ID: 1187239602

View in Genome Browser
Species Human (GRCh38)
Location X:17500621-17500643
Sequence TTCTATGTGAAGCTAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187239596_1187239602 28 Left 1187239596 X:17500570-17500592 CCACTCTGATCAAGCAGCAGGAG 0: 1
1: 0
2: 1
3: 19
4: 173
Right 1187239602 X:17500621-17500643 TTCTATGTGAAGCTAGGGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187239602 Original CRISPR TTCTATGTGAAGCTAGGGAA AGG Intronic
905959640 1:42032936-42032958 TTGTATCTGGTGCTAGGGAATGG - Intronic
906537545 1:46560043-46560065 ATCTAGGTGAAGGAAGGGAAGGG + Intronic
908054142 1:60264950-60264972 TTATAGGTGAAGTTGGGGAAGGG + Intergenic
909398540 1:75198287-75198309 CTCTCTGAGAAGCTAGTGAAGGG - Intergenic
910396485 1:86799260-86799282 TTCTCTGTGAAACTTGGGAGGGG - Intergenic
912208956 1:107537787-107537809 TTGGATGTCAAGCAAGGGAAAGG - Intergenic
914221403 1:145685232-145685254 TTGTATGTCAACCTAGGCAAGGG + Intronic
914473969 1:148008099-148008121 TTGTATGTCAACCTAGGCAAGGG + Intergenic
916208017 1:162334164-162334186 CTCTTTGTGGAGCTAGGGTAGGG - Intronic
916432135 1:164740830-164740852 TTCTATGGGAAGATAGAAAAGGG + Intronic
917512908 1:175682916-175682938 TTCTATGTGTAGCTAGAGCCAGG + Intronic
917944177 1:179952630-179952652 ATCTATGTGAAGATGGGTAACGG + Intergenic
918018793 1:180664541-180664563 TTCTGTGTGAAGAGAGGGTAGGG - Intronic
921892673 1:220368761-220368783 TTGTTTGTGAAGCTTGAGAAAGG - Intergenic
1063462290 10:6222455-6222477 TTCTTTGTGCAGTGAGGGAAAGG - Intronic
1064445277 10:15387373-15387395 GTCGATGTTAAGCGAGGGAAAGG + Intergenic
1065119550 10:22515300-22515322 TACTATGGGAAGCCATGGAAGGG + Intergenic
1071747708 10:88440683-88440705 GTCAATGTGAAGCAAGAGAAAGG + Intronic
1072034093 10:91548735-91548757 TTCCATGTGTAGATATGGAAAGG - Intergenic
1074956247 10:118392939-118392961 TCCTAAGTGGAGCCAGGGAAGGG - Intergenic
1075121921 10:119670411-119670433 TTCTTTTTGTAGCTAAGGAACGG + Intronic
1075281545 10:121143227-121143249 TTCAAGGTGAAGTTTGGGAAGGG + Intergenic
1078804953 11:14689533-14689555 TCATAGGTGAAGCTTGGGAATGG + Intronic
1080452940 11:32393692-32393714 TTCGATGTGGAGATAGGGATGGG - Intronic
1080620454 11:33982787-33982809 TTCTTTGTGAAGCAAGGAATAGG - Intergenic
1081138167 11:39465398-39465420 TTCTCAGTCAAGCAAGGGAAAGG + Intergenic
1081191343 11:40105614-40105636 TTCCAGGTGAAGATTGGGAAAGG - Intergenic
1081493490 11:43583968-43583990 TTATCTGTGGAGCTAGGGAAGGG + Intronic
1082186549 11:49188985-49189007 TTCAATGTTAAGATAGTGAATGG - Intronic
1082641498 11:55666565-55666587 GACAATGGGAAGCTAGGGAAGGG - Intergenic
1085985045 11:81776641-81776663 TTCGTGGTGATGCTAGGGAATGG - Intergenic
1086106612 11:83154448-83154470 TACTCTGTGAACCAAGGGAAGGG + Intergenic
1086769845 11:90748244-90748266 TCCTTTGAGAAGTTAGGGAAAGG + Intergenic
1087032937 11:93724462-93724484 TTCCATGTGATTCTAGGTAAGGG - Intronic
1088548970 11:110991207-110991229 ATCTTTGAGAGGCTAGGGAAGGG - Intergenic
1090122587 11:124048035-124048057 TTCTAAGTGACACTCGGGAATGG - Intergenic
1090659643 11:128872465-128872487 TTCTCTCTGAAGGTAGGTAAGGG - Intergenic
1092798648 12:12140550-12140572 TTCAATGAGAAGGAAGGGAAGGG + Intronic
1092933790 12:13341260-13341282 TGCTATGTGAAGCTTGAAAAGGG - Intergenic
1095846287 12:46748672-46748694 TTCTATGTGATGTAAGGGAAAGG - Intergenic
1099509017 12:83510654-83510676 TTCTATCTGAGGCTAAGTAAAGG - Intergenic
1099558645 12:84145202-84145224 CTCTATGTACAGCTAGGAAATGG + Intergenic
1100172425 12:91990712-91990734 TTTTTTCTGAAGCAAGGGAAAGG - Intronic
1100174073 12:92009604-92009626 TTCTATTTAAAGCAAAGGAATGG - Intronic
1101085824 12:101234814-101234836 ATGTGTGTGAAGGTAGGGAAAGG - Intergenic
1109103827 13:58223007-58223029 GTATATGTGAAGCTGGGGAAAGG - Intergenic
1116801500 14:49449165-49449187 TTCTAAGGGAACTTAGGGAATGG - Intergenic
1117307131 14:54488397-54488419 CTCTGTAGGAAGCTAGGGAAAGG + Intronic
1118122562 14:62861589-62861611 TCCTATGTTAAGTTAGGAAAAGG + Intronic
1119004283 14:70909054-70909076 TTCTTTGTGGAGCTAGAGACAGG + Intronic
1124662595 15:31562456-31562478 TTCTATGGGAAGGCAGGGCAGGG - Intronic
1126807156 15:52362509-52362531 TTATATCTGGAGCTAGGAAAAGG + Intronic
1131032708 15:89199870-89199892 TTGTAGTTGAAGCTAAGGAAGGG + Exonic
1131192375 15:90326777-90326799 TACTTTGGGAAGCTAAGGAAGGG - Intergenic
1132230219 15:100176483-100176505 TTCTCTGTATAGCTATGGAAAGG + Intronic
1137791989 16:51182907-51182929 TTCTAAGTGACATTAGGGAATGG + Intergenic
1137882175 16:52061375-52061397 TTCTATGTGCACATAGAGAATGG + Intronic
1139256470 16:65547653-65547675 TTCTATGACAACCCAGGGAAAGG + Intergenic
1139326125 16:66153909-66153931 TTGTGTGTGAGGCTGGGGAAGGG - Intergenic
1140222617 16:73055018-73055040 TTCTGTGTGAAGCCAGCAAAGGG + Intronic
1140311916 16:73857736-73857758 TTCTATGTGATGTCAGGAAAAGG + Intergenic
1141643664 16:85356145-85356167 TTCCATGTAGAGCTAGGGACAGG + Intergenic
1142947093 17:3439046-3439068 ATCTATGTGAAGCTGGTCAAAGG - Intergenic
1143542377 17:7577268-7577290 TTTTAGGTGTGGCTAGGGAAGGG + Intronic
1148794486 17:50190484-50190506 TGCTGTGTGAAGGGAGGGAAGGG + Intronic
1149563279 17:57624737-57624759 TTCTGGGGGAAGCAAGGGAAAGG + Intronic
1151135359 17:71941439-71941461 TTCTTTGTGTAGATAGAGAAAGG + Intergenic
1151850162 17:76685231-76685253 TTCTTTTTAAACCTAGGGAAAGG - Intronic
1153936487 18:9929698-9929720 TTCTATTTTAAACTAGGAAAGGG + Intronic
1153973620 18:10247778-10247800 GTCTGTGTGAAGACAGGGAAAGG + Intergenic
1156190770 18:34717777-34717799 TTCAATAGGAAGCTGGGGAAAGG + Intronic
1157950456 18:52030853-52030875 TACTATGGGAATATAGGGAAAGG + Intergenic
1158175466 18:54651134-54651156 TTCTTGGTTAAGCTAGGGAAAGG - Intergenic
1159891827 18:73960190-73960212 TTTTATGTGGACCTTGGGAATGG - Intergenic
1160049742 18:75421667-75421689 TTCCATGTGTAGCTTGGGGAAGG + Intronic
1168577964 19:57528699-57528721 CTCTATGTGGAGCCAGAGAAAGG + Intronic
925141733 2:1555217-1555239 TTCTCTTTGCAGCGAGGGAAGGG + Intergenic
925308072 2:2864227-2864249 TGCTATTCGGAGCTAGGGAAAGG - Intergenic
925768816 2:7262782-7262804 TGCTGTGTGAAGCTGGGGAGAGG + Intergenic
928349520 2:30536371-30536393 TTCTATGAACAGCTAGAGAAAGG + Intronic
928682583 2:33717521-33717543 TACAATGTGAAGATAGGGAGGGG + Intergenic
933228709 2:79780685-79780707 TCCTATGTGAAGTAAGAGAAAGG - Intronic
933400247 2:81787221-81787243 CTCTATGTTAAGATAGAGAAAGG - Intergenic
933635549 2:84704856-84704878 TTCTGTGTAAAACTAGGCAAAGG + Intronic
933868789 2:86547947-86547969 TTATATGCGAAACTAGGCAAAGG + Intronic
935434711 2:103017089-103017111 TTCCACGTGAAGCCAGGGACAGG + Intergenic
938133108 2:128734039-128734061 TACTATGTTAAGCTATGGAAGGG - Intergenic
938161270 2:128986702-128986724 TTCTCTCTCAAGGTAGGGAAAGG - Intergenic
939793011 2:146603534-146603556 TCCTATGCAAAGCTAGGCAATGG - Intergenic
941903377 2:170698361-170698383 TTATATGTGAAGTTTGAGAAGGG - Intergenic
947679547 2:232017565-232017587 TCCTATGTGAAACAAGAGAAGGG - Intronic
947778510 2:232734928-232734950 TTCTATGTTAATCTGGGGTAAGG - Intronic
948748074 2:240110121-240110143 TTCCATGTGCACCTGGGGAAGGG - Intergenic
1169915567 20:10679284-10679306 TTCTTTGTGAAGCTAGAGTGTGG + Intergenic
1170170038 20:13400052-13400074 AGAGATGTGAAGCTAGGGAAGGG - Intronic
1173226582 20:41165678-41165700 TTCCATGGGAAGCTAGGGGCAGG + Exonic
1174446361 20:50593818-50593840 TTCTCTGTGGAGCAAGTGAAAGG - Intronic
1180613419 22:17112078-17112100 ATTTATTGGAAGCTAGGGAAAGG - Exonic
1182711197 22:32324517-32324539 TTCTAGGTGGAGATAGGGGAGGG - Intergenic
1183233220 22:36596179-36596201 TTTTAAGTGAAGCAAAGGAAGGG + Intronic
1183964825 22:41435372-41435394 TTATATGTGAGGCTGGGGAATGG - Exonic
1184398723 22:44261320-44261342 TTCTAGGTGGAGATAGGGGAGGG - Intronic
1184866238 22:47203149-47203171 TTATTTGGGAAGCTGGGGAATGG + Intergenic
1185347922 22:50318642-50318664 TTCTACGTGAATCTGGGGACCGG + Intronic
951646971 3:24903296-24903318 TTCTATGTGAAGTAGAGGAAGGG + Intergenic
954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG + Intronic
955084360 3:55688332-55688354 TTCTTTGTGCAGATATGGAAAGG + Intronic
955119802 3:56046533-56046555 TTCTAAGTGAAGATAGGCTATGG - Intronic
955383833 3:58462922-58462944 TTCTAGGAGCAGCCAGGGAAGGG + Intergenic
955893609 3:63675804-63675826 TTCCAGGTGAAGGTAGGGAGTGG + Intronic
958900512 3:99880578-99880600 GTCCATGTGATGCTAGGGAATGG + Intronic
960210435 3:114958534-114958556 TATTATTTCAAGCTAGGGAAAGG - Intronic
964041429 3:152267024-152267046 TTCTGTGAGAAGCGAGGGTAGGG - Intronic
964788647 3:160428975-160428997 TCCAATGTGAAGGCAGGGAAAGG - Intronic
965014783 3:163142975-163142997 TTCTGTCATAAGCTAGGGAATGG - Intergenic
965143789 3:164871373-164871395 CTGTATTTGAAGATAGGGAAAGG - Intergenic
965328802 3:167343460-167343482 TTCTAAGAAAAGCTAGGGAAGGG - Intronic
967198392 3:187049431-187049453 TTCTATGAGATCCAAGGGAAGGG + Intronic
967779509 3:193419904-193419926 TACTCTGTGAAGCTGGGGTACGG - Intronic
968744243 4:2351326-2351348 TTCTGTGGGAATCTAGGTAATGG - Intronic
970234291 4:13943306-13943328 TTTTATGTGTAGTTGGGGAAAGG + Intergenic
970554981 4:17222168-17222190 CTCCATGTACAGCTAGGGAAGGG - Intergenic
973232815 4:47861687-47861709 TTATAAGTGAAACTAGGGCATGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
985351520 4:189068118-189068140 TTCTTTGGGAAGCTATGGGAAGG + Intergenic
987067504 5:14303831-14303853 TTCTCTGTGAATCTTAGGAAAGG - Intronic
989091721 5:37740855-37740877 TTCTTTGCCAAGCTAGGGGAGGG + Intronic
991343255 5:65635387-65635409 CTCTATTTGCACCTAGGGAAAGG + Intronic
991682408 5:69152176-69152198 TTCTAAGTGAAGTAAGAGAATGG - Intergenic
993039614 5:82798542-82798564 TTCTCTGAGAAGGAAGGGAATGG + Intergenic
995695470 5:114874201-114874223 ATCTATGTGAAGCTATTGTAGGG + Intergenic
997297912 5:132779696-132779718 ATCTTTGTGAAGTTAGGGAAGGG - Intronic
998176086 5:139903058-139903080 TTCTGTGTAATGATAGGGAAGGG - Intronic
999994070 5:157075222-157075244 TTCAATGGCAAGCTATGGAAAGG + Intergenic
1000839114 5:166194541-166194563 ATCTATGTGAAGCTGAGAAAAGG + Intergenic
1002280423 5:178126722-178126744 TTTTATGAGATGCTAGGGAAAGG - Intergenic
1005330270 6:24742887-24742909 TTGAATGTGAAGTAAGGGAATGG + Intergenic
1006259351 6:32854810-32854832 TCCTGGGTCAAGCTAGGGAAGGG - Intronic
1010135267 6:72543969-72543991 TTCTCTGTAAAACTAGGAAAAGG - Intergenic
1012634632 6:101522522-101522544 TTCTCTGTGCAGCTATTGAAGGG - Intronic
1013460762 6:110372887-110372909 TTCTATGGGAAGCAAGGTACAGG - Intergenic
1022725315 7:32976031-32976053 ATGTATGTGAAGCTATGGAGAGG + Intronic
1023404576 7:39819363-39819385 CTCTTTTTGAAGCTGGGGAAAGG + Intergenic
1023565356 7:41518824-41518846 TTTTTGGTGAAGCTAGAGAAAGG - Intergenic
1025048295 7:55711809-55711831 ATGTATGTGAAGCTATGGAGAGG - Intergenic
1026361055 7:69600553-69600575 TTTTTGGTGAAGCTGGGGAAGGG + Intronic
1028100940 7:86819901-86819923 TTCTAGGTGAACCTAGGTATGGG + Intronic
1028129204 7:87150566-87150588 GTCAATGTGTACCTAGGGAATGG - Intergenic
1028712122 7:93921630-93921652 TTGTTTGTGAAGCTAGGAAAAGG - Intergenic
1029001480 7:97159523-97159545 TTCTAAGTCAAGCAAGAGAAAGG + Intronic
1031030826 7:116732988-116733010 TTCAATGTGAAGCAATAGAAGGG - Intronic
1031161381 7:118172746-118172768 TTTTATGTGAAGCAAAGGACAGG - Intergenic
1032444001 7:131964877-131964899 AACTATGTGAAACTAGAGAAAGG + Intergenic
1034884969 7:154792395-154792417 TTCTATGTAAAGCAAGGGCTAGG + Intronic
1035973370 8:4278048-4278070 TTGTATTTAAAGTTAGGGAAAGG - Intronic
1037643880 8:20772842-20772864 TTATATGTGAAGGTAGGGGGAGG + Intergenic
1040687634 8:49894406-49894428 TTCTAAGTGAAGCTCAGGAATGG - Intergenic
1044344623 8:91090984-91091006 TTCTTTGTGGAGCTTAGGAAAGG - Intergenic
1050471727 9:5999685-5999707 TACTGTGTGTAGCTAGGGAATGG - Intronic
1052125499 9:24769751-24769773 TTCTATCTGAAGATGGGGAGAGG + Intergenic
1052881355 9:33602643-33602665 TTCTTTCTGAAGCCAGGGAAGGG - Intergenic
1053412223 9:37923203-37923225 TTCCATGTGAAGCCAGGCAGAGG + Intronic
1053916807 9:42949925-42949947 TTCTTTCTGAAGCCAGGGAGGGG - Intergenic
1055381785 9:75715253-75715275 TTCCATGGGCAGCTAGGTAAGGG + Intergenic
1057535333 9:95897203-95897225 TGCTCTGTGAAGTTAGGCAAGGG - Intronic
1057956774 9:99415981-99416003 TTCTATGTTCAGTTAGTGAAAGG - Intergenic
1059029245 9:110672437-110672459 TGCTATGTGAACATAGGGTAGGG + Intronic
1059601877 9:115787620-115787642 TTCTTTGTGACTCTAGAGAATGG + Intergenic
1187239602 X:17500621-17500643 TTCTATGTGAAGCTAGGGAAAGG + Intronic
1187685730 X:21813943-21813965 TTCTTTGTGATGCTGGGGATGGG - Intergenic
1189332598 X:40152824-40152846 TTCTTTTTGAATCTCGGGAAAGG + Intronic
1190699740 X:52978828-52978850 TCCTTTGTGAAGGTATGGAAGGG - Intronic
1193732806 X:85121711-85121733 TTCTATGTGGGGGTGGGGAATGG + Intergenic
1195762136 X:108257947-108257969 TTCTATATGAAAATAGGGAAGGG + Intronic
1195867753 X:109451652-109451674 TGATATGTGATGATAGGGAATGG - Intronic
1196763866 X:119225463-119225485 GTTTATGTGCAGCTAGGGAATGG + Intergenic
1198261053 X:134965194-134965216 TGCTCCTTGAAGCTAGGGAATGG - Intergenic
1199565462 X:149211158-149211180 TTCTGTGTTTAGTTAGGGAAGGG - Intergenic