ID: 1187244371

View in Genome Browser
Species Human (GRCh38)
Location X:17540650-17540672
Sequence CAAGTTCTTCAGAGGGTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 494}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187244371_1187244377 13 Left 1187244371 X:17540650-17540672 CCGTCAACCCTCTGAAGAACTTG 0: 1
1: 0
2: 1
3: 29
4: 494
Right 1187244377 X:17540686-17540708 CACTTATCTGAACTCTGGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1187244371_1187244376 8 Left 1187244371 X:17540650-17540672 CCGTCAACCCTCTGAAGAACTTG 0: 1
1: 0
2: 1
3: 29
4: 494
Right 1187244376 X:17540681-17540703 AATTTCACTTATCTGAACTCTGG 0: 1
1: 0
2: 0
3: 22
4: 245
1187244371_1187244378 14 Left 1187244371 X:17540650-17540672 CCGTCAACCCTCTGAAGAACTTG 0: 1
1: 0
2: 1
3: 29
4: 494
Right 1187244378 X:17540687-17540709 ACTTATCTGAACTCTGGTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187244371 Original CRISPR CAAGTTCTTCAGAGGGTTGA CGG (reversed) Intronic
900662623 1:3792749-3792771 CAAGTTCTTAAAAGTGTTGTGGG - Intronic
903162261 1:21497584-21497606 CAACTTCCACAGAGGGTTGTTGG - Intergenic
903566701 1:24272841-24272863 CAGTTTCTTCATAGTGTTGATGG + Intergenic
904816997 1:33211315-33211337 CAGTTTCTTCATAGCGTTGATGG + Intergenic
905460074 1:38116872-38116894 CATCTAATTCAGAGGGTTGATGG - Intergenic
906253051 1:44326128-44326150 AATTTTCTTCCGAGGGTTGAAGG - Intronic
906739751 1:48171393-48171415 CAGTTTCTTCATAGTGTTGATGG + Intergenic
908584410 1:65552794-65552816 CAGTTTCTTCATAGTGTTGATGG + Intronic
908601208 1:65742281-65742303 CAATTTTTTCATAGTGTTGATGG + Intergenic
909915327 1:81310945-81310967 CACGTTCTTCAAATGGTTGTAGG - Intronic
910605056 1:89073911-89073933 CAGTTTCTTCATAGTGTTGATGG - Intergenic
910925182 1:92390457-92390479 CAGTTTCTTCATAGTGTTGATGG - Exonic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912235549 1:107846361-107846383 CAGTTTCTTCACAGTGTTGATGG - Intronic
912894660 1:113574272-113574294 CAGTTTCTTCATAGGGTTGTTGG + Intronic
912966943 1:114243851-114243873 CAGTTTCTTCATAGTGTTGATGG - Intergenic
913036078 1:114967760-114967782 CAGTTTCTTCATAGTGTTGATGG + Intronic
913141657 1:115947163-115947185 CAAGATCTTCAGAGATTTGAAGG + Intergenic
913702623 1:121387187-121387209 CAAGTTCATCAGTTTGTTGAAGG + Intronic
914043186 1:144067682-144067704 CAAGTTCATCAGTTTGTTGAAGG + Intergenic
914134900 1:144892806-144892828 CAAGTTCATCAGTTTGTTGAAGG - Intronic
915876737 1:159618437-159618459 CAGTTTCTTCATAGTGTTGATGG - Intergenic
915975890 1:160388678-160388700 CAGTTTCTTCATAGCGTTGATGG + Intergenic
916144826 1:161728870-161728892 CTAGCTCTGCAGAGGATTGATGG - Intergenic
916612608 1:166408013-166408035 CAGTTTCTTCATAGTGTTGATGG + Intergenic
917285281 1:173416395-173416417 CAAGCACTACAGAGGGATGACGG + Intergenic
917464150 1:175260314-175260336 CAGTTTCTTCACAGCGTTGATGG + Intergenic
917502182 1:175595582-175595604 CCAGTACTTCTGAGGGTTGCAGG - Intronic
918088825 1:181269948-181269970 CAGTTTCTTCATAGCGTTGATGG + Intergenic
918353550 1:183683248-183683270 CAGTTTCTTCATAGTGTTGATGG + Intronic
918877723 1:190071043-190071065 CACGTTCTTCACAGGGTGGCAGG + Intergenic
919602114 1:199634911-199634933 CAGTTTCTTCATAGTGTTGATGG - Intergenic
919625646 1:199907605-199907627 GAGGATCTTCAGAGAGTTGAAGG + Intergenic
920428893 1:205901544-205901566 CAGTTTCTTCATAGCGTTGATGG - Intergenic
920490052 1:206405930-206405952 CAAGTTCATCAGTTTGTTGAAGG + Intronic
921514629 1:216074909-216074931 AGAGTTCTTCAGAGGGATGGTGG + Intronic
922556753 1:226538449-226538471 CCAGTTCCTCAGAGGGTTTTGGG - Intergenic
923061026 1:230474709-230474731 CAGTTTCTTCATAGTGTTGATGG + Intergenic
924296246 1:242589013-242589035 CAATTTCTTCATAGTGTCGATGG - Intergenic
924398634 1:243652511-243652533 CAGTTTCTTCATAGTGTTGATGG - Intronic
1063243848 10:4198190-4198212 ATACTTCTTCATAGGGTTGAGGG + Intergenic
1063656143 10:7990997-7991019 GAAGGTCTTAAAAGGGTTGAAGG - Intronic
1064913276 10:20427127-20427149 CAAGTACTTCATTGGGGTGACGG + Intergenic
1066257438 10:33694376-33694398 CAATTTCTTCATAATGTTGATGG + Intergenic
1066701994 10:38139741-38139763 CAATATTTTCAGAGGCTTGAAGG - Intergenic
1067332107 10:45332098-45332120 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1068085877 10:52373309-52373331 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1069139718 10:64808524-64808546 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1071272622 10:84021969-84021991 CAGTTTCTTCATAGCGTTGATGG - Intergenic
1071844538 10:89507641-89507663 CAGTTTCTTCATAGTGTTGATGG - Intronic
1073300344 10:102467540-102467562 CATTTTCTTCAGGGGGTTCAAGG + Intronic
1073757053 10:106592094-106592116 CATGTTATCCAGAAGGTTGAGGG - Intronic
1073884380 10:108021160-108021182 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1075924449 10:126239452-126239474 CAAGTACTCCAGAAAGTTGAGGG - Intronic
1076123467 10:127954690-127954712 AAGGTTCTTCAGAAGGTTGTAGG + Intronic
1077561837 11:3268490-3268512 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1077567731 11:3314310-3314332 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1077967247 11:7148084-7148106 CAGTTTCTTCATAGTGTTGACGG + Intergenic
1079466402 11:20735183-20735205 CAAATGCTGCTGAGGGTTGACGG + Intronic
1080581575 11:33648683-33648705 CAATTTCTTCACAGAGTTAACGG - Intronic
1080846794 11:36033792-36033814 CATGTTCTTCTCAGGGTTGTTGG + Intronic
1081119594 11:39249193-39249215 CAATTTCTTCAGAGAATTAAGGG + Intergenic
1084303751 11:68267960-68267982 CAAGATCATCAGAGGGTCAAGGG - Intronic
1084763007 11:71285911-71285933 CAAGTTCTGGAGATGGATGATGG - Intergenic
1084967296 11:72751448-72751470 CAAGATCATCACAGGGTAGAAGG - Intronic
1086825559 11:91490577-91490599 CAATTCCTTCAGAGGGTTTGTGG + Intergenic
1086906929 11:92429458-92429480 CAGTTTCTTCATAGTGTTGATGG + Intronic
1087570956 11:99927613-99927635 CAAGTTCTCCAGAGATCTGAAGG - Intronic
1087596340 11:100258858-100258880 CAGCTTCTTCATAGTGTTGATGG - Intronic
1087868471 11:103262764-103262786 CAGTTTCTTCATAGTGTTGATGG - Intronic
1087947870 11:104186214-104186236 CAAGATCTTCAGAAGTTTAAGGG + Intergenic
1088151954 11:106756426-106756448 CAGTTTCTTCATAGTGTTGATGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089765816 11:120764522-120764544 CAGTTTCTTCATAGTGTTGATGG + Intronic
1090591165 11:128270908-128270930 CAATTTCTTCAGAATTTTGAAGG - Intergenic
1090645814 11:128765692-128765714 CAAGTGCTGCAGAAGTTTGAAGG - Intronic
1090895904 11:130975166-130975188 CAATTTCTTCATAGTGCTGATGG + Intergenic
1091362872 11:134992048-134992070 CAGGTTATTCTGAGGCTTGATGG - Intergenic
1092398705 12:8152831-8152853 CAGTTTCTTCATAGTGTTGATGG + Intronic
1093248748 12:16773122-16773144 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1093595446 12:20953165-20953187 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1093597512 12:20979817-20979839 CAATTTCTTCATAGCATTGATGG + Intergenic
1093902595 12:24653164-24653186 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1095488715 12:42710210-42710232 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1096180628 12:49548721-49548743 CAGACTCTTCTGAGGGTTGAGGG + Intronic
1097517370 12:60621804-60621826 CAATTTCTTCATAGTGTTGATGG - Intergenic
1097948606 12:65401688-65401710 CAGTTTCTTCATAGCGTTGATGG + Intronic
1098151646 12:67553778-67553800 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1099010756 12:77288258-77288280 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1099071611 12:78051268-78051290 GAGGTTATTCAGAGTGTTGAAGG + Intronic
1099492268 12:83301806-83301828 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1099697271 12:86038810-86038832 CAGTTTCTTCATAGTGTTGATGG + Intronic
1099897742 12:88669517-88669539 CAATTTCTTCATAGTGTTGATGG - Intergenic
1100208439 12:92376392-92376414 CAAGTTCTGGAGAGGCTTCAGGG - Intergenic
1100665925 12:96753009-96753031 TAAGTCCTTCAGAGGGTGGCTGG + Intronic
1100768521 12:97896371-97896393 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1101245855 12:102883918-102883940 TACGTCCTTCAGAGGGTTGATGG + Intronic
1101296352 12:103427021-103427043 CAGTTTCTTCAGAGTGTTGATGG - Intronic
1101472452 12:105011568-105011590 CAGTTTCTTCATAGTGTTGATGG + Intronic
1101742837 12:107514316-107514338 CAAATTCTCCAAAGGGTTTATGG - Intronic
1102645391 12:114400454-114400476 CATGTTCCTCAGAAGGTGGAGGG - Intronic
1103198577 12:119067975-119067997 CAAGTTCTTCAAATGGTTGGTGG + Intronic
1103744357 12:123111921-123111943 AAAGCTGTTGAGAGGGTTGAGGG + Intronic
1104590109 12:130077576-130077598 TGAGTTCTTAAGAGAGTTGATGG - Intergenic
1105061089 12:133151701-133151723 CCAGTCCTGCAGAGGGTTGGTGG + Intronic
1105645583 13:22314518-22314540 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1106213153 13:27669493-27669515 CATCTTCTTCATAGGGTTGTGGG - Intergenic
1106807732 13:33328235-33328257 CAATATGTTCAGAGGTTTGAGGG + Intronic
1106980404 13:35272418-35272440 CAGTTTCTTCATAGCGTTGAGGG - Intronic
1108029863 13:46218680-46218702 CAGTTTCTTCATAGTGTTGATGG + Intronic
1108384066 13:49881775-49881797 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1108673816 13:52719405-52719427 CAGTTTCTTCATAGTGTTGATGG + Intronic
1108927854 13:55775646-55775668 CAAGTTTTTCATAGGGTACATGG - Intergenic
1109675734 13:65673886-65673908 CAGTTTCTTCATAGTGTTGAAGG + Intergenic
1112546375 13:100375706-100375728 CAGTTTCTTCATAGTGTTGATGG - Intronic
1113079807 13:106506806-106506828 CACCTGCTTCACAGGGTTGATGG - Intronic
1115690793 14:35842255-35842277 CAGTTTCTTCATAGCGTTGATGG + Intronic
1115728825 14:36245858-36245880 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1115856049 14:37631189-37631211 CAGTTTCTTCATAGTGTTGATGG + Intronic
1116212542 14:41966889-41966911 CAGTTTCTTCATAGCGTTGACGG + Intergenic
1116540777 14:46099471-46099493 CAGTTTCTTCCTAGGGTTGATGG + Intergenic
1116771246 14:49129850-49129872 CAATTTCTTCATAGTGTCGATGG + Intergenic
1116792923 14:49358641-49358663 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1116793933 14:49368990-49369012 CAAGATCTTAAGAGTGTTTAAGG + Intergenic
1117121292 14:52570409-52570431 CAGTTTCTTCATAGGGTCGATGG - Intronic
1117238187 14:53800234-53800256 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1117299027 14:54405916-54405938 CAGTTTCTTCATAGCGTTGATGG + Intronic
1117485689 14:56194662-56194684 CAAGCTTTTCAGCGGGGTGAAGG - Intronic
1117502146 14:56363662-56363684 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG + Intergenic
1117655671 14:57953345-57953367 CAGTTTCTTCATTGGGTTGATGG - Intronic
1117900443 14:60527330-60527352 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1117930326 14:60835325-60835347 CAGTTTCTTCATAGTGTTGATGG + Intronic
1119427915 14:74547755-74547777 CATGCCCCTCAGAGGGTTGATGG + Intronic
1122424841 14:101599836-101599858 CAGGTTTTTCTGAGGATTGAAGG - Intergenic
1122608795 14:102966826-102966848 CAAGTCCTTCAGTGGGTTGGTGG + Intronic
1123429030 15:20198907-20198929 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1124084417 15:26533418-26533440 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1124666944 15:31600523-31600545 CAGTTTCTTCATAGTGTTGATGG - Intronic
1125219728 15:37319166-37319188 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1126051044 15:44685160-44685182 CAGTTTCTTCATAGTGTTGATGG - Intronic
1126470544 15:49005831-49005853 CAGTTTCTTCATAGTGTTGACGG + Intronic
1127580238 15:60331826-60331848 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1128027686 15:64452124-64452146 CAAATTTTTCTGGGGGTTGAGGG + Intronic
1129206402 15:74039446-74039468 AAAGTTCTTCAGGAGCTTGAGGG + Intronic
1129563432 15:76594890-76594912 CAATTTCTTCGTAGTGTTGATGG - Intronic
1132159812 15:99529714-99529736 CAACTTCTTCACAGGGTGGCAGG - Intergenic
1133523017 16:6577083-6577105 CATGTTCATCAGAGGATTGGGGG - Intronic
1136855292 16:33650825-33650847 CAGTTTCTTCATAGCGTTGATGG - Intergenic
1137419775 16:48322493-48322515 CAGGTCCTTCAGAAGGTAGAAGG - Intronic
1138360890 16:56425858-56425880 TAACCTCTTCAGAGGGTTAATGG - Intergenic
1138838514 16:60468806-60468828 TAAGGTCTTCAGCGGATTGATGG + Intergenic
1139871385 16:70111372-70111394 CAAGAACTTCAGAGGGAGGAGGG + Intergenic
1140364550 16:74371117-74371139 CAAGAACTTCAGAGGGAGGAGGG - Intergenic
1140582160 16:76243793-76243815 CAAAATTTTCAGATGGTTGAAGG - Intergenic
1140883615 16:79222400-79222422 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1141275368 16:82583012-82583034 CAAGCTTTTCAGAGTGTTCAAGG + Intergenic
1142332063 16:89461333-89461355 CAAGTTCTGGAGAGGGATGGTGG + Intronic
1203116877 16_KI270728v1_random:1499306-1499328 CAGTTTCTTCATAGCGTTGATGG - Intergenic
1143104792 17:4523808-4523830 CAAGTGCTACAGAGGGTGGGAGG - Intronic
1143384611 17:6521039-6521061 CAAGTTCTGGAGATGGTTGGTGG + Intronic
1143426924 17:6847267-6847289 CAATTTCTTCATAGTGTCGATGG + Intergenic
1145861425 17:28213639-28213661 CAGTTTCTTCATAGCGTTGATGG - Intergenic
1146746112 17:35332011-35332033 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1148967611 17:51449056-51449078 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1149351989 17:55799652-55799674 CAGTTTCTTCATAGTGTTGATGG + Intronic
1149798259 17:59541528-59541550 CAAGTTCTTCTCATGGTTAAGGG + Intergenic
1150702107 17:67456925-67456947 TACTATCTTCAGAGGGTTGAGGG - Intronic
1150884827 17:69072661-69072683 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1151046341 17:70923915-70923937 CAAATCCCTCAGTGGGTTGAGGG - Intergenic
1153064730 18:1033393-1033415 CAGTTTCTTTATAGGGTTGATGG + Intergenic
1153338679 18:3951737-3951759 CAAGTTCTTAAGAGATCTGATGG + Intronic
1153702845 18:7713432-7713454 CAGTTTCTTCATAGTGTTGATGG - Intronic
1153743069 18:8149726-8149748 TAATTTCTTCATAGTGTTGATGG + Intronic
1153798675 18:8648785-8648807 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1154040105 18:10846584-10846606 CCAGTTCTTCAGAGCCATGATGG - Intronic
1154488961 18:14904297-14904319 CAGGTTATTCTGAGGCTTGATGG + Intergenic
1155004405 18:21715079-21715101 CACTTTCTCCAGAGGGTTCATGG - Intronic
1155385148 18:25268842-25268864 CAATTTCTTCATAGTGTTGATGG - Intronic
1155403719 18:25465371-25465393 GAAGTCCTTCAGAGGGTGGCAGG - Intergenic
1155723776 18:29052962-29052984 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1156140778 18:34108001-34108023 GAAGTTCTCCACATGGTTGAAGG + Intronic
1156414924 18:36878085-36878107 CAGTTTCTTCATAGTGTTGATGG + Intronic
1156626671 18:38918348-38918370 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1157217550 18:45798144-45798166 CAATTTCTTCCTAGGCTTGACGG + Intergenic
1158297464 18:56014631-56014653 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1159014520 18:63090189-63090211 GAAGTTCTTTGGAGGGTGGAAGG + Intergenic
1159058340 18:63489601-63489623 CAAGTTGTTTACAGGCTTGAAGG - Intronic
1159661027 18:71096205-71096227 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1160573942 18:79838090-79838112 CAAGTTCTCCTGAGATTTGATGG - Intergenic
1161111970 19:2475720-2475742 CAAGTTCTGCTGGGGGTGGAGGG - Intergenic
1164197213 19:22979922-22979944 CAGTTTCTTCATAGTGTTGATGG - Intronic
1165764737 19:38343573-38343595 CCAGGTCCTCAGAGGGCTGAGGG - Exonic
1166082399 19:40452188-40452210 CAAGGACGTCAGAGGGCTGATGG - Intronic
1166731551 19:45061913-45061935 CAAGTTCCTCAGAGTCATGATGG + Intronic
1167660093 19:50791302-50791324 CATGTTCTTCAGAGGTTAGGAGG - Intronic
924967956 2:95371-95393 CAGTTTCTTCACAGTGTTGACGG - Intergenic
926970427 2:18462292-18462314 CACTTTCTTCATAGGGATGATGG + Intergenic
927221413 2:20713449-20713471 CAGTTTCTTCATAGGATTGATGG - Intronic
927336589 2:21931689-21931711 CAATTTCTTCATAGCGTCGATGG + Intergenic
927818536 2:26242692-26242714 CAAGGTCATCAGAGGGTAAAAGG + Intronic
928462841 2:31491148-31491170 CAGTTTCTTCATAGCGTTGATGG - Intergenic
928750875 2:34468571-34468593 CAGTTTCTTCATAGTGTTGATGG - Intergenic
929255916 2:39811768-39811790 CAGTTTCTTCATAGTGTTGATGG + Intergenic
930264513 2:49184577-49184599 CAGTTTCTTCATAGTGTTGATGG + Intergenic
930440104 2:51393554-51393576 CAGTTTCTTCATAGGGTTGATGG - Intergenic
931030591 2:58170449-58170471 CAGTTTCTTCATAGTGTTGATGG - Intronic
931223057 2:60305765-60305787 CAAGTTTTTCAGAGGGGAGATGG + Intergenic
931306792 2:61036688-61036710 CAGTTTCTTCATAGCGTTGATGG - Intronic
931376897 2:61715972-61715994 CAACCTCTGCTGAGGGTTGAAGG - Intergenic
931566850 2:63623250-63623272 CAGTTTCTTCATAGCGTTGATGG - Intronic
932899723 2:75683507-75683529 CAGTTTCTTCATAGCGTTGATGG - Intronic
935010732 2:99133664-99133686 CAGTTTCTTCATAGTGTTGATGG + Intronic
935567742 2:104627780-104627802 CAGTTTCTTCATAGTGTTGACGG + Intergenic
936028132 2:109049490-109049512 GAGCTTCTTCAGAGGGGTGAGGG - Intergenic
936603766 2:113926645-113926667 TTAATTCTCCAGAGGGTTGAAGG - Intronic
936807960 2:116359929-116359951 CAGCTTCTTCATAGTGTTGATGG - Intergenic
936915552 2:117636099-117636121 CACATGCTTCAGAGGGTGGAAGG - Intergenic
936999750 2:118455366-118455388 GAGTTTCTTCATAGGGTTGATGG + Intergenic
937100505 2:119264631-119264653 CTGGTTCTGCAGAGGGTTGGGGG - Exonic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
938874204 2:135516345-135516367 AAATTTCTTCACAGTGTTGATGG + Intronic
939686932 2:145211905-145211927 CAGTTTCTTCAGAGTGTCGACGG + Intergenic
940758159 2:157706527-157706549 CAGTTTCTTCATAGTGTTGATGG - Intergenic
941559842 2:167031271-167031293 CAGTTTCTTCATAGTGTTGATGG + Intronic
941845520 2:170127971-170127993 CAGTTTCTTCACAGTGTTGATGG - Intergenic
942010656 2:171759584-171759606 CAGTTTCTTCATAGTGTTGATGG + Intergenic
942572691 2:177329768-177329790 CAACTTCTAGAGAGGGTAGAGGG - Intronic
943130174 2:183843940-183843962 CAGTTTCTTCATAGTGTTGATGG - Intergenic
943408558 2:187518219-187518241 CAGTTTCTTCAGAGTGTTGTTGG + Intronic
943598889 2:189890992-189891014 CAATTTCTTCATAGTGTCGATGG + Intronic
943891809 2:193296872-193296894 CAGTTTCTTCATAGTGTTGATGG - Intergenic
944018804 2:195075758-195075780 CAGTTTCTTCATAGCGTTGATGG - Intergenic
944270670 2:197782568-197782590 CAATTTCTAGAGAGGGTTTAAGG - Intronic
944455423 2:199888639-199888661 CAGTTTCTTCATAGTGTTGATGG - Intergenic
945845723 2:214942037-214942059 CAGTTTCTTCATAGTGTTGATGG + Intronic
946018715 2:216624693-216624715 CAAGTTCTTCTGAAGGATGAGGG - Intergenic
946682855 2:222235550-222235572 CAATTTTTTCAGAGGATTGTGGG + Intronic
947960015 2:234228607-234228629 CAGGTCCTTCAGAAGGTTGCTGG - Intergenic
1168924243 20:1566360-1566382 CAAAAGCTTCAGAGGATTGATGG - Intronic
1170056000 20:12202915-12202937 CTAATAATTCAGAGGGTTGAGGG + Intergenic
1170283272 20:14675617-14675639 CAGTTTCTTCATAGTGTTGATGG - Intronic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1173723518 20:45280533-45280555 CTAGAACTTCAGAGGGTTGGAGG - Intergenic
1175408662 20:58751952-58751974 AAACTTCTTCAAAGGGTCGAAGG - Intergenic
1176208844 20:63906986-63907008 CAACTACTTCGGAGGGTTGCAGG + Intronic
1176891993 21:14329214-14329236 CAATTTCTTCATAGTGTTGATGG - Intergenic
1177594495 21:23219067-23219089 TAAGGCCTTCAGAGGGTAGAGGG - Intergenic
1178613955 21:34113905-34113927 CAACCTCTTCACAGGGTAGAAGG - Intronic
1184012113 22:41757010-41757032 CAAGGTGTTCAGAGGCCTGAAGG - Intronic
1184397619 22:44253040-44253062 AAAGTTCTACAGAGGGATGATGG + Intronic
1184808905 22:46815514-46815536 TAAATTCTTCAGAGGATTGGTGG + Intronic
949440360 3:4073398-4073420 CAGTTTCTTCATAGAGTTGATGG - Intronic
949453524 3:4213475-4213497 CAGTTTCTTCATAGTGTTGATGG - Intronic
949580381 3:5382373-5382395 CAGTTTCTTCATAGTGTTGATGG + Intergenic
950992240 3:17451292-17451314 CAGTTTCTTCATAGTGTTGATGG - Intronic
951254278 3:20431191-20431213 CAGTTTCTTCACAGTGTTGATGG + Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952580675 3:34830063-34830085 CAAGTTCTGCTGATGGGTGATGG + Intergenic
952842382 3:37658764-37658786 CAGCTTCTTCATAGTGTTGATGG + Intronic
953099840 3:39813103-39813125 GAATCTCTTCAGAGGTTTGAAGG + Intronic
953225387 3:41014273-41014295 CAAGTCCTTCCCAGGGTTCAAGG - Intergenic
953316085 3:41927410-41927432 CAGTTTCTTCACAGTGTTGATGG - Intronic
954183360 3:48898753-48898775 CAGGTTCTTGAGCGGGCTGATGG + Exonic
954490398 3:50899555-50899577 CAGTTTCTTCATAGTGTTGATGG + Intronic
956279626 3:67542393-67542415 CAGTTTCTTCATAGTGTTGATGG - Intronic
956355932 3:68391922-68391944 CAGTTTCTTCATAGTGTTGATGG - Intronic
956382844 3:68684507-68684529 CAATTTCTTCATAGTGTTGATGG + Intergenic
956774990 3:72557570-72557592 CAAGTGCCTCATAGGGTAGAGGG - Intergenic
957908021 3:86582722-86582744 CAGTTTCTTCATAGTGTTGATGG - Intergenic
957993030 3:87651950-87651972 CAATTTCTTCATAGTGTAGATGG + Intergenic
959290503 3:104467899-104467921 CAGTTTCTTCATAGTGTTGATGG + Intergenic
959428464 3:106222474-106222496 CAGTTTCTTCATAGTGTTGATGG + Intergenic
959518117 3:107293132-107293154 AAAGTTCTTCAGTGGGTAAATGG - Intergenic
960770178 3:121185122-121185144 CAGTTTCTTCAGAGTGTCGATGG - Intronic
962239184 3:133736367-133736389 CAGTTTCTTCATAGTGTTGATGG - Intergenic
963629088 3:147711238-147711260 CAGTTTCTTCACAGTGTTGATGG + Intergenic
964566863 3:158066170-158066192 CAGTTTCTTCATAGTGTTGATGG - Intergenic
964648874 3:158989661-158989683 CAGTTTCTTCATAGTGTTGATGG + Intronic
965364748 3:167784606-167784628 CAACTTCTTCACAGGGTGGCAGG + Intronic
966291397 3:178363176-178363198 CAGTTTCTTCATAGTGTTGATGG - Intergenic
966753408 3:183344489-183344511 CAGTTTCTTCATAGTGTTGATGG - Intronic
968418218 4:459213-459235 CAGTTTCTTCATAGTGTTGATGG - Intronic
969884714 4:10205123-10205145 CCAGTTCTTCAGAGGCTTAAAGG + Intergenic
970055129 4:11963450-11963472 CAGTTTCTTCATAGTGTTGATGG + Intergenic
970655192 4:18223396-18223418 CAGTTTCTTCATAGTGTTGATGG + Intergenic
972962956 4:44475779-44475801 CAGTTTCTTCATAGTGTTGACGG - Intergenic
973883746 4:55299190-55299212 CAGTTTCTTCATAGTGTTGATGG - Intergenic
974023871 4:56714676-56714698 CAGTTTCTTCATAGTGTTGATGG - Intergenic
974326105 4:60417449-60417471 CAGTTTCTTCATAGTGTTGATGG + Intergenic
974453098 4:62092413-62092435 CAGTTTCTTCATAGTGTTGATGG + Intergenic
974793220 4:66715970-66715992 CAGTTTCTTCATAGTGTTGATGG - Intergenic
975246084 4:72121814-72121836 CAGTTTCTTCATAGCGTTGATGG - Intronic
975491108 4:74989657-74989679 AAACTTCTACAGAGGGTAGAAGG - Intronic
975524453 4:75333273-75333295 CAGTTTCTTCATAGTGTTGACGG - Intergenic
976560126 4:86491317-86491339 CAAGTGCATCACATGGTTGATGG + Intronic
976716147 4:88124226-88124248 CAGTTTCTTCATAGTGTTGATGG - Intronic
977047107 4:92081033-92081055 GAATTTCTTCATAGTGTTGATGG - Intergenic
977500460 4:97830437-97830459 CAGTTTCTTCATAGAGTTGATGG - Intronic
978269677 4:106874180-106874202 CAGTTTCTTCATAGTGTTGATGG + Intergenic
978278117 4:106976817-106976839 CAGTTTCTTCAAAGGGTCGATGG + Intronic
978664504 4:111166112-111166134 CAGTTTCTTCATAGTGTTGATGG - Intergenic
979421607 4:120511176-120511198 CAGTTTCTTCATAGCGTTGATGG - Intergenic
979457816 4:120946134-120946156 CAGTTTCTTCATAGTGTTGATGG - Intergenic
979461413 4:120988768-120988790 CAGTTTCTTCATAGTGTTGATGG + Intergenic
979581586 4:122366865-122366887 CAGTTTCTTCATAGCGTTGATGG - Intergenic
980260387 4:130440944-130440966 CAGTTTCTTCATAGTGTTGATGG + Intergenic
981629930 4:146806295-146806317 CAGTTTCTTCATAGTGTTGATGG - Intronic
981886261 4:149676543-149676565 CAATTTCTTCATTGGGTAGAGGG - Intergenic
982684462 4:158471508-158471530 CAAGTACTTCTGATGGTTCAGGG - Intronic
982725359 4:158900913-158900935 CAGTTTCTTCATAGTGTTGATGG + Intronic
982733631 4:158981769-158981791 CAGTTTCTTCATAGTGTTGATGG - Intronic
983179653 4:164632500-164632522 CAGTTTCTTCATAGTGTTGATGG - Intergenic
983514029 4:168638338-168638360 CCAGTTCTTCAGAGCCCTGAAGG - Intronic
983543515 4:168937374-168937396 CAGTTTCTTCATAGTGTTGATGG - Intronic
983754253 4:171314230-171314252 CAGTTTCTTCATAGTGTTGATGG + Intergenic
983849807 4:172567295-172567317 CAAGTCCCTCACAGAGTTGATGG + Intronic
983949240 4:173620649-173620671 CAGTTTCTTCATAGTGTTGACGG + Intergenic
985800450 5:2002380-2002402 CAGGTTCTCCAGAGGCTTTAGGG - Intergenic
987228967 5:15872338-15872360 CAGCTTCTTCATAGTGTTGATGG - Intronic
987687807 5:21227323-21227345 CAGTTTCTTCATAGTGTTGATGG - Intergenic
987923868 5:24316045-24316067 CAGTTTCTTCACAGTGTTGATGG + Intergenic
988719419 5:33861095-33861117 CAGTTTCTTCATAGTGTTGATGG - Intronic
989320497 5:40129157-40129179 CAGTTTCTTCATAGTGTTGATGG + Intergenic
989517000 5:42355233-42355255 CAATTTCTTCATAGTGTTGATGG - Intergenic
990083280 5:51943887-51943909 CATCTTCTTCAGAGGGATGCAGG - Intergenic
990163500 5:52969829-52969851 CAGTTTCTTCATAGTGTTGATGG + Intergenic
990745641 5:58957162-58957184 CAGTTTCTTCATAGTGTTGATGG + Intergenic
990838698 5:60050598-60050620 CAGTTTCTTCATAGTGTTGATGG - Intronic
991223785 5:64245152-64245174 CAGTTTCTTCATAGTGTTGATGG - Intronic
991576047 5:68104290-68104312 CAGTTTCTTCATAGTGTTGATGG - Intergenic
992061049 5:73048089-73048111 CCAGTTCTTCAGGAGGCTGAGGG - Intronic
992068133 5:73125832-73125854 CAAGATTTTCATAGGTTTGATGG - Intronic
992362786 5:76058345-76058367 CAAGTTTTTTCCAGGGTTGATGG - Intergenic
992976666 5:82128366-82128388 CAGTTTCTTCATAGTGTTGATGG + Intronic
993380644 5:87203270-87203292 CAGTTTCTTCATAGTGTTGACGG + Intergenic
993403909 5:87487689-87487711 CAGTTTCTTCATAGTGTTGATGG + Intergenic
993609222 5:90033578-90033600 CAGTTTCTTCATAGTGTTGATGG - Intergenic
993757425 5:91749289-91749311 CAGTTTCTTCATAGTGTTGACGG + Intergenic
995283061 5:110356998-110357020 CACGTTCTTCACAGGGTGGTAGG - Intronic
995413921 5:111888397-111888419 CAACTTCTTCACAGGGTGGCAGG + Intronic
995620824 5:114023312-114023334 CAGTTTCTTCATAGTGTTGATGG - Intergenic
996953090 5:129151551-129151573 CAATTTCTTCATAGCGTTGATGG + Intergenic
997217636 5:132127489-132127511 CAGTTTCTTCATAGTGTTGATGG + Intergenic
997220147 5:132155504-132155526 CAGTTTCTTCATAGTGTTGATGG + Intergenic
997902971 5:137785002-137785024 CAGTTTCTTCATAGTGTTGATGG - Intergenic
998237660 5:140413430-140413452 AAAGTTCTGGAGATGGTTGATGG - Intronic
998691405 5:144592825-144592847 CAGTTTCTTCATAGTGTTGATGG + Intergenic
998751887 5:145331848-145331870 CAGTTTCTTCATAGTGTTGATGG + Intergenic
998972562 5:147609254-147609276 CAGTTTCTTCATAGCGTTGACGG + Intronic
999029845 5:148279357-148279379 CAGTTTCTTCATAGTGTTGATGG + Intronic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
1000438096 5:161238415-161238437 CACTTTCTTTAGAGGGTTAATGG - Intergenic
1000582015 5:163046721-163046743 CAATTTCTTCATAGTGTTGATGG + Intergenic
1000590243 5:163148797-163148819 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1000598051 5:163238201-163238223 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1000831016 5:166101482-166101504 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1002007795 5:176251036-176251058 CAGTTTCTTCATAGTGTTGATGG + Intronic
1002218589 5:177659644-177659666 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1002632428 5:180590711-180590733 CAGGAGCTTCAGCGGGTTGAGGG + Exonic
1002673755 5:180891762-180891784 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1003496759 6:6670224-6670246 CAATTTCTTCATAGCATTGATGG - Intergenic
1004028206 6:11839261-11839283 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1004944257 6:20594758-20594780 CAATTTCTTCATAGCATTGATGG + Intronic
1005171594 6:22991864-22991886 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1006561396 6:34915937-34915959 CAAATTCTTCAGAGGCTTTTAGG - Intronic
1007236882 6:40396930-40396952 TAACTTCCTCAGAGGGTTGTAGG - Intronic
1008509848 6:52266139-52266161 TGTGTACTTCAGAGGGTTGATGG + Exonic
1008782527 6:55125191-55125213 CAGTTTCTTCATAGTGTTGATGG + Intronic
1008785320 6:55160399-55160421 CAGTTTCTTCATAGTGTTGATGG - Intronic
1009054527 6:58318477-58318499 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1009458973 6:63889684-63889706 CAGTTTCTTCATAGTGTTGATGG - Intronic
1009776086 6:68207684-68207706 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1009776866 6:68216696-68216718 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1010344060 6:74790840-74790862 CAGTTTCTTCATAGCGTTGATGG - Intergenic
1010936044 6:81862953-81862975 TAAATTCTCCAGAGGTTTGAGGG - Intergenic
1011333897 6:86238719-86238741 CAATTTCATCATAGTGTTGATGG - Intergenic
1011776576 6:90737820-90737842 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1012121079 6:95367339-95367361 CAAGTTATTAAGGGGGTTGTAGG - Intergenic
1012209088 6:96498349-96498371 CAATTTCTTCATAGAATTGATGG + Intergenic
1012233804 6:96789786-96789808 CAGGCTCTTCACAGGGTAGAGGG - Intergenic
1012282926 6:97350551-97350573 AAAGTTTTTCAGAGGGTAGAAGG - Intergenic
1012743656 6:103054850-103054872 CAAGTCCTGCAAAGGGTTCAAGG - Intergenic
1013625436 6:111933051-111933073 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1013860679 6:114632079-114632101 CAATTTCTTCATAGCATTGATGG + Intergenic
1014058286 6:117042162-117042184 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1014113587 6:117647638-117647660 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1014378996 6:120715155-120715177 CAACTTCTTCACAGGGTGGCAGG + Intergenic
1014386860 6:120814264-120814286 CAATTTCTTCATAGTGTCGATGG + Intergenic
1014563016 6:122913855-122913877 CCATTGCTTCAGAGGGTTCAAGG + Intergenic
1014967968 6:127780474-127780496 CAGTTTCTTCATAGTGTTGATGG + Intronic
1015472065 6:133616638-133616660 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1015873389 6:137799345-137799367 CAGGTGCTTAAGAGGGTGGAAGG + Intergenic
1015915108 6:138208456-138208478 CAAGGTCTTCAGTGGTGTGAAGG + Intronic
1017322854 6:153112984-153113006 CAGTTTCTTCATAGTGTTGATGG - Intronic
1017968480 6:159288624-159288646 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1018600284 6:165530910-165530932 CAAGTTATTGAAAGGTTTGAAGG - Intronic
1019071685 6:169351946-169351968 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1020391189 7:7660380-7660402 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020454360 7:8354328-8354350 AAAATTCTTCAGAGGGAGGATGG + Intergenic
1020487449 7:8737209-8737231 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020630001 7:10627736-10627758 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1020693613 7:11389700-11389722 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020823592 7:13000792-13000814 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1020874062 7:13672145-13672167 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1021502097 7:21343427-21343449 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1022170227 7:27820412-27820434 CCAGTGCTTGAGAGAGTTGAGGG + Intronic
1022419297 7:30205669-30205691 AAAGTTCTTGAGATGGATGACGG + Intergenic
1022432723 7:30342306-30342328 CAATTTCTTCATAGTGTTGATGG + Intronic
1022692442 7:32669915-32669937 CCATTTCCTCTGAGGGTTGAGGG + Intergenic
1022885105 7:34634951-34634973 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1022920118 7:35004461-35004483 TCATTTCTTCTGAGGGTTGAGGG + Intronic
1023651011 7:42369499-42369521 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1024282182 7:47728254-47728276 CAATTTCATCAAAGGGCTGATGG + Intronic
1024664685 7:51534843-51534865 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1026241431 7:68578897-68578919 CAAGTTCTCCAGAGGGACAATGG + Intergenic
1027440065 7:78209801-78209823 CAATTTCTTCAGAGCCTTGTAGG - Intronic
1027637305 7:80691061-80691083 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1027777998 7:82490821-82490843 CAGTTTCTTCATAGTGTTGAAGG + Intergenic
1027843570 7:83343690-83343712 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1028090862 7:86699009-86699031 TAAGATCTTCAGAGGCTTGTGGG - Intronic
1028337236 7:89673019-89673041 CAGTTTCTTCAGAGTTTTGAAGG + Intergenic
1028429732 7:90733887-90733909 CAGTTTCTTCATAGCGTTGATGG + Intronic
1028462163 7:91106276-91106298 TAATGTCTTCAGAGGGTTAAGGG + Intronic
1028652642 7:93168521-93168543 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1030258148 7:107534229-107534251 CAGATTCTTCATAGTGTTGATGG - Intronic
1030331536 7:108276814-108276836 CAGTTTCTTCATAGCGTTGATGG + Intronic
1031613546 7:123855281-123855303 CATTTTCTTCACAGTGTTGATGG + Intronic
1032657986 7:133952575-133952597 AAAGTTCTGCAGATGGATGATGG - Intronic
1032743964 7:134767242-134767264 CAAGCTCTGCTGAGGTTTGATGG - Intronic
1033679339 7:143578678-143578700 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1033692498 7:143750766-143750788 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1033922403 7:146410650-146410672 CAAGTCTATCAGAGGGTAGAGGG - Intronic
1035164905 7:156981270-156981292 CAAGTTGTTCTGTGGGTTCATGG + Intergenic
1035696297 8:1599950-1599972 CAATTTCTTCATAGTGTCGATGG + Intronic
1035798525 8:2382758-2382780 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1036121365 8:6021058-6021080 CAAGTTCTTCAGAGAGGTCTTGG - Intergenic
1036558211 8:9878651-9878673 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1039134066 8:34299634-34299656 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1040878511 8:52177546-52177568 TAACTTGTTCAGAGGGCTGAAGG + Intronic
1040956684 8:52987061-52987083 CAAGTTCTGCAGAATTTTGATGG + Intergenic
1041051030 8:53934171-53934193 CAGTTTCTTCATAGTGTTGATGG - Intronic
1041836841 8:62225493-62225515 CAGTTTCTTCATAGTGTTGAGGG - Intergenic
1041851411 8:62397445-62397467 CAAATTCTGCAGAGAGTTGTAGG + Intronic
1041977471 8:63816636-63816658 CACGTTCTTCACAGGGTGGCAGG + Intergenic
1042195800 8:66230576-66230598 CAGTTTCTTCATAGGATTGATGG - Intergenic
1043528004 8:81117370-81117392 CACCTTCTAGAGAGGGTTGATGG + Intergenic
1043646995 8:82534145-82534167 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1044595005 8:93951042-93951064 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1044703836 8:94989422-94989444 CAAGTTGGTGAGAGTGTTGAGGG + Intronic
1047238318 8:123061941-123061963 CAAGTTCTTCAGCTTGTAGATGG + Intronic
1048382412 8:133878575-133878597 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1048400960 8:134070115-134070137 AAATTTCTTCAGAGTGCTGAAGG - Intergenic
1049274751 8:141714582-141714604 CTAGTAGTTCAGAGGGTGGAGGG + Intergenic
1050075705 9:1861061-1861083 CAATTTCTTCATAGCGTCGATGG - Intergenic
1050121550 9:2313813-2313835 CCATTGCTTCAGAGGGTTCAAGG + Intergenic
1050129945 9:2401785-2401807 CAATTTCTTCATAGTGTCGACGG + Intergenic
1050569577 9:6923627-6923649 CAAGTTCTTCAGAGTCTTGTGGG + Intronic
1050700540 9:8333617-8333639 CAGCTTCTTCATAGCGTTGATGG - Intronic
1050942946 9:11483852-11483874 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1051045531 9:12868875-12868897 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1052281007 9:26733647-26733669 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1053314872 9:37042637-37042659 CAAGTTCTTCTGTGGATTAAAGG - Intergenic
1053446740 9:38158763-38158785 CAAGTTCCTAAGAGGGTGGAGGG + Intergenic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1055125492 9:72714843-72714865 CGATTTCTTCATAGCGTTGATGG + Intronic
1055325470 9:75123662-75123684 CAAATTCTTCACAGTGTTGGTGG - Intronic
1055390730 9:75819828-75819850 CAATTTCTTCATAGTGTTGATGG + Intergenic
1055634526 9:78262414-78262436 CAATTCCTCCAGAGTGTTGAGGG - Intronic
1056321126 9:85435473-85435495 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1058081761 9:100708544-100708566 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1058353394 9:104054196-104054218 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1058558840 9:106202419-106202441 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1060108711 9:120891298-120891320 CAAGTTCCTCAGAGAGGGGAGGG - Intronic
1060137963 9:121175673-121175695 CAAGTTTTTCAGAGAGTTGAAGG - Intronic
1060584215 9:124776210-124776232 CAAGTTATTCAGAAGGCTGAGGG + Intergenic
1186700616 X:12086254-12086276 AAATTTCTTTAGAGTGTTGAAGG + Intergenic
1186799045 X:13074884-13074906 GAAGTTTGTCAGAGGCTTGAGGG + Intergenic
1186937024 X:14461927-14461949 CAGTTTCTTCATAGCGTTGATGG + Intergenic
1187244371 X:17540650-17540672 CAAGTTCTTCAGAGGGTTGACGG - Intronic
1187661069 X:21546991-21547013 CAGTTTCTTCATAGTGTTGATGG - Intronic
1187728837 X:22232875-22232897 CAGTTTCTTCATAGTGTTGATGG + Intronic
1187729755 X:22240300-22240322 CAGTTTCTTCATAGTGTTGATGG - Intronic
1188623561 X:32256590-32256612 CAGTTTCTTCATAGGGTCGATGG + Intronic
1189590847 X:42509081-42509103 TAATTTCTTCATAGTGTTGATGG - Intergenic
1189595118 X:42556281-42556303 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1189721651 X:43925949-43925971 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1189937981 X:46089182-46089204 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1189978214 X:46484146-46484168 CAGTTTCTTCATAGGGTTGGTGG + Intronic
1190110747 X:47587503-47587525 CAAGTTGGTCAGAGGAGTGAGGG - Intronic
1190506100 X:51127285-51127307 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1191154213 X:57253836-57253858 CAATTTCTTCATAGTGTTGATGG - Intergenic
1191181737 X:57571194-57571216 CAATTTCTTCATAGTGTTGATGG - Intergenic
1191705314 X:64087678-64087700 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1191750163 X:64533869-64533891 CAAGTTTTCCAGAGGATTAAGGG - Intergenic
1191771393 X:64763115-64763137 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1191793994 X:65001506-65001528 CAGTTTCTTCATAGTGTTGATGG - Intronic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192179422 X:68907116-68907138 CATGTTCTCCAGGGTGTTGATGG - Intergenic
1192966329 X:76181361-76181383 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1193095152 X:77539879-77539901 CAGTTTCTTCATAGCGTTGATGG - Intronic
1193267062 X:79484144-79484166 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1193355776 X:80519272-80519294 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1193434166 X:81451318-81451340 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1193477434 X:81983521-81983543 CAATTTCTTCATAGCATTGATGG - Intergenic
1193949540 X:87780478-87780500 CAGTTTCTTCATAGAGTTGATGG - Intergenic
1194357310 X:92901588-92901610 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1195414439 X:104604369-104604391 CAGTTTCTTCATAGTGTTGATGG - Intronic
1196121566 X:112056693-112056715 CATTTTCCTAAGAGGGTTGAAGG + Intronic
1196272949 X:113734076-113734098 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1196312594 X:114185545-114185567 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1196570124 X:117256352-117256374 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1196602737 X:117621168-117621190 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1198029836 X:132744202-132744224 TATGTACTTCATAGGGTTGATGG - Intronic
1198490154 X:137131501-137131523 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1199524695 X:148779825-148779847 CAGTTTCTTCATAGTGTTGATGG + Intronic
1199808872 X:151329237-151329259 CAAGTTCTGCAGAGGGATGGTGG + Intergenic
1200407830 Y:2831337-2831359 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1200898309 Y:8400267-8400289 TAAGTTTTTCACTGGGTTGAAGG + Intergenic
1201672655 Y:16541540-16541562 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1201961739 Y:19688689-19688711 CAGTTTCTTCATAGTGTTGATGG + Intergenic