ID: 1187245872

View in Genome Browser
Species Human (GRCh38)
Location X:17552527-17552549
Sequence AGGGAGAAAGAAGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2976
Summary {0: 1, 1: 0, 2: 30, 3: 334, 4: 2611}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187245867_1187245872 29 Left 1187245867 X:17552475-17552497 CCTCATGATTGCGAGATGGCTGC 0: 1
1: 1
2: 41
3: 111
4: 297
Right 1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG 0: 1
1: 0
2: 30
3: 334
4: 2611
1187245868_1187245872 -1 Left 1187245868 X:17552505-17552527 CCAAGCATCATGTCTGTGTTCTA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG 0: 1
1: 0
2: 30
3: 334
4: 2611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187245872 Original CRISPR AGGGAGAAAGAAGATGAGGA AGG Intronic
Too many off-targets to display for this crispr