1190715799 X:53102406-53102428 TTGATCATTTAGAAGACTCCTGG + Intergenic
1192362952 X:70450624-70450646 TTGTTCACCTAGAAGAGGAGAGG - Exonic
1192837897 X:74821516-74821538 TTGTTCATCTATAGGAGTAATGG - Intronic
1192947888 X:75985400-75985422 TTCTTCATTTGCAAGAGTCTAGG - Intergenic
1196021544 X:110996088-110996110 TACTTCATCTAGAAGAGGCCTGG - Intronic
1197318995 X:125005490-125005512 ATGTTCCACTAGTAGAGTCTAGG + Intergenic