ID: 1187246291

View in Genome Browser
Species Human (GRCh38)
Location X:17555506-17555528
Sequence GGGGCTGATGCTGCTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1824
Summary {0: 1, 1: 12, 2: 116, 3: 449, 4: 1246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187246283_1187246291 10 Left 1187246283 X:17555473-17555495 CCAAGAATTGGCATTTCTCACAG 0: 1
1: 1
2: 22
3: 179
4: 685
Right 1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG 0: 1
1: 12
2: 116
3: 449
4: 1246
1187246280_1187246291 30 Left 1187246280 X:17555453-17555475 CCATAGGTCTGGAGTGGGGCCCA 0: 2
1: 3
2: 13
3: 69
4: 246
Right 1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG 0: 1
1: 12
2: 116
3: 449
4: 1246
1187246282_1187246291 11 Left 1187246282 X:17555472-17555494 CCCAAGAATTGGCATTTCTCACA 0: 1
1: 3
2: 102
3: 420
4: 1399
Right 1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG 0: 1
1: 12
2: 116
3: 449
4: 1246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187246291 Original CRISPR GGGGCTGATGCTGCTGGTCT GGG Intronic
900207277 1:1436923-1436945 GGGGCTGATGCTGGTGGACCTGG - Exonic
900310216 1:2029869-2029891 GGGGCTGGAGCTGCTGGTCCAGG + Intronic
900480580 1:2896195-2896217 GGGGATGCTGCTGCTGGACAAGG + Intergenic
900642330 1:3693728-3693750 GGAGCTGAGGCTGCAGGGCTGGG - Intronic
900642350 1:3693798-3693820 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642381 1:3693903-3693925 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642393 1:3693939-3693961 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642403 1:3693974-3693996 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642414 1:3694009-3694031 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642424 1:3694044-3694066 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642444 1:3694114-3694136 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642454 1:3694149-3694171 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642477 1:3694220-3694242 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642500 1:3694291-3694313 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642523 1:3694362-3694384 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642533 1:3694397-3694419 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642544 1:3694432-3694454 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642554 1:3694467-3694489 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642564 1:3694502-3694524 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642575 1:3694537-3694559 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642585 1:3694572-3694594 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642595 1:3694607-3694629 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642627 1:3694712-3694734 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642637 1:3694747-3694769 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642665 1:3694853-3694875 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900642684 1:3694923-3694945 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642694 1:3694958-3694980 GGGGCTGAGGCTGCATGGCTGGG - Intronic
900741183 1:4332339-4332361 TGGGCTGGTGCTGCAGGTCGTGG - Intergenic
900862548 1:5243726-5243748 GGAGCCGAATCTGCTGGTCTAGG + Intergenic
900884211 1:5403936-5403958 AGGGCTGCTGCTGCTGGTGCTGG - Intergenic
901039686 1:6356425-6356447 GGGGCTGAGGGTGCTGAGCTGGG - Intronic
901059189 1:6464289-6464311 GGGGCAGGTGCTGCTGGTTCAGG - Intronic
901146204 1:7066254-7066276 GGGGCTGTAGCTGTTGGCCTTGG + Intronic
901245299 1:7725685-7725707 AGTTCTGATGCTTCTGGTCTAGG - Intronic
901759988 1:11464479-11464501 GATGCTGCTGCTGATGGTCTGGG + Intergenic
901782365 1:11602432-11602454 GGTGCTGCTGCTGCTGCTGTTGG - Intergenic
901953194 1:12764627-12764649 GAAGCTGGTGCTGCTGGCCTGGG + Intergenic
902078346 1:13804598-13804620 GGAAATGATGCCGCTGGTCTGGG + Intronic
902167402 1:14583690-14583712 GTGGCTGATATTCCTGGTCTTGG + Intergenic
902176580 1:14655110-14655132 GGTGCTGCTGCTCCTGGCCTAGG + Intronic
902211365 1:14907029-14907051 GTTGCTGATGCTGCTGGTCTTGG - Intronic
902271890 1:15310582-15310604 GATGCTGATGCTGCTGGTCCAGG - Intronic
902293997 1:15453843-15453865 TGTGCTGATGCTGCTGGCCCAGG + Intergenic
902681891 1:18049574-18049596 GGTGCTGATGATGCTGGTGATGG + Intergenic
902931811 1:19736674-19736696 AGGGCTGCTGCTCCTGGCCTTGG - Intronic
903001864 1:20272076-20272098 GGGGCTGATGGAGCTGGTGCTGG + Intergenic
903244775 1:22007386-22007408 GGGCCTGCTGCAGCTTGTCTGGG - Exonic
903300045 1:22372335-22372357 GATGCTGATGCTGCCGGTCCAGG - Intergenic
903457080 1:23495029-23495051 AATTCTGATGCTGCTGGTCTGGG + Intergenic
903831852 1:26180229-26180251 GAGTCTGCTGCTGCTGGTCTGGG + Intronic
903942251 1:26939825-26939847 GATGCTGATGCTGCAGGTCAGGG + Intronic
904094529 1:27966720-27966742 GTGGCTGGTACTGCTGCTCTGGG + Exonic
904539182 1:31221328-31221350 GATGCTGATGCTGCTAGTCCAGG - Intronic
904562920 1:31410782-31410804 GGGGTTGATCCTCTTGGTCTTGG + Intronic
904960490 1:34328789-34328811 GTGGGTGGTTCTGCTGGTCTAGG + Intergenic
904974069 1:34442579-34442601 GATGCTGATGCTGCTGGTCTGGG + Intergenic
904975230 1:34451093-34451115 GATGCTGATGCTGCTGGTCCAGG - Intergenic
905111939 1:35601759-35601781 GCTACTGATGCTGCTGGTCTAGG - Exonic
905214376 1:36396600-36396622 GATGCTGATGCTGCTGGTCAGGG + Intronic
905556408 1:38888687-38888709 GAAGCTGATGCTGCTGGTCTTGG - Intronic
905588479 1:39141377-39141399 GATGCTGATGCTGCTGGTCTGGG + Intronic
905637940 1:39567924-39567946 GATGCTGGTGCTCCTGGTCTGGG - Intronic
905739098 1:40353921-40353943 GACACTGATGCTGCTTGTCTGGG + Intronic
905832969 1:41089080-41089102 AGTGCTGATGCTGCTGGTCTGGG + Intronic
906132890 1:43471836-43471858 GATGCTGATGCTGTTGGTCCAGG + Intergenic
906532847 1:46533311-46533333 GGGGCTGGCGCTGCTGGTGCTGG - Intergenic
907002854 1:50879693-50879715 GATGCTGATGCTGCTGGTCTAGG - Intronic
907359840 1:53905650-53905672 GACGCTGATGCTGTTAGTCTGGG + Intronic
907376047 1:54041447-54041469 TTTGCTGATGCTGCTGGCCTGGG - Intronic
907471838 1:54679364-54679386 GGAGATGATGCAGCTGGCCTCGG + Exonic
907488545 1:54793960-54793982 GCTGCTGATCTTGCTGGTCTGGG - Intronic
907634898 1:56124596-56124618 AAGGCTGATGCTGCTGGTCCAGG - Intergenic
907824136 1:57999317-57999339 GCTGCTGATGCTGCTGGTCCAGG - Intronic
907839527 1:58142947-58142969 GAAGCTGATGCTACAGGTCTAGG - Intronic
907867000 1:58408042-58408064 GATGCTGAGGCTGCTGGTCCAGG - Intronic
907952582 1:59197843-59197865 AAAGCTGATGCTGCTGGTCCAGG + Intergenic
908793779 1:67810979-67811001 GATGCTGATGCTGCCGGTCCAGG - Intronic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909342762 1:74550163-74550185 GATGCTGATGCTGCTTGTCCTGG + Intergenic
909347895 1:74614144-74614166 GATGCTGATGCTATTGGTCTAGG + Intronic
910449001 1:87328550-87328572 GGGGCTGTTGCTGCCCGGCTCGG - Exonic
910910601 1:92230129-92230151 GATGCTGATGATACTGGTCTGGG - Intronic
910927252 1:92410084-92410106 GGAGCTGCTGCTGCTGCTTTGGG - Intergenic
911101091 1:94096319-94096341 GGGACAAATGCTGCTGGTGTTGG + Intronic
911384326 1:97156008-97156030 GATGCTGATGTTGCTGGTTTGGG + Intronic
912109468 1:106323245-106323267 GAGGCTGCTGCTGCTGCTATTGG + Intergenic
912231481 1:107797935-107797957 GCTGTTGATGCTGCTGGTCCAGG + Intronic
912719284 1:112006140-112006162 CAAGTTGATGCTGCTGGTCTAGG + Intergenic
912919720 1:113854268-113854290 GATGCTGATGCTTCTTGTCTGGG + Intronic
913070294 1:115292472-115292494 GATGCTGATGCTGTTGGTCTGGG + Intronic
913110481 1:115653264-115653286 GGGGCAGGTGCTGCTGGACGGGG + Intronic
913110677 1:115654665-115654687 GGGGCAGGTGCTGCTGGACGGGG - Intronic
913181380 1:116325770-116325792 GATTCTGATGCTGCTGGTCTGGG - Intergenic
913312283 1:117512473-117512495 GATGCTGATGCTGCTGGTCTGGG + Intronic
913360942 1:117979264-117979286 GGTGCTGATGTTGCTGATATAGG - Intronic
913373758 1:118129346-118129368 GATACTGATGCTGCTAGTCTGGG - Intronic
913963180 1:143354439-143354461 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914046508 1:144097894-144097916 GGTGATAATGCTGCTGATCTGGG + Intergenic
914057536 1:144180025-144180047 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914121610 1:144786341-144786363 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
914131602 1:144862792-144862814 GGTGATAATGCTGCTGATCTGGG - Intergenic
914787151 1:150844524-150844546 GTTGCTGATGCTCCTGGTCTCGG - Intronic
915145371 1:153793502-153793524 GGTGCTGGGGCTGCTGGGCTGGG + Intergenic
915241234 1:154523492-154523514 GGTGCTGATGCTCCTGGCCCTGG + Intronic
915487494 1:156232000-156232022 TAGGCTGATGGTGCTGGTCTGGG - Intronic
915559107 1:156676235-156676257 GGGGCTGCTGCAACGGGTCTTGG + Intronic
915637325 1:157195814-157195836 TGGGCTGCTGCAGCTGGCCTGGG - Intergenic
915674053 1:157514602-157514624 GATGCTGATGCTGCTGGCCCTGG - Exonic
916250758 1:162735524-162735546 GATGCTGATGCTGCTGGTCCTGG + Intronic
916390277 1:164322898-164322920 GATGCAGATGCTGCTGGTTTGGG - Intergenic
916482327 1:165225763-165225785 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
916488405 1:165279606-165279628 GGGGCTGATGCTGCCTGTCCAGG + Intronic
916658150 1:166896302-166896324 GGTGCTGGTGCTGCTGCTGTTGG + Intergenic
916678711 1:167085567-167085589 GGGGATGATACTCCTGGTCCAGG - Intronic
916888373 1:169092499-169092521 CATGCTGATGCTGCTGGTCTGGG + Intergenic
917314741 1:173712945-173712967 GATGTTGATGCTGCTGGTCCAGG + Intergenic
917450379 1:175142944-175142966 GATGTGGATGCTGCTGGTCTGGG + Intronic
917516798 1:175715048-175715070 GATGCTGAAGCTGCTGGTCCTGG - Intronic
917683546 1:177392458-177392480 GGTGCTGCTGCTGCTGCTGTTGG + Intergenic
917732675 1:177891793-177891815 GTGGCTCAGGCTGCTGGTCTAGG - Intergenic
917748708 1:178035785-178035807 GATACTGATGCTGGTGGTCTGGG - Intergenic
917968792 1:180194524-180194546 GGGGCTGATGATACTGGCATTGG - Intronic
918068067 1:181114943-181114965 GATACTGATGCTGCTGGTCCAGG - Intergenic
918209287 1:182336754-182336776 GCTGCTGATGCTTCTTGTCTGGG - Intergenic
918594668 1:186279186-186279208 GATGCTGATGCTGCTGGTCCAGG - Intergenic
919697102 1:200588572-200588594 GATGTTGATGTTGCTGGTCTAGG + Intronic
919801023 1:201354757-201354779 GGGGAAAATGCTGCTGATCTGGG - Intergenic
919821999 1:201479309-201479331 GGTGCTGATGTTGCTGATCCTGG - Intergenic
919851728 1:201677432-201677454 TGGGCAGAGGCTGCTGGCCTTGG - Intronic
919994632 1:202737390-202737412 GATGCTAATACTGCTGGTCTGGG + Intronic
920123058 1:203673156-203673178 TGAGCTGATGCATCTGGTCTGGG - Intronic
920187042 1:204166242-204166264 GGGACTGCTGCTGCTGCTCTGGG - Exonic
920264272 1:204710262-204710284 GATGTTGATGCTGCTGGTCCAGG + Intergenic
920264319 1:204710544-204710566 GATGCTAATACTGCTGGTCTGGG - Intergenic
920281856 1:204849533-204849555 TCTGCTGATGCTGCTGGTCCAGG + Intronic
920307327 1:205027273-205027295 GGTTCTGATACTGCCGGTCTAGG - Intergenic
920414897 1:205792525-205792547 GTTGTTGATGCTGCTGGTCCTGG - Intronic
920461312 1:206142685-206142707 GAGGCTGATACTGCTCGTCCAGG + Intergenic
920695331 1:208177738-208177760 GGGGCAGATGCTGCTGCTCTGGG - Intronic
920854384 1:209651395-209651417 TGGGTTGAGGCTGCTGGTCTAGG - Intronic
920932929 1:210405962-210405984 GATACTGATGCTGCTGGTCCAGG - Intronic
920942993 1:210501514-210501536 GAAGCTGCTGCTGCTGATCTTGG + Intronic
921118099 1:212113524-212113546 GGTGCTGATGCTGCTGGTCTAGG + Intergenic
921132690 1:212233178-212233200 GATGCTGCTGCTGCTGATCTGGG + Intergenic
921217553 1:212950665-212950687 GGGGCTGCTGCTGCTGCTGCTGG - Exonic
921221607 1:212977836-212977858 GATGCTGATCCTGCTGGTCCGGG + Intronic
921424124 1:214982810-214982832 GACGCTGATGCTGCTGGCCCAGG - Intergenic
921505589 1:215965121-215965143 GTGGCTGTTGCTGCTGCTCTGGG + Intronic
921643148 1:217580695-217580717 GATGCTGATGATGCTGGCCTGGG - Intronic
921655737 1:217734910-217734932 GAAGTTGATGCTGCTGGTCCAGG + Intronic
921900063 1:220440694-220440716 GAAGCTGATGCTGCTGGTCCAGG + Intergenic
921920073 1:220658476-220658498 GATGCTTATGCTGCTGTTCTAGG + Intronic
922033090 1:221823361-221823383 GATGCTGATGCTGCTGGTCCAGG + Intergenic
922144459 1:222925712-222925734 GCTGCTGCTGCTGCTGTTCTGGG - Intronic
922391976 1:225153335-225153357 GTTACTGATGCTGCTGATCTGGG + Intronic
922879671 1:228971141-228971163 GGGGCTGCTGCTGCTGCTGCTGG + Intergenic
923036801 1:230290196-230290218 GATGCTGATGCTGCTGGCCTGGG + Intergenic
923221593 1:231899349-231899371 GACACAGATGCTGCTGGTCTGGG + Intronic
923350815 1:233103977-233103999 GATGCTGATGCTGCCAGTCTGGG + Intronic
923454080 1:234147913-234147935 GATGCAGATGCTGTTGGTCTTGG + Intronic
923763534 1:236870546-236870568 AGGGCTGGTGCTGCTGGTACAGG + Intronic
924159778 1:241218908-241218930 GATGCTGCTGCTGCTGGACTGGG + Intronic
924933696 1:248750543-248750565 GGAGCTGATACAGCTGGTGTTGG + Exonic
1062808376 10:442286-442308 GGGCGTGATGCGGCGGGTCTGGG - Intronic
1063134579 10:3205757-3205779 GGGGCTGCCGCTGCTGCCCTAGG - Intergenic
1063234008 10:4093509-4093531 GGGGCTGATGCCACAGGTGTGGG + Intergenic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1063365147 10:5486160-5486182 GGGTCAGAGGCTGCTGGACTGGG - Intergenic
1063505408 10:6593628-6593650 GGGGCTGATGCAGCTGGAGCTGG - Intergenic
1063515677 10:6692706-6692728 GATGCTGATGCTGCTGGTTCAGG + Intergenic
1064578471 10:16769647-16769669 GATGCCGATGTTGCTGGTCTGGG + Intronic
1064795407 10:19006435-19006457 GAGGGTGATGCTGCTGGTACAGG + Intergenic
1065111108 10:22440656-22440678 GATGCTGATGCTGCTGGTTCAGG + Intronic
1065334015 10:24636313-24636335 GATACTGATGCTGCTGGTCCTGG - Intronic
1065738610 10:28776174-28776196 GGTGCCAATGCTGCTGGTCTAGG + Intergenic
1065748190 10:28860963-28860985 GGGGCTGCTGCTCCTGGTGTAGG - Intronic
1065770380 10:29072620-29072642 GATGCTGATGCTACTGCTCTGGG - Intergenic
1066259755 10:33717961-33717983 GATGCTGGTGCTGCTGGCCTAGG + Intergenic
1067011810 10:42721219-42721241 GATGCTGATGTTGCTGCTCTGGG - Intergenic
1067018205 10:42773061-42773083 GAGGCTGTTGCTCCTGGTCCTGG - Intergenic
1067220385 10:44339871-44339893 GATGCTGATGCTGCCGGTCCAGG + Intergenic
1067284741 10:44899297-44899319 TGGGCTGATGCCGTTGGTCCTGG + Intergenic
1067311780 10:45120637-45120659 GATGCTGATGTTGCTGTTCTGGG + Intergenic
1067791644 10:49292886-49292908 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1067851656 10:49758693-49758715 TGGGCAGATGGTGCTGGGCTAGG + Intronic
1067947568 10:50699701-50699723 GATGCTGATGCTGTTGGACTGGG - Intergenic
1068012776 10:51475283-51475305 GATGCTGATGCTGCTGTTCCAGG - Intronic
1068090760 10:52429872-52429894 GATGCTGATGCTGTTGTTCTGGG + Intergenic
1068095605 10:52487440-52487462 GAAGCTGATGCTGCTGGTCTAGG + Intergenic
1068613065 10:59082081-59082103 GGTGCTGCTGATGCTGGTCAAGG - Intergenic
1068729303 10:60338431-60338453 GATGCTGATGCTGCTGGCCTAGG + Intronic
1068800893 10:61138574-61138596 GATTCTGATGCTGCTGGTCTTGG + Intergenic
1069191651 10:65498555-65498577 GATGCTGATGCTGCTAATCTAGG + Intergenic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069357800 10:67607713-67607735 GTGGCTGCTGTTGCTGTTCTTGG - Intronic
1069443423 10:68450394-68450416 GATGCTGATGCTACTGGTCCAGG - Intronic
1069572890 10:69504991-69505013 GATGCTGTTGCTGCTGGACTGGG - Intronic
1069685903 10:70318327-70318349 GATGCTGCTGCTGCTGGTCCTGG + Intronic
1069742490 10:70693894-70693916 AGCGCTGATGGTGCTGGTATGGG + Intronic
1069860368 10:71467432-71467454 GATGGTGATGCTGCTGGTCTGGG + Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1069879695 10:71584057-71584079 AACACTGATGCTGCTGGTCTGGG + Intronic
1069945163 10:71980668-71980690 GGGGCTGATACTGCCAGTCTGGG + Intronic
1070390086 10:75962332-75962354 GATGCTGATGCTGCTGGGCTGGG - Intronic
1070489477 10:76963257-76963279 GATGCTGATGCGGCTGGTCTGGG - Intronic
1070512137 10:77171125-77171147 GATGCTGCTGCTGCTGATCTGGG - Intronic
1070658961 10:78291220-78291242 GGAAATGATGCGGCTGGTCTTGG + Intergenic
1070742676 10:78913115-78913137 GATGCTGATGCTGCTGGTCCTGG + Intergenic
1070804366 10:79262222-79262244 GCTGCTGATGCTGCTGACCTGGG - Intronic
1070829042 10:79407564-79407586 GGTGCAGCTGCTGCTGGTCTGGG + Intronic
1070882886 10:79864688-79864710 GATGCTGATGCTGTTGGACTGGG - Intergenic
1070965376 10:80527188-80527210 GCTGCAGCTGCTGCTGGTCTGGG - Exonic
1071048810 10:81419963-81419985 GATACTGATGCTGCTGGTCCAGG + Intergenic
1071166010 10:82807584-82807606 GATGCTGATGTTGCTGGCCTTGG - Intronic
1071241302 10:83708213-83708235 GAGGCTGATTCTGCTGGGCTGGG + Intergenic
1071402019 10:85282590-85282612 GATGCTGATGCTGCTGCTCCAGG - Intergenic
1071481043 10:86065194-86065216 GATGCTGACGCTGCTGGTCCAGG - Intronic
1071509807 10:86254360-86254382 GATGCTGGTGCTGCTGGTCTGGG - Intronic
1071575340 10:86721661-86721683 GGTGATGTTGCTGCTGGTGTTGG - Intronic
1071649452 10:87380991-87381013 GATGCTGATGCTGTTGGACTGGG - Intergenic
1071696044 10:87872721-87872743 GATGCTGATGCTGGTGCTCTGGG + Intronic
1071965582 10:90848825-90848847 GATTCTGATGCTTCTGGTCTTGG - Intronic
1072096025 10:92180792-92180814 AATGCTGATGCTGCTGGTCCAGG + Intronic
1072307676 10:94122900-94122922 GAGGAGGATGATGCTGGTCTGGG + Intronic
1072479320 10:95795297-95795319 CAGGATGATGCTGCTGTTCTTGG + Intronic
1072495916 10:95959273-95959295 GAAGGTGATGATGCTGGTCTGGG - Intronic
1072576377 10:96704383-96704405 GATGCTGATGCTGCTGGTCCAGG - Intronic
1072742853 10:97920598-97920620 GATGCTGACACTGCTGGTCTGGG + Intronic
1072777255 10:98211218-98211240 GATACTCATGCTGCTGGTCTAGG - Intronic
1073340415 10:102740032-102740054 GATGCTGATTCTGTTGGTCTTGG + Exonic
1073417161 10:103393969-103393991 GATGCTAATGCTGCTGGTCTAGG - Intronic
1073629876 10:105137649-105137671 GATGCCAATGCTGCTGGTCTGGG - Intronic
1073634933 10:105187990-105188012 GGTGCTGCTGCTGCTGGTGGTGG + Intronic
1073739948 10:106394879-106394901 AGGGCTGGTGCTGCTGGTCTGGG + Intergenic
1073847690 10:107577463-107577485 GTGACAGATGCTGCTGCTCTGGG + Intergenic
1074143300 10:110695996-110696018 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074703451 10:116111720-116111742 AGTGCTGCTGCTGCTGGTCTGGG - Intronic
1074963750 10:118470892-118470914 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1075178201 10:120185284-120185306 GATGCTGATGCAGCTGGTCCAGG - Intergenic
1075226788 10:120636806-120636828 GATGCTGATGCTGCTGATCTAGG + Intergenic
1075329256 10:121560932-121560954 GATGCTGATGCTGCTGGTCCAGG + Intronic
1075472625 10:122704309-122704331 GAGTCTGATTCTGCAGGTCTGGG + Intergenic
1075473058 10:122707963-122707985 GAGTCTGATTCTGCAGGTCTGGG - Intergenic
1075930703 10:126293012-126293034 GATGCTGATGCTGCTGGTCTGGG + Intronic
1075955294 10:126518198-126518220 CGTGTGGATGCTGCTGGTCTGGG - Intronic
1076046333 10:127297044-127297066 GTGGCTGATGCTGATGAACTGGG - Intronic
1076055081 10:127366349-127366371 GGGGATGATGCTGCAGGCTTGGG - Intronic
1076988848 11:258514-258536 GATGCTGATGCTGTTGGTCCAGG - Intergenic
1077206468 11:1346904-1346926 GGGGCCGGTGCTGCTGGGGTGGG + Intergenic
1077886437 11:6390975-6390997 GGGGCTGATGCTGGTGCGCTGGG + Intronic
1077951501 11:6962668-6962690 GATGTTGATGCTGCTGGTCTGGG - Intronic
1078065986 11:8080080-8080102 GGGGCTCATCCTGCTGCCCTGGG - Intronic
1078193945 11:9119220-9119242 GATGCTGATGCTGCTGGCCCGGG - Intronic
1078399214 11:11009445-11009467 GATGCTGATGCTGCTGGTTCGGG + Intergenic
1078967991 11:16369991-16370013 GGGGCTTAGGCAGCTGGTATTGG - Intronic
1079366190 11:19812222-19812244 CATGCTAATGCTGCTGGTCTGGG + Intronic
1079567329 11:21899030-21899052 GGTGCTGATGCTGCTTGCTTAGG + Intergenic
1080300806 11:30783216-30783238 GGAGGTGATACTGCTGATCTGGG - Intergenic
1080388454 11:31823903-31823925 GGGGTTGATGCTCTTGTTCTGGG - Intronic
1080629989 11:34065526-34065548 GATGCTGATGTTGCTGGTTTGGG + Intronic
1080923260 11:36730336-36730358 AAGGCTGATGCTGCTAGTCTGGG - Intergenic
1081286640 11:41278671-41278693 GGTGATGCTGCTGCTGGTCCTGG + Intronic
1081436768 11:43035244-43035266 GGGGCTGATGCTGATGCCCATGG + Intergenic
1081483189 11:43507571-43507593 GATGCTGATGCTGTTGGTCTGGG - Intergenic
1081671892 11:44947111-44947133 GGGTCTGAAGCTGCTGCTGTGGG + Intronic
1081855439 11:46300405-46300427 CCAGGTGATGCTGCTGGTCTGGG - Intronic
1081981684 11:47270442-47270464 GGGGCTCAGGCTACTGGGCTTGG + Intronic
1082238732 11:49851252-49851274 GAGGCTGATGCCGCTGGCCCAGG + Intergenic
1082243411 11:49893075-49893097 GAGGCTGATGCTGCTGGCCCAGG - Intergenic
1082657907 11:55873901-55873923 GAGGCTGATGCCGCTGGCCCAGG - Intergenic
1082789949 11:57340266-57340288 GGGGCTGAGCGGGCTGGTCTAGG - Intronic
1082842926 11:57704047-57704069 GCTGCTGCTGCTGCTGGCCTGGG + Exonic
1083198892 11:61107707-61107729 GGTGATGATGATGCTGGTCACGG - Intronic
1083274149 11:61587526-61587548 GGGGCTGCTGGAGCAGGTCTTGG - Intergenic
1084052704 11:66610951-66610973 GGCGGGGATGCTGCTGGTATTGG + Intergenic
1084697042 11:70761925-70761947 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1084701189 11:70787254-70787276 GGTGGTGATGCTGCTGGTGGTGG - Intronic
1084941255 11:72614631-72614653 GACACTGATGCTGCTGGTCGGGG + Intronic
1085192398 11:74639121-74639143 AATGCTGATGCTGCTGGTCTGGG - Intronic
1085442608 11:76578104-76578126 GGGTCTGATGCTGCTGGCCCTGG + Intergenic
1085659776 11:78353061-78353083 GATGCTCATGCTGCTGGTATGGG - Intronic
1085799205 11:79572539-79572561 GATGCTGATGCTGCTGGCCTGGG + Intergenic
1085911308 11:80829913-80829935 AGGACTGATGCTGTTGGTCTGGG + Intergenic
1086076768 11:82863057-82863079 GAAGCTGATACTGCTGGTCTGGG - Intronic
1086279092 11:85164917-85164939 GGTGCTGATGCTGCTGGTCTGGG - Intronic
1086279183 11:85166010-85166032 GGCGCTGATGCTGCTGGTCTGGG - Intronic
1086690685 11:89786607-89786629 GAGGCTGATGCCGCTGGCCCAGG + Intergenic
1086697837 11:89864899-89864921 GAGGCTGATGCCGCTGGCCCAGG - Intergenic
1086708325 11:89979589-89979611 GAGGCTGATGCCGCTGGCCCAGG + Intergenic
1086715116 11:90053053-90053075 GAGGCTGATGCCGCTGGCCCAGG - Intergenic
1086825940 11:91496708-91496730 GTTCCTGATGCTGCTGGTCTGGG - Intergenic
1086865134 11:91971368-91971390 GATGCGGATGCTGCTGGTCAAGG - Intergenic
1086980084 11:93186946-93186968 GCTGCTGATGTTGCTGGTCTGGG + Intronic
1087275867 11:96159855-96159877 GATACTGATGCTGCTGGTCTGGG + Intronic
1087287233 11:96278074-96278096 GCCGCTGCTGCTGCTGTTCTTGG + Intronic
1087356209 11:97097797-97097819 GAAGCTCAAGCTGCTGGTCTAGG - Intergenic
1087760772 11:102102189-102102211 GATGCTGATGCTGCTGGTTTAGG + Intergenic
1087837759 11:102891867-102891889 AAGGCTGATGCTGCTGGTCTGGG - Intergenic
1087866241 11:103229947-103229969 GATGCTGATGCTGCTGGTCTAGG - Intronic
1088472993 11:110206925-110206947 GAGTCTGATGCTGCTGTTTTGGG - Intronic
1088574039 11:111252412-111252434 AATGCTGATGCTGCTGGTCCAGG + Intergenic
1088590476 11:111398677-111398699 GATGGTGCTGCTGCTGGTCTGGG + Intronic
1088624997 11:111723730-111723752 GGGGCTGAAGCTGCATCTCTTGG - Exonic
1088753112 11:112862501-112862523 GGAGCTGATGCTACTGCTCTAGG - Intergenic
1088878667 11:113956931-113956953 GATGCTAATGCTGCTGGTCCTGG - Intergenic
1088939523 11:114439503-114439525 GGGGCCGTGGCTGCTGGTCCCGG + Exonic
1089156568 11:116407263-116407285 GGGGCTGCTCCTCCTGGGCTGGG - Intergenic
1089533291 11:119145670-119145692 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1089626449 11:119754159-119754181 GATGCTGATGCTTCTGGTCTCGG - Intergenic
1089635858 11:119811229-119811251 GATGCTGATGCTGCTTGTCCAGG + Intergenic
1089679877 11:120113404-120113426 GGGGCTGATGGTGCTTGCGTGGG - Intronic
1089841156 11:121418953-121418975 GCAGCTGCTGCTGCTGCTCTAGG + Intergenic
1090035382 11:123245482-123245504 GACGCTGATGCTGCTGGTTGAGG - Intergenic
1090095599 11:123739801-123739823 GGTACTGATGCTGCAGATCTGGG - Intronic
1090331156 11:125933201-125933223 GCTGCTGCTGCTGCTGATCTGGG - Intergenic
1090561760 11:127940069-127940091 ATTGCTGATACTGCTGGTCTGGG + Intergenic
1090620011 11:128552097-128552119 GATAGTGATGCTGCTGGTCTGGG + Intronic
1090931133 11:131299076-131299098 GGTGCTGCTGCTGCTGGTTCGGG + Intergenic
1091031368 11:132191187-132191209 AGTGCTGTTGCTGGTGGTCTGGG + Intronic
1091394913 12:148216-148238 GAAGCTGACGCTGCTGGTCCAGG - Intronic
1091610029 12:1999069-1999091 GACGCTGATGCCGCTGATCTGGG - Intronic
1091789051 12:3260823-3260845 GGGGCTGATGCCTCTACTCTGGG - Intronic
1091841517 12:3624737-3624759 GAGGCTGATGCTGGTGGTCCAGG - Intronic
1091920064 12:4296929-4296951 GGGGTTGAAGCTGCTGTTCTGGG + Intronic
1092771084 12:11897357-11897379 AGTGCTGATGGTGCTGGTCCAGG + Intergenic
1092778773 12:11966355-11966377 GGTGCTGATACAGCTGGTCCAGG - Intergenic
1092953335 12:13527683-13527705 GGGGCTGCTGCCTCTGGTGTGGG - Intergenic
1093115560 12:15206518-15206540 GATGCTGATGCTGCTAGTCTAGG - Intronic
1093276155 12:17130416-17130438 GGAGCTCATGCTCTTGGTCTGGG + Intergenic
1093711255 12:22332939-22332961 GGGGCTGAAGATGCTGCTGTTGG - Intronic
1093744618 12:22725803-22725825 GAAGCTGTTGCTGCTGGTCAGGG + Intergenic
1093791458 12:23255197-23255219 GGGGCTGATGCTTCTGGCACGGG - Intergenic
1093948375 12:25135830-25135852 GGGGTTGCTGCGGCTGCTCTAGG - Intronic
1094418412 12:30242511-30242533 GGTGCTGAGGCTCCTGGACTTGG + Intergenic
1094487634 12:30937697-30937719 GAGGCTGATGCTGTTGGTCTGGG - Intronic
1095792727 12:46185239-46185261 GATGCTGATGCTACTGGTCTAGG + Intronic
1095902912 12:47346951-47346973 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1095954989 12:47800739-47800761 GTGGCTGAAGCCACTGGTCTTGG - Intronic
1096552694 12:52383768-52383790 GGAGCTTATTCTGCTGCTCTAGG + Exonic
1096599696 12:52720874-52720896 GCTGCTGAGGCTGCTGCTCTGGG - Intergenic
1096606247 12:52768516-52768538 GGAGGTCCTGCTGCTGGTCTGGG - Exonic
1096874100 12:54613976-54613998 GGGGGTGCAGCTGCTGGTCGAGG - Intergenic
1097283003 12:57856941-57856963 GATACTGATGCTGCTGGACTGGG - Intergenic
1097301545 12:58024480-58024502 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1097677851 12:62622374-62622396 GGTGCTGGTGCTGCTGCTCCTGG - Intergenic
1097858576 12:64493655-64493677 GAGGCTGAAGCTGCTGGCCCAGG - Intronic
1098440384 12:70511513-70511535 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1099072353 12:78061064-78061086 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1099226344 12:79973983-79974005 GCTGCTGCTACTGCTGGTCTGGG + Intergenic
1099987577 12:89685503-89685525 GATGCTGATACTGCTAGTCTGGG - Intronic
1100168566 12:91946262-91946284 GGTGCCCATGCTGCTGGCCTAGG + Intergenic
1100187305 12:92151707-92151729 GACTCTGATGCTGCTGGTTTGGG - Intergenic
1100207395 12:92365401-92365423 AAGGCTGATTCTGCTGGTCCTGG + Intergenic
1100527963 12:95437839-95437861 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1100559561 12:95734439-95734461 GAGGCTGATGGTGCTGGTTCAGG + Intronic
1100903035 12:99265196-99265218 GATGCTAATGCTGCTGTTCTGGG - Intronic
1101061441 12:100976646-100976668 GCAGCTAATGCTGCTGGTCACGG + Intronic
1101089794 12:101273606-101273628 GGTGCTGATACTGCTGGTCAGGG + Intergenic
1101447558 12:104748309-104748331 GATGCTGATGCCGCTGGACTAGG - Intronic
1101706719 12:107227406-107227428 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1101740144 12:107494367-107494389 TGGGCTGAGTCTGCTGGTCAGGG + Intronic
1101747518 12:107554749-107554771 GAGGCTGTTGCTGCTGGTTCAGG + Intronic
1101759194 12:107645295-107645317 GGTGCTTCTGCTGCTGCTCTGGG + Intronic
1101761793 12:107664747-107664769 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
1101820312 12:108179165-108179187 GATGTTGATGCTGCTGGTCCAGG - Intronic
1102178929 12:110896975-110896997 GAAGCTGATGCTGCTTGTCCTGG + Intronic
1102202272 12:111065760-111065782 GATGCTGATGCTGCTGGTCCAGG - Intronic
1102494171 12:113307706-113307728 GGGGCTCACGCTGCTGGCCTGGG - Exonic
1102560078 12:113755645-113755667 TGGGCTGGCTCTGCTGGTCTTGG - Intergenic
1102623810 12:114218472-114218494 TGATCTGATGCTACTGGTCTGGG + Intergenic
1102624847 12:114226738-114226760 GGCGCTGATGCTGCTGGCCCAGG + Intergenic
1102922706 12:116804255-116804277 GGTGCTCATGCTACTGGTCCAGG - Intronic
1102962378 12:117100903-117100925 GGGGCTGATTCTGATGCTCTAGG - Intergenic
1102977625 12:117217930-117217952 GGTGCTGATGCTGCTGTTTTGGG + Intronic
1103026033 12:117574783-117574805 GACGCTGATGGTGCTGGTCCAGG + Intronic
1103058727 12:117842050-117842072 GACGCTGGTGCTGCTGGTTTGGG - Intronic
1103065003 12:117890108-117890130 GATGCTGATGCTGCTGGTCCAGG + Intronic
1103359809 12:120346850-120346872 ATGGCTGATGCTGCTGCACTAGG - Intronic
1103759734 12:123240029-123240051 GAGGCTGTTGCTGCTGGTCCAGG - Intronic
1103972627 12:124681693-124681715 CCGGCGGATGCTGCTGGCCTGGG - Intergenic
1104004911 12:124885101-124885123 CACGCTGGTGCTGCTGGTCTGGG + Intergenic
1104444622 12:128823445-128823467 GGGGCTGGTGCTGGTGGGCCTGG - Exonic
1104488105 12:129169214-129169236 GATGCTGATGCAGCTGGTCTGGG + Intronic
1104595331 12:130116708-130116730 GAGGCTGAAGCTGGGGGTCTGGG + Intergenic
1104794691 12:131509335-131509357 GATGCTGATGCTGCTGGCCCAGG + Intergenic
1104929940 12:132333357-132333379 GGGGGTGATGCTACTGGTGAGGG - Intergenic
1105357890 13:19676361-19676383 GATGGCGATGCTGCTGGTCTAGG + Intronic
1105420913 13:20251585-20251607 GCTGCTGCTGCTGCTGGTCAGGG + Intergenic
1105459305 13:20568604-20568626 GATGCTGAGGCTACTGGTCTGGG - Intronic
1105982671 13:25534922-25534944 GAGGCTGATGCCGATGGTGTAGG + Intronic
1105988706 13:25595828-25595850 GGGTCTGATGCTGCTGGCCAAGG + Intronic
1106418407 13:29565480-29565502 GGGCCTGCTGTTGATGGTCTAGG + Intronic
1106862998 13:33931404-33931426 GATGCTGATGCTTTTGGTCTGGG + Intronic
1106976991 13:35230810-35230832 GGTGTTGATGCTGCTGATCCAGG - Intronic
1107095495 13:36530824-36530846 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1107434748 13:40372483-40372505 TAGGCTGAAGCTGCTGGTCCAGG - Intergenic
1107583563 13:41818910-41818932 GATACTGATGCTGCTGGTCTGGG - Intronic
1108002490 13:45916937-45916959 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1108095111 13:46893403-46893425 GATGCTGATGCTGCTGGTCCAGG + Intronic
1108235802 13:48403755-48403777 GATACTGATGCTGCTGGTCTGGG + Intronic
1108379665 13:49843963-49843985 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1108382686 13:49869233-49869255 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1108575817 13:51789503-51789525 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1108577420 13:51802288-51802310 GATGCTGATGCAGCTTGTCTGGG - Intronic
1108621758 13:52191697-52191719 GTTGCTAATGCTGCTGGTCAGGG + Intergenic
1108772963 13:53727839-53727861 GATGTTGATGCTGCTGGTCTAGG + Intergenic
1109309240 13:60672462-60672484 GTGGCTCAGGCTGCTGGTCTGGG + Intergenic
1109788925 13:67221937-67221959 GGTACTGATGCTGCTAGTCCAGG - Intronic
1110121249 13:71884544-71884566 TGGGATGACGCTTCTGGTCTGGG + Intergenic
1110278975 13:73670667-73670689 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1110416266 13:75256542-75256564 AATGCTGATGCTGCTGGTCCAGG - Intergenic
1110873349 13:80479166-80479188 GATGCTGGTGCTGCTAGTCTAGG - Intergenic
1111041614 13:82756814-82756836 GTGGCTCAGGCTGCTGGTCCAGG - Intergenic
1111912809 13:94330606-94330628 GGTTCTGATGCTGCAGGCCTGGG - Intronic
1111934942 13:94548960-94548982 GGTGCTGATGCTGCGGATCTGGG + Intergenic
1111962122 13:94823292-94823314 TGTGCTTATGGTGCTGGTCTGGG - Intergenic
1112245166 13:97726823-97726845 GATGTCGATGCTGCTGGTCTGGG - Intergenic
1112290494 13:98141792-98141814 GGGGCTGCTGGTGGTGGTCGTGG + Intergenic
1112336815 13:98523116-98523138 GAGGGAGATGCTGCTGGTCCAGG + Intronic
1112353474 13:98655525-98655547 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1112366000 13:98756001-98756023 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1112372177 13:98803555-98803577 GGTGCTGATGCTGCTGGTCCTGG + Intronic
1112436996 13:99397688-99397710 GACACTGATGCTGCTGGTCCAGG - Intergenic
1112558482 13:100491058-100491080 GCTGCTGCTGCTGCTGGTCAGGG + Intronic
1112680408 13:101758381-101758403 GATGCTGATGCTGTTTGTCTAGG + Intronic
1112781367 13:102904466-102904488 GATGCTGATGCTCCTGGTCTGGG + Intergenic
1112933279 13:104768272-104768294 GATGCTGATGCTGCTTGTATGGG - Intergenic
1112958884 13:105096951-105096973 GAGGTTGATACTGCTGTTCTAGG + Intergenic
1113041545 13:106108486-106108508 GATGCTGAGGCTGCTGGTCCAGG - Intergenic
1113214270 13:108020030-108020052 GTGGCTCAGGCTGCTGGTCCAGG - Intergenic
1113265855 13:108617295-108617317 GGGGATGCTGCTGCTGGTCCAGG + Intronic
1113371136 13:109726455-109726477 GAGGCTGCTGCTGCTGCTTTGGG - Intergenic
1113467525 13:110522762-110522784 GGGTCTGCTGCTGCTGGCCGTGG - Intergenic
1113544445 13:111137279-111137301 AGTGCTGGTGCTGCTGGTCCTGG + Intronic
1113696370 13:112348976-112348998 GGGTGTGAGGCTGCTGGTCAAGG - Intergenic
1113952574 13:114080120-114080142 GGGGCAGAGGCCGCTGGGCTTGG + Intronic
1113965532 13:114151143-114151165 GGGGCTGAGACTCCTGGGCTGGG + Intergenic
1113994328 14:16053793-16053815 GGGGCTCATGAGGCGGGTCTTGG + Intergenic
1114172488 14:20287295-20287317 GATGCTGATGCTGCTGGTCTGGG + Exonic
1114452579 14:22836900-22836922 GGGGCTGAAGCTGCTGCTTTGGG - Exonic
1114832739 14:26164461-26164483 GTAGCTGAAGCTGCTGATCTGGG + Intergenic
1115085438 14:29509409-29509431 GTGGCAAATACTGCTGGTCTGGG + Intergenic
1115179384 14:30604590-30604612 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1115503177 14:34067222-34067244 GATGTTGATGCTGCTGGTCCAGG + Intronic
1115550717 14:34502765-34502787 GGTGCTGATTCTGCTGGTCTGGG + Intergenic
1115773447 14:36689681-36689703 GGTGCTGATGGTGGTGGTGTGGG - Intronic
1115963641 14:38863410-38863432 GTGGCTTAGGCTGCTGGTCCAGG + Intergenic
1116820480 14:49621616-49621638 GGAGCTGGTGCTGGTGGTCCAGG + Exonic
1116831588 14:49725494-49725516 GGTGGTGCTGCTACTGGTCTGGG + Intronic
1117021030 14:51570596-51570618 GGTGTTGATGCTGCTGGTCTGGG - Intronic
1117258671 14:54006469-54006491 GATGCTGATGCTACTGGTCCAGG - Intergenic
1117433224 14:55691117-55691139 GCAGCTAATGCTGCTGGTTTGGG + Intronic
1117775947 14:59184639-59184661 GATACTGATGTTGCTGGTCTGGG + Intergenic
1117984005 14:61369298-61369320 GATACTTATGCTGCTGGTCTTGG + Intronic
1118060004 14:62125976-62125998 GATGCTGATGCTGCCAGTCTGGG - Intergenic
1118621520 14:67618708-67618730 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1119131114 14:72174046-72174068 GGGGCTGAAGCTGCTTCTCCAGG - Intronic
1119628660 14:76206652-76206674 TGTGCTGATGCTGTTGGCCTAGG - Exonic
1119706024 14:76783064-76783086 GGGGCTAATGCCGCTGGGCTGGG - Intergenic
1119729459 14:76941850-76941872 GTGGCAGCTGCTGCTGTTCTGGG + Intergenic
1119741643 14:77017616-77017638 GGGGCTGGTGCTGTGAGTCTTGG + Intergenic
1119943655 14:78668540-78668562 AGGGAAGATGCTGCTGGTGTGGG + Intronic
1119972287 14:78984745-78984767 GATGCAGATGCTGCTGGTTTAGG + Intronic
1120411077 14:84156657-84156679 GATATTGATGCTGCTGGTCTTGG - Intergenic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1120942699 14:89964012-89964034 GATGCTGAGGCTGCTGGTCCAGG - Intronic
1121080061 14:91100662-91100684 GAGGCTGGTGCTGCTGGTCTGGG - Intronic
1121226542 14:92325317-92325339 GGTGCTGATTCTGCTGGTCCAGG - Intronic
1121451472 14:94010999-94011021 GTGGCAGATGCTGCTGGTCCTGG + Intergenic
1121453105 14:94021957-94021979 GGACCTCCTGCTGCTGGTCTTGG + Intergenic
1121551916 14:94809380-94809402 GAGGCTGGTGCTGCCGGTCCAGG - Intergenic
1121702306 14:95963748-95963770 GATGCTGATGCTGCCGGTCCTGG + Intergenic
1122122178 14:99560551-99560573 GGGCGTGATGCTGGCGGTCTGGG - Intronic
1122312287 14:100804766-100804788 GGGACTGAGGCTGCCGCTCTGGG + Intergenic
1122480742 14:102045830-102045852 GCTGCTGCTGCTGCTGGTTTGGG - Intronic
1122738700 14:103858489-103858511 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1122880415 14:104688273-104688295 GGGGCTGGGGCTGCTGGGCAGGG + Intergenic
1123110187 14:105863615-105863637 GGGGCTCCTTCGGCTGGTCTGGG - Intergenic
1123194926 14:106606829-106606851 TGTGCTGAAGATGCTGGTCTGGG + Intergenic
1123473724 15:20572417-20572439 GGGGCTGGGGCTCCTGGACTGGG - Intergenic
1123644285 15:22427936-22427958 GGGGCTGGGGCTCCTGGACTGGG + Intergenic
1123734024 15:23167428-23167450 GGGGCTGGGGCTCCTGGACTGGG - Intergenic
1123755932 15:23397726-23397748 GAGGCTGATGCTGCTCCACTGGG - Intergenic
1124158674 15:27250197-27250219 GGAGCTGATGGTGCTCCTCTAGG - Intronic
1124284527 15:28388739-28388761 GGGGCTGGGGCTCCTGGACTGGG - Exonic
1124298170 15:28522875-28522897 GGGGCTGGGGCTCCTGGACTGGG + Exonic
1124360849 15:29035713-29035735 GATGCTGAGGCTGCTGGTCCAGG - Intronic
1124430457 15:29603286-29603308 GCTGCTGATGCTGCTGTTCTGGG - Intergenic
1124645956 15:31437671-31437693 GGGGCTGAGGCTGCTGGCCAGGG + Intergenic
1124686857 15:31790323-31790345 GATGCTGATGCTGCAGGCCTAGG + Intronic
1124712008 15:32021312-32021334 GGGGAGGATGGTGCTTGTCTTGG + Intergenic
1124808362 15:32908677-32908699 GTTGTTGATGCTGCTAGTCTAGG - Intronic
1124817988 15:33015929-33015951 GATGCTGATGCTCCTGGTCCAGG - Intronic
1124959057 15:34381733-34381755 GGGGCTGGGGCTCCTGGACTGGG + Exonic
1124975683 15:34527954-34527976 GGGGCTGGGGCTCCTGGACTGGG + Exonic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1125423963 15:39531469-39531491 GATGCTGAAGCTGCTGGTGTAGG - Intergenic
1125429882 15:39582971-39582993 GATGCTGATGCCGGTGGTCTGGG + Intronic
1125968551 15:43893700-43893722 GGGGCTGAGGCTGCTGGGCCAGG + Intronic
1125973776 15:43933487-43933509 GATGCTGCTGTTGCTGGTCTGGG + Intronic
1126141502 15:45443099-45443121 GAAGCTGATGCTCCTGGTCTGGG + Intronic
1126734687 15:51718987-51719009 GATACTGATGCTGTTGGTCTAGG - Intronic
1126851671 15:52801025-52801047 GCTGCTGCTGCTGCTGCTCTTGG + Intergenic
1126906642 15:53375065-53375087 GGTGTTAGTGCTGCTGGTCTAGG + Intergenic
1126924062 15:53562491-53562513 GATGCTGATGCTGCTGGTCCAGG + Intronic
1126994225 15:54421470-54421492 CTAGCTGATGCTGCTGGTCCAGG - Intronic
1127001723 15:54516451-54516473 GACGCTGATGCTACTGGTCTGGG + Intronic
1127289919 15:57561085-57561107 GATGCCAATGCTGCTGGTCTGGG + Intergenic
1127377554 15:58398871-58398893 AACGCTGATGCTGCTGGTCTAGG - Intronic
1127386086 15:58468332-58468354 GATGCTGATGCTGCTGGTTTGGG - Intronic
1127428576 15:58880428-58880450 GGTGCTGCTGCTGCTGGTTTGGG - Intronic
1127473672 15:59312684-59312706 GTTGCTGATGCTGCTGGTTTGGG - Intronic
1127638675 15:60894731-60894753 GGAGCTGATGCTGCTGGCCTGGG + Intronic
1127833107 15:62768126-62768148 GCTGCTGAAGCTGCTGATCTGGG - Intronic
1128080362 15:64853625-64853647 GGTGCGAATGCTGCTGGCCTAGG + Intronic
1128229774 15:66026302-66026324 GGTGCTGATGCTGCAGGACCGGG + Intronic
1128234141 15:66056018-66056040 GGTGCTGCTGCTGCTGGTTTAGG - Intronic
1128338530 15:66803670-66803692 GCTGCTGATGCTGCTGGTTCAGG - Intergenic
1128343336 15:66837740-66837762 GGTGCTGATGCTGCCAGTCTAGG + Intergenic
1128350653 15:66886236-66886258 TGGGCTGAGGCTGGTGGTGTTGG - Intergenic
1128522941 15:68387392-68387414 GGTGCTGGTGCTGCTGGTCTGGG - Intronic
1128841589 15:70854706-70854728 GCAGCTGATGCTCCTGGTCTGGG - Intronic
1128843373 15:70868655-70868677 GATGCTGATGCAACTGGTCTGGG + Intronic
1129274034 15:74433804-74433826 GCGGCTGCTGCTGCTGCTCTGGG - Exonic
1129653876 15:77510111-77510133 GGGGCTGCTGCTCCTGCCCTTGG + Intergenic
1129760352 15:78125589-78125611 GAGGCTGATGCTGCTGGTCCAGG - Intronic
1129761840 15:78133417-78133439 GACACTGATGCAGCTGGTCTTGG + Intronic
1130175399 15:81563990-81564012 GAGGCTGATGCTGCCAGTCCTGG + Intergenic
1130358177 15:83154452-83154474 GAGGCTTATCCTGCTGATCTGGG - Intronic
1130402813 15:83573402-83573424 GATGCTGATGTTGCTGGTCCAGG - Intronic
1130434805 15:83887049-83887071 GATGCTGATGCTGCAGGTCCAGG - Intronic
1130651535 15:85764736-85764758 GATGCTGATGCTGATGGTTTTGG - Intronic
1130708060 15:86252130-86252152 GATACTGATGCTACTGGTCTGGG + Intronic
1130715431 15:86329264-86329286 GTGGCTCAGGCTGCTGGTCCAGG - Intronic
1130795106 15:87199510-87199532 AATGCTGATGCTGCTGGTCCTGG + Intergenic
1130924416 15:88374563-88374585 GATGCAGTTGCTGCTGGTCTGGG + Intergenic
1130928440 15:88402428-88402450 GGAGCTGCTGCTGCTGGGGTAGG + Intergenic
1131306514 15:91248690-91248712 GAGGCCAGTGCTGCTGGTCTGGG - Intronic
1131329877 15:91487023-91487045 GGTGGTGATGCTGCTGGCCAGGG + Intergenic
1131384131 15:91988727-91988749 GATGCTGATGCTGCTGGTCCAGG + Intronic
1131425563 15:92342931-92342953 GATGCCGATGCTGCTGGCCTGGG + Intergenic
1131439949 15:92452199-92452221 GATGCTGATGCTGCTGGTCTGGG - Intronic
1131481647 15:92787427-92787449 GATGCTGATGGTGCTGGTCTGGG - Intronic
1131514747 15:93069756-93069778 AAGGCTAATGCTGCTGGTCCAGG + Intronic
1131643726 15:94319543-94319565 AAGGCTGATGCTGCTGGCCCAGG + Intronic
1131670056 15:94610341-94610363 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1131764943 15:95665542-95665564 GGGACAGATGCTTCTGGTCCCGG + Intergenic
1131793207 15:95987452-95987474 GAGGCTGCTGCTGCTGGTCAGGG - Intergenic
1132028595 15:98422364-98422386 GATGCTGATGTTGCTGGTCCGGG + Intergenic
1132150353 15:99454326-99454348 GGTGCTGGTGCTGCCGGACTGGG + Intergenic
1132170665 15:99650793-99650815 GCTGCTGCTGCTGCTGGTCAGGG - Intronic
1132225007 15:100133602-100133624 GGGGCTGCTGCTCCTGGCCAGGG - Intronic
1132250221 15:100330429-100330451 GATGCTGATGCTGCTGGCCCGGG + Intronic
1132250949 15:100335059-100335081 GGTGCTGATGCTGCCGTCCTGGG - Intronic
1132252122 15:100341839-100341861 CGTGCTGCTGCTGCTGGTTTGGG - Exonic
1132319293 15:100913766-100913788 GAGGCTGATGCTGCTGGTCTGGG + Intronic
1132335682 15:101046936-101046958 GAGGCTGATTTTGCTGGTATAGG - Intronic
1132374775 15:101321769-101321791 GGTTCTGATGCAGCAGGTCTGGG - Intronic
1132426266 15:101719967-101719989 GATGCCCATGCTGCTGGTCTGGG + Intronic
1132673985 16:1114166-1114188 GGGGCTGAGGCTGGTGGAGTGGG - Intergenic
1132809865 16:1792366-1792388 GGCGCTGCTGCTGCTGTCCTGGG - Exonic
1133011170 16:2912438-2912460 GGGGCTGATGCTGCGGGTCCAGG - Intronic
1133021165 16:2967557-2967579 GGTGCTGCTGCTGCTGCTCCTGG + Exonic
1133128761 16:3663573-3663595 GGGTCTGATGGAGCTGCTCTTGG - Exonic
1133152822 16:3849760-3849782 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1133266552 16:4588068-4588090 GGGTCTGATGCTTCTAGTTTGGG - Intronic
1133401658 16:5492021-5492043 AACGCTGATACTGCTGGTCTGGG - Intergenic
1133419189 16:5631206-5631228 GTGGCTGATGTTACTGGTCAGGG + Intergenic
1133726834 16:8545671-8545693 GAGGCTGATGCTGCTGATCTGGG + Intergenic
1133799518 16:9073770-9073792 GGCGCTGAAGCTGCTGGTCCTGG + Intergenic
1133811044 16:9161292-9161314 GACGCTGATGTTGGTGGTCTGGG - Intergenic
1133864808 16:9632722-9632744 GATGCTGATGCTGCCTGTCTGGG + Intergenic
1133907527 16:10035664-10035686 GATGCTGATGCTGCTGGTCCAGG + Intronic
1134084445 16:11346721-11346743 GATGCTGATGCTGCTGGTCTGGG + Intronic
1134360350 16:13525173-13525195 GGTGCTGATGATGCTAGCCTGGG + Intergenic
1134502725 16:14781730-14781752 ATGGCAGATGCTGCTGGCCTGGG - Intronic
1134567706 16:15265615-15265637 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134577838 16:15347165-15347187 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134630466 16:15752473-15752495 CCAGGTGATGCTGCTGGTCTAGG - Intronic
1134642955 16:15843876-15843898 GATGATGATGATGCTGGTCTAGG + Intronic
1134724750 16:16410381-16410403 ATGGCAGATGCTGCTGGCCTGGG - Intergenic
1134734731 16:16490738-16490760 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1134751694 16:16630299-16630321 GATGCTGGTGCTGCTGGTCTGGG + Intergenic
1134761520 16:16718944-16718966 GGTGCTGATGCTGCTGGCCCAGG - Intergenic
1134769862 16:16798819-16798841 GATGCTGATGCTGGTGGTCCAGG + Intergenic
1134932742 16:18221168-18221190 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134942682 16:18301478-18301500 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134984538 16:18640226-18640248 GGTGCTGATGCTGCTGGCCCAGG + Intergenic
1134993766 16:18723324-18723346 GATGCTGGTGCTGCTGGTCTGGG - Intergenic
1135046317 16:19158912-19158934 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1135233075 16:20727851-20727873 GATGCTGATGTTGCTGGTTTGGG - Intronic
1135324887 16:21520098-21520120 GGGGCTGGCGCTGGTGGTGTGGG - Intergenic
1135635981 16:24076113-24076135 GATGCTGACGCTGCTAGTCTGGG + Intronic
1135685743 16:24497128-24497150 GAGGCTGATGTTGCTGGCCCAGG + Intergenic
1135851364 16:25966955-25966977 GATGCTGATGCTGCAGGCCTGGG - Intronic
1135856961 16:26020595-26020617 GATGCTGGTGCTGCTGCTCTGGG + Intronic
1135958032 16:26972563-26972585 GCTGCTGACACTGCTGGTCTGGG - Intergenic
1136098392 16:27975115-27975137 GATGCTGATGCTGCCGGCCTGGG + Intronic
1136928423 16:34396547-34396569 GACGCTGATGTTGCTGGTCTAGG - Intergenic
1136976151 16:35015257-35015279 GACGCTGATGTTGCTGGTCTAGG + Intergenic
1137507528 16:49067372-49067394 GATGCTGATGATGCTGGTCCAGG - Intergenic
1137715420 16:50595449-50595471 TGGCCTGATGCTGGTGGTCCTGG + Intronic
1137893790 16:52189530-52189552 GATGCTGGTGCTACTGGTCTGGG - Intergenic
1138292552 16:55860358-55860380 GATGCTGATGCTGCTGGTCTAGG - Intronic
1138474364 16:57262049-57262071 GGTGCTGGGGCTGCTGGTGTGGG - Exonic
1138645150 16:58419243-58419265 GGTGCTGATGCAGCTGGCCTGGG - Intergenic
1138939439 16:61772751-61772773 GAGGCTGATGCTGCAGGTCCAGG - Intronic
1139153765 16:64415893-64415915 GATGCTGATAGTGCTGGTCTAGG + Intergenic
1139164566 16:64550787-64550809 GATGCAGATGCTGCTGGTTTAGG + Intergenic
1139523046 16:67496239-67496261 TAGGCTGATGCTGTTGGTGTGGG - Intergenic
1139656277 16:68388990-68389012 GGAGCTGATTCTGCTTGCCTGGG - Intronic
1139854112 16:69967223-69967245 GATGCTGAGGCTGCTGGACTGGG - Intergenic
1139883093 16:70190137-70190159 GATGCTGAGGCTGCTGGACTGGG - Intergenic
1140369415 16:74405383-74405405 GATGCTGAGGCTGCTGGACTGGG + Intergenic
1140378583 16:74465550-74465572 GCTGCTGCTGCTGCTCGTCTAGG + Intronic
1140451697 16:75075920-75075942 GGGGCAGTTGCTGCAGGTGTAGG + Intronic
1140525226 16:75617435-75617457 GATGCTGATGCTGCTGGTACAGG - Intronic
1140687929 16:77451450-77451472 GATGCCGATGCTGCTGGTCTGGG - Intergenic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140951298 16:79820403-79820425 GGTGTTGATGCTGCTGGTCTAGG + Intergenic
1141012597 16:80416906-80416928 GTTGCTGATGCTGCTGGTCCAGG + Intergenic
1141090064 16:81124023-81124045 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1141196318 16:81864235-81864257 GATGTAGATGCTGCTGGTCTGGG + Intronic
1141534906 16:84672593-84672615 GTGGCTGATTCAGCTGGTCTGGG - Intergenic
1141536579 16:84685336-84685358 GGGGCTAACGCTGCCGGTCCAGG + Intergenic
1141987503 16:87589401-87589423 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1141991273 16:87611789-87611811 GATGCTGAGGCTGCTGATCTGGG + Intronic
1142033135 16:87848335-87848357 CGTGCTGCTGCTGCTGGGCTGGG + Intronic
1142034944 16:87856935-87856957 GAGGCTGGTGCTGCCGGCCTGGG + Intronic
1142037092 16:87869155-87869177 GGGGCTGGCGCTGGTGGTGTGGG - Exonic
1142130012 16:88428102-88428124 GGGGCTGGTGCCCCTGCTCTGGG - Exonic
1142255829 16:89013476-89013498 GGGGCTGAAGCTGCTGGGCAGGG + Intergenic
1142280007 16:89143019-89143041 GGGGCTGGTGCTGCTGGAGATGG + Intronic
1143027947 17:3951970-3951992 GCTGCTGCTGCTGCTGGTCTGGG - Intronic
1143152182 17:4814573-4814595 GGGGGTGCAGCTGGTGGTCTGGG + Intronic
1143323310 17:6081842-6081864 GGAGCTGATGCTGCTGGTCAGGG - Intronic
1143464783 17:7129466-7129488 GGCGCTGCTGCAGGTGGTCTTGG - Intergenic
1143710096 17:8728447-8728469 GATGCTGACGCTGCTGGTCCGGG + Intergenic
1143758876 17:9086900-9086922 GGTGCTGATGCTGATGGTGATGG - Intronic
1143834627 17:9680691-9680713 GATGCCGATGCTGCTGGTCCAGG + Intronic
1143877111 17:10000273-10000295 AACGCTGATGCTGCTGGTCTGGG + Intronic
1143894106 17:10123354-10123376 GGTTCTGTTGCTGCTGGTCCAGG + Intronic
1143942729 17:10559472-10559494 GATACTGATGCTGCTGGTCTGGG - Intergenic
1143970201 17:10789837-10789859 GAGGCTGAGGCTGCTGGTCCAGG + Intergenic
1143994016 17:10991250-10991272 GAGCCTGATGCAGGTGGTCTGGG + Intergenic
1143996977 17:11015032-11015054 GATGCTGATACTGCTGGTCGGGG + Intergenic
1144088586 17:11833066-11833088 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144099390 17:11930586-11930608 GATGCTGATGCTGCTGGTCCAGG - Intronic
1144194242 17:12875212-12875234 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144273633 17:13643893-13643915 GAGGCTGATGCTGCTGGTCCAGG - Intergenic
1144366203 17:14547267-14547289 GGTACTGATGCTGCTGGTCTAGG + Intergenic
1144394103 17:14826843-14826865 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1144479603 17:15617993-15618015 AGTGCTGATGTTGCTGGACTGGG - Intronic
1144483773 17:15648279-15648301 GGGCCTGGAGATGCTGGTCTGGG + Intronic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1144992581 17:19243870-19243892 GCTGCTGATGCTGCCAGTCTAGG + Intronic
1145093949 17:20009062-20009084 GAGGCTGAAGCTGCTGGTCCGGG + Intergenic
1145126239 17:20302289-20302311 GGGGATGATGGTGCAGGCCTGGG - Intronic
1145846586 17:28043180-28043202 GGGGCTGCTGCAGCTGGTCCAGG - Exonic
1146105433 17:30031350-30031372 GATGCTGATGCTGTTGGTCTAGG + Intronic
1146308291 17:31747410-31747432 GGTGCTGAAGCTGTGGGTCTGGG - Intergenic
1146488015 17:33259898-33259920 GATGCTGATGCTGCTGGTCCTGG + Intronic
1146564892 17:33904243-33904265 GATGCTGATGCTGCTTGCCTGGG - Intronic
1146719497 17:35113766-35113788 GTTGCTGATGCACCTGGTCTGGG - Intronic
1146806358 17:35868102-35868124 GATGCTGATGCTGCTGGTCATGG + Intronic
1147547689 17:41415374-41415396 GACACTGATGCTGCTGGTCTGGG + Intergenic
1147721400 17:42541819-42541841 GCTGCTGCTGCTGCTGGTTTTGG - Intronic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148188245 17:45660184-45660206 GGTGCTGATGCTGCTGGTCTGGG + Intergenic
1148329464 17:46804931-46804953 GGGGTTGGTGCTGCTGGCTTGGG - Intronic
1148477236 17:47936848-47936870 AGGGCTGATGATACTGGTTTAGG - Intergenic
1148536755 17:48445467-48445489 GGAGCAGATGCTGCTGATGTGGG - Intergenic
1148740031 17:49887541-49887563 GGGGTAGATGCTGCTGGCATTGG - Intergenic
1149220094 17:54407184-54407206 GATGCTGATGCTGTTTGTCTAGG + Intergenic
1149269998 17:54967671-54967693 GATGCTGATGCTGCCGGTCCTGG + Intronic
1149358159 17:55865595-55865617 GTTGATGATGCTGCTGGTCTAGG + Intergenic
1149392620 17:56207193-56207215 GATGCTGATGCTGCTGTTCAGGG - Intronic
1149462089 17:56837061-56837083 GATGCTGATGCTGCTGGTCTAGG - Intronic
1149496031 17:57118091-57118113 GGTGCTGCTGCTGGTGGTATTGG + Intronic
1149626667 17:58084455-58084477 GTGACTGAGGCTGCTGGCCTGGG + Intronic
1149660606 17:58332389-58332411 GGGGCTTGGGCTGCTGGTCTGGG - Intergenic
1149865220 17:60147850-60147872 GAGGCTGGGGCTGCTGGGCTGGG + Intergenic
1150148171 17:62788428-62788450 GGGGCTGCTGCTGCTGCTGGTGG - Intronic
1150556194 17:66256769-66256791 GATGGTGATGCTGCTGGTCTGGG - Intergenic
1150819582 17:68424555-68424577 GGAGCTGATGCTCCAAGTCTTGG + Intronic
1150893175 17:69178395-69178417 GACGTTGATGCTGCTGGTCTGGG - Intronic
1150998748 17:70349694-70349716 GATGCTGATGCTGCTGGTTTTGG + Intergenic
1151213028 17:72559040-72559062 GATGCAGATGCTGCTGGTCAGGG - Intergenic
1151269681 17:72984542-72984564 GTTGCTGATGCTGCTGGCCTTGG - Intronic
1151283528 17:73093516-73093538 GTTGCTGATGCTGCTGTCCTGGG + Intergenic
1151287063 17:73119806-73119828 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1151372912 17:73660302-73660324 GATGCTGATGATGCTGGTCCAGG + Intergenic
1151453591 17:74213673-74213695 GGGGCTGAAGGTGCTGTTCACGG - Exonic
1151576067 17:74953197-74953219 GGGGCAAAGGCTGCTGGGCTGGG - Intronic
1152146497 17:78571872-78571894 GGTGCTGCTGCTGGTGGTTTGGG - Intronic
1152191456 17:78890715-78890737 AGATCTGCTGCTGCTGGTCTCGG + Exonic
1152251715 17:79215994-79216016 AGGGCTGGAGCTGATGGTCTTGG + Intronic
1152730483 17:81967396-81967418 GGGGCGGCTGCTCCTGGGCTTGG + Intergenic
1152933783 17:83124352-83124374 AGAGCTTATGCTGCTGGGCTGGG + Intergenic
1153552285 18:6274176-6274198 GACACTGATGCTGCTGGTTTGGG - Intronic
1153555594 18:6310080-6310102 GATGCTGATGCTGCTGGTCCAGG + Intronic
1154006310 18:10530510-10530532 AGTGCTGATGGTGCTGGTCCAGG + Intronic
1154007818 18:10548021-10548043 GGCACTCCTGCTGCTGGTCTGGG - Intronic
1155209449 18:23587681-23587703 GATGCTCCTGCTGCTGGTCTGGG - Intergenic
1155395121 18:25378752-25378774 GGGGATGTTGCTGCTAGTTTTGG - Intergenic
1156014327 18:32531068-32531090 GATGCTGATGCTGCTGGTTTGGG - Intergenic
1156324802 18:36064728-36064750 CGGGTTGTTGCTGCTGGTTTGGG - Intronic
1156367182 18:36440168-36440190 GATGCTGATGCTGCTGGTCCAGG + Intronic
1156427867 18:37035271-37035293 GATGCTGATGCTGCTGGACTGGG - Intronic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1156811045 18:41251773-41251795 GGGTCTGAGGCTTCTGGACTTGG + Intergenic
1156844514 18:41648907-41648929 GATGCTGATGCTGCTGGTTCAGG - Intergenic
1157059544 18:44271763-44271785 GAGGCTGATGCTGCTGACCCAGG + Intergenic
1157120021 18:44900639-44900661 GATGCTGATGCTGCTGGTCTGGG - Intronic
1157128534 18:44981001-44981023 GAGGCAGATGCTATTGGTCTGGG - Intronic
1157201430 18:45663221-45663243 GATGCTGATGCTACTGGTCCAGG + Intronic
1157215128 18:45776105-45776127 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1157617578 18:48996308-48996330 AAGGCTGAGGCTGCTGGTCTAGG + Intergenic
1157672348 18:49541057-49541079 GATACTGATGCTGCTGGTCCAGG + Intergenic
1157710434 18:49846356-49846378 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157742092 18:50102662-50102684 GGTGCTGCTGCTCCTGGTCTAGG - Intronic
1157807749 18:50670807-50670829 GAAGCTGAGGCTGCTGGTGTGGG - Intronic
1157921498 18:51717674-51717696 GATACTGATGCTGCTGGTCTGGG - Intergenic
1157930208 18:51813387-51813409 GGTGCTGCTGCTACTGGTCTGGG - Intergenic
1157931100 18:51824382-51824404 GGGCCTGATCCTGCCGGTATAGG + Intergenic
1157940332 18:51921646-51921668 GTGGCTCAGGCTGCTGATCTAGG - Intergenic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158688509 18:59638420-59638442 GGTGCTGATGCTGCTGGTCCAGG - Intronic
1158857387 18:61556473-61556495 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1158900550 18:61957961-61957983 GCGGCTGCTGGTGCTGCTCTGGG - Intergenic
1158928913 18:62301679-62301701 GGTGCTAATGCTGCAGGTCTAGG + Intronic
1159085252 18:63782803-63782825 GGTGCTGATGATCCTGGTCTGGG - Intronic
1159530694 18:69651775-69651797 GGGGCTGATGGGGCTGGGCGCGG - Intronic
1159783008 18:72681064-72681086 GCTGCTGATGTTGCTGGTCTGGG - Intergenic
1159836738 18:73345943-73345965 GGGGCTGCTGGTGCAAGTCTTGG + Intergenic
1160290299 18:77586920-77586942 GATGGTGATGCTGCTGGTCCAGG - Intergenic
1160618840 18:80155621-80155643 GATGCTGATGCTGCTGGTGCAGG - Intronic
1160725230 19:614878-614900 GCGGCTCATGCTGCTGTTCGTGG + Intronic
1160789667 19:917652-917674 GGCGCTGATGCTGCTGGGCCTGG + Exonic
1160977402 19:1800053-1800075 GAGGCTGGTGCTGCGGGCCTTGG + Exonic
1161224449 19:3136573-3136595 GGAGCTGAAGCTGCTGCTTTTGG + Exonic
1161305296 19:3564125-3564147 GGGGCTGCTGGTGATGGGCTGGG - Intronic
1161697415 19:5777242-5777264 GGAGCTGATCCTCCTAGTCTGGG - Intronic
1161734305 19:5981513-5981535 CATGCTGATGCTGCTGGTGTGGG - Intergenic
1162030004 19:7913249-7913271 TGGGCTGGGGCTGCTGCTCTGGG + Exonic
1162035684 19:7937476-7937498 GGAGCCACTGCTGCTGGTCTGGG + Intronic
1162718400 19:12647856-12647878 GGGGCTGAAGCCGCGGGGCTGGG + Intronic
1162832617 19:13296127-13296149 GAGGCTGATACTACTGGTCCAGG - Intronic
1163420246 19:17210158-17210180 GGGGCTGATTCTTCTGCTATGGG - Intronic
1164231010 19:23288889-23288911 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1164247430 19:23444559-23444581 GGGGCTGATGGTGATGACCTGGG - Intergenic
1165393699 19:35552421-35552443 GATGGTGATGCTGCTGGTCTGGG + Intronic
1165448542 19:35869567-35869589 GGGGCTGGTGCTGGGGGTCTCGG + Intronic
1165741381 19:38207115-38207137 GAGGCCGAGGCTGCTGGTCAGGG - Exonic
1165756500 19:38296263-38296285 GCTGCAGATGCTGCTGGACTTGG - Intronic
1165788193 19:38474916-38474938 GGGGCTGCTGCTGCTGGGCGGGG + Intronic
1165908796 19:39211011-39211033 GATGCTGATGCTGTTGGTCCAGG - Intergenic
1165989728 19:39803335-39803357 CAAGCTGATGCTGCTGGTCTGGG - Intergenic
1166041953 19:40208934-40208956 GATGGTGATGCTGCTGTTCTGGG + Intronic
1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG + Intergenic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1167220185 19:48194276-48194298 GATGGTGATGCTGCTGGTCCAGG + Intronic
1167264702 19:48477822-48477844 GGGGCTCAGGCTCCTGGGCTGGG + Intronic
1167332342 19:48864030-48864052 GACGCTGATGCTGCTGGTCTGGG + Intronic
1167411786 19:49348483-49348505 TGCGTTGATGCAGCTGGTCTGGG - Intronic
1167456594 19:49599550-49599572 GGGGCTGGGGCTGCAGGCCTCGG - Exonic
1167513393 19:49908947-49908969 GGTGCTGCTGCTGCTGGTGGTGG + Exonic
1167998102 19:53423109-53423131 GGGGCTGATGGTGATGGCCTGGG - Intronic
1168007580 19:53503703-53503725 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1168422172 19:56211594-56211616 GGTGCTGATGCTGCTGGTCTTGG + Intergenic
1168423385 19:56219789-56219811 GGTGCTCATGCTGCTGGTCTTGG - Exonic
1168427412 19:56249888-56249910 GATGCTGATGCTGCTGGTCTTGG + Intronic
1168453062 19:56480911-56480933 GGGGCTGAGGCTCTTTGTCTTGG - Intergenic
1202697020 1_KI270712v1_random:132698-132720 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
925070899 2:965644-965666 GGGGCTGCTGCTGCTGGCGGGGG + Intronic
925382145 2:3436075-3436097 GGCCCTGATGCAGCAGGTCTGGG + Intronic
925731410 2:6921773-6921795 TGGGGCGATGCTGTTGGTCTGGG + Intronic
925768327 2:7259168-7259190 GTGGCTCAGGCTGCTGGTCCAGG - Intergenic
925922596 2:8647348-8647370 GAGGCTGAAGCCGCTGGTTTGGG - Intergenic
926025992 2:9545119-9545141 GATGATGATGCTGCTGGTTTGGG - Intronic
926142070 2:10373747-10373769 GGGGGTGGTGCTGGTGGCCTGGG - Intronic
926709802 2:15869901-15869923 GGGGCTGGTGCTGCTGAACACGG - Intergenic
926712174 2:15890467-15890489 GACGCTCATGCTGCTGGTCCTGG - Intergenic
926768827 2:16350020-16350042 GTTGCTGATACTGCTGGTCCAGG + Intergenic
927198432 2:20563868-20563890 GGGTCTGATTCAGCAGGTCTGGG - Intronic
927452275 2:23219331-23219353 GATGCTGATGCTCTTGGTCTGGG - Intergenic
927553841 2:24019219-24019241 GTTGCTGATGCTGCTGGTCCAGG - Intronic
928230060 2:29490443-29490465 GATGCTGATGCCGCTGATCTAGG - Intronic
928579551 2:32693322-32693344 GACGCTGATGCTGCTGGTCCAGG - Intronic
928904941 2:36357681-36357703 TGGGCTGATGATGCTGTTCCGGG + Intronic
928912207 2:36433246-36433268 GTTGCTGAGGCTACTGGTCTAGG + Intronic
928941760 2:36734038-36734060 GATGCTGATGCTGCCGGTCCAGG - Intronic
928961468 2:36930597-36930619 GGTGATAATGCTGCTGATCTGGG + Intronic
929026695 2:37611700-37611722 GATGCTGATGCTGCTGGTTCTGG - Intergenic
929066538 2:37981169-37981191 GATGCTGATGCTTCTGGTCTTGG + Intronic
929098490 2:38286421-38286443 GGGCCTGAGGCTGGTGGTCTGGG - Intergenic
929125413 2:38519052-38519074 CATGCTGATGCTGCTGGTCTAGG - Intergenic
929282897 2:40101917-40101939 GTTGCTGATGCTGCTTGTTTGGG + Intronic
929851297 2:45592795-45592817 GATGCTTATGCTGCTGGTTTGGG - Intronic
930804741 2:55479160-55479182 GATGCTGATGCTGCTGGTCCAGG + Intergenic
930865401 2:56117902-56117924 GGTGCTGCTGCTGCTGGCCCAGG - Intergenic
931569193 2:63650327-63650349 GATGCTTATGCTGCTGGTCCAGG + Intronic
931721725 2:65071862-65071884 GGGGGTGATGCTTCTGGGCTAGG + Exonic
931731144 2:65154472-65154494 GATGCTGATGCTGCTGGTCCAGG - Intergenic
931828100 2:66022305-66022327 GATACTGATGCTACTGGTCTAGG - Intergenic
931906553 2:66849381-66849403 GGGGCTGCTGCTCCTTCTCTTGG - Intergenic
932042656 2:68317748-68317770 GATGCTGATACTGCTGGTCCAGG - Intronic
932130730 2:69185115-69185137 GATGCTGATGCTGCTGTTCCAGG - Intronic
932132341 2:69199281-69199303 GATGCTGATGCTGCTGGTCTGGG + Intronic
932272358 2:70421671-70421693 GATGCTGATGTTGCTGGTATAGG + Intergenic
932416744 2:71578199-71578221 GATGCTGATGCTGCTGGTCCAGG + Intronic
932443104 2:71750471-71750493 GATGCTGATGCTGCTGGTCCAGG + Intergenic
932621874 2:73269484-73269506 GTCGCAGATGCTGTTGGTCTTGG + Exonic
932688661 2:73894234-73894256 GACACTGAAGCTGCTGGTCTGGG + Intronic
932712470 2:74077361-74077383 GATGCTGATGCTGCTGGCCCTGG + Intronic
932873466 2:75426673-75426695 GGTATTGATGCTGCTGGTGTGGG + Intergenic
933283130 2:80354783-80354805 GGTGCTAAAGCTGCCGGTCTGGG + Intronic
933396046 2:81732608-81732630 TATGCTGATACTGCTGGTCTGGG - Intergenic
933691562 2:85182939-85182961 GATGCCGATGCTGCTGGTCCAGG + Intronic
933706465 2:85294463-85294485 GATGCTTATGCTGCTGGTCTGGG + Intronic
933816757 2:86074796-86074818 GCTGCTGCTGATGCTGGTCTGGG + Intronic
933916531 2:86999765-86999787 GTTGCTGATACTTCTGGTCTGGG + Intronic
934006462 2:87770161-87770183 GTTGCTGATACTTCTGGTCTGGG - Intronic
934059770 2:88283241-88283263 GATGCCGATGCTGCTGGTCCAGG + Intergenic
934164739 2:89283710-89283732 GGGGCTCATTCTCCTGGTCTGGG + Intergenic
934202535 2:89898814-89898836 GGGGCTCATTCTCCTGGTCTGGG - Intergenic
934245659 2:90303507-90303529 GGTGATAATGCTGCTGATCTGGG - Intergenic
934263087 2:91493529-91493551 GGTGATAATGCTGCTGATCTGGG + Intergenic
934278181 2:91589712-91589734 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
934578924 2:95422721-95422743 AATGCTGATGCTGCTAGTCTGGG + Intergenic
934588392 2:95525992-95526014 GAGGCTGATGCCGCTGGCCCAGG + Intergenic
934600523 2:95653982-95654004 AATGCTGATGCTGCTAGTCTGGG - Intergenic
934609125 2:95721722-95721744 GGGGCTCATGCTGCTGACCCAGG - Intergenic
934628273 2:95884004-95884026 GACGCTGATGCTGCTGGTCTTGG - Intronic
934628520 2:95887755-95887777 GACGCTGATGCTGCTGGTCTTGG - Intronic
934631092 2:95923325-95923347 GACGCTGATGCTGCTGGTCTTGG - Intronic
934656248 2:96118028-96118050 GTGGCTGGGGGTGCTGGTCTGGG - Intergenic
934668595 2:96192231-96192253 GAGTCTGATGCTACTGGTCTGGG - Intronic
934716029 2:96544397-96544419 GGGGCTAATGCAGCTGGTACTGG + Intronic
934802953 2:97185658-97185680 GATGCTGATGCTGCTGGTCTTGG + Intronic
934805007 2:97213762-97213784 GACGCTGATGCTGCTGGTCTTGG + Intronic
934832229 2:97539863-97539885 GACGCTGATGCTGCTGGTCTTGG - Intronic
934832476 2:97543620-97543642 GACGCTGATGCTGCTGGTCTTGG - Intronic
934833246 2:97554889-97554911 GATGCTGATGCTGCTGGTCTTGG - Intronic
935177937 2:100665436-100665458 GATGCTGATAGTGCTGGTCTGGG + Intergenic
935181014 2:100691340-100691362 GGGGCTGCTGCTGCTACTCAAGG + Intergenic
935232171 2:101108609-101108631 TGGCCTGATGTTGCTGGTCTTGG - Intronic
935322362 2:101901581-101901603 GGTGCTGAGGCTGCTGGTTTGGG + Intergenic
935471181 2:103462824-103462846 GCTGCTGATGCTTCTGGTTTTGG + Intergenic
935557492 2:104526257-104526279 GATGCTGATGCTGCTGGTCCAGG + Intergenic
935619072 2:105113059-105113081 GATGCTGATCCTGCTGGTCCAGG + Intergenic
935623442 2:105148289-105148311 GGTGCTGCTGCTGCTGGTCTGGG - Intergenic
935709564 2:105885665-105885687 GGTGGTGATGCTGCTGCTTTTGG + Intronic
935763330 2:106341827-106341849 GATGCTAATGCTGCTGGTCCAGG + Intergenic
935770116 2:106411069-106411091 GTTGCTGATACTTCTGGTCTGGG - Intronic
935909979 2:107884855-107884877 GTTGCTGATACTTCTGGTCTGGG + Intronic
936012713 2:108935336-108935358 GATGCTAATGCTGCTGGTCCAGG - Intronic
936131763 2:109849985-109850007 GTTGCTGATGCTTCTGGTCTGGG + Intronic
936174411 2:110206884-110206906 GGTGGTGATGATGCTGATCTAGG - Intergenic
936212934 2:110521500-110521522 GTTGCTGATGCTTCTGGTCTGGG - Intronic
936394073 2:112106296-112106318 GATGCTCATGCTGCTGGCCTAGG - Intronic
936422074 2:112376056-112376078 GTTGCTGATACTTCTGGTCTGGG - Intronic
936652762 2:114448493-114448515 GATGCTGATACTGCTGGTCTAGG - Intronic
936880757 2:117247730-117247752 GGTGCTGATACTGCTGGTCAGGG + Intergenic
936918542 2:117664213-117664235 GATGCTGATGCTGCTGGCCTGGG - Intergenic
937011141 2:118563762-118563784 GGTGCTGCTGCTGCTGGTGCAGG + Intergenic
937123641 2:119458757-119458779 GTTGCTCATGCTGCTGGTCCAGG - Intronic
937200877 2:120203914-120203936 GGGGCTGCTGCAGTTGGTCCAGG + Intergenic
937228308 2:120382425-120382447 GATACTGAGGCTGCTGGTCTGGG - Intergenic
937324882 2:120984670-120984692 CTGGCTGGTGCTGCTGGCCTCGG - Exonic
937442584 2:121929598-121929620 GAGGCTGATGTTGCTGGTCCCGG - Intergenic
937777167 2:125791816-125791838 GGGGCTGCTGCTGTTACTCTGGG + Intergenic
937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG + Intergenic
937890882 2:126937762-126937784 GAGGCTGATGTTGTTAGTCTGGG - Intergenic
937915581 2:127097276-127097298 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915606 2:127097368-127097390 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915619 2:127097414-127097436 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937956062 2:127422420-127422442 GCGGCGGCTGCTGCTGGTCCAGG - Intronic
937968582 2:127533348-127533370 AGGGCTGACGCTGCTGCTCCTGG - Intergenic
938061476 2:128258443-128258465 GGGGCTGTGGCAGCTGGTCTTGG + Intronic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
938537329 2:132257082-132257104 GGGGCTCATGAGGCGGGTCTCGG - Intronic
938580170 2:132638515-132638537 GGCGCTGATGCTGCTGTTCCAGG + Intronic
938604425 2:132877571-132877593 GAGGCTGACGCTGCTGGTCCAGG + Intronic
938644170 2:133314471-133314493 GTTTCTAATGCTGCTGGTCTGGG + Intronic
938842880 2:135180088-135180110 GATACTGATGCTGCTGGTCTAGG - Intronic
938904065 2:135822437-135822459 AATGTTGATGCTGCTGGTCTGGG + Intronic
938922728 2:136009771-136009793 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
939076648 2:137610299-137610321 GATGTTGATGCTGCTGGTCCTGG + Intronic
940126062 2:150326261-150326283 GCTGCTGATGCTGCTAGTCTGGG - Intergenic
940170473 2:150824709-150824731 TGTGCTGATGCTACTAGTCTGGG - Intergenic
940514470 2:154663791-154663813 TATGCTGATGCTGCTGGTCTGGG - Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940755924 2:157683549-157683571 GGGGCTGAAGCAGCAGGACTGGG + Intergenic
940805773 2:158184915-158184937 GATGCTGATTGTGCTGGTCTGGG + Intronic
940839950 2:158568401-158568423 GGTGCTGATGTTGCTGGTTCAGG + Intronic
940969948 2:159884811-159884833 GATGCTGATGCTGTTGGTCTGGG + Intronic
940970538 2:159892060-159892082 AGTGCTGATAATGCTGGTCTGGG - Intronic
940982299 2:160017327-160017349 GATGTTAATGCTGCTGGTCTGGG + Intronic
941068008 2:160924960-160924982 GATGCTCATGCTGCTGGTCCAGG + Intergenic
941291038 2:163675419-163675441 GATGCTGTTGCTGCTGGTCCAGG - Intronic
941477783 2:165969877-165969899 GATGCTGTTGCTGTTGGTCTGGG + Intergenic
941552071 2:166929060-166929082 GAGGCTGAGGCTGCTGGTTGGGG - Intronic
941746762 2:169095197-169095219 GATGCTGATGCTGCTGGTCCAGG - Intronic
941888108 2:170550462-170550484 GGATAAGATGCTGCTGGTCTGGG + Intronic
941906828 2:170724760-170724782 GATGCTGATGCTGCAGGTCTGGG - Intergenic
941990201 2:171548211-171548233 GATGCTAATGCTGCTGTTCTAGG - Intronic
942138234 2:172950957-172950979 GATGTTGATGCTGCTGGTGTGGG - Intronic
942231169 2:173862012-173862034 GGTGCTGATGCTGCTGAACTGGG - Intergenic
942241229 2:173965073-173965095 GGGGCCGCTGCCGCCGGTCTCGG - Intronic
942364365 2:175208007-175208029 GGTGCTGGTGCTGCTGGTCCAGG + Intergenic
942503404 2:176616390-176616412 GAAGCTGTTGCTGGTGGTCTGGG - Intergenic
942577056 2:177374804-177374826 AATGCTGATGTTGCTGGTCTGGG + Intronic
942657504 2:178229494-178229516 GATGCTAATGCTGCTGGTCTGGG - Intronic
942719128 2:178929807-178929829 GGTAATGATGCTGCTGGTCTCGG - Intronic
942959160 2:181809169-181809191 GAGGCTGATGCTTCTGGTCTAGG + Intergenic
943056818 2:182992118-182992140 GTTGCTGATGTTGCTGGTCTAGG + Intronic
943139861 2:183968734-183968756 GATGCTGATGCTTCTGGTTTGGG + Intergenic
943143644 2:184015239-184015261 GTGGCTGCTTCTGCTGGCCTAGG + Intergenic
943598359 2:189884845-189884867 GATGCTGATGCTGCTGGTTCAGG + Intronic
943616778 2:190101483-190101505 GAGGCTCAGGCTGCTGGTCCAGG - Intronic
943736884 2:191366039-191366061 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
943777722 2:191785156-191785178 GGTGAGGATGATGCTGGTCTGGG + Intergenic
944207248 2:197169633-197169655 GATGCTGATGCTGCTGGTTGGGG - Intronic
944353774 2:198760821-198760843 TTTGCTGGTGCTGCTGGTCTGGG - Intergenic
944402575 2:199345117-199345139 GGGGCTGGTGCTGCTGCTGCTGG + Intronic
944402577 2:199345123-199345145 GGTGCTGCTGCTGCTGGTGGTGG + Intronic
945145552 2:206734452-206734474 GATGCTGATGCTACTGATCTGGG - Intergenic
945378615 2:209111294-209111316 GGGGCTAAAGCAGCTGGCCTTGG - Intergenic
945435824 2:209816630-209816652 GATGCTGATGCTGCTGGTCCAGG + Intronic
945446255 2:209941739-209941761 GATGCTGATGCTGCTGGCCCAGG - Intronic
945661968 2:212697588-212697610 GATGCTGATACTGCTGGTCTAGG + Intergenic
945802537 2:214451074-214451096 AATACTGATGCTGCTGGTCTGGG - Intronic
946261755 2:218498380-218498402 CACGTTGATGCTGCTGGTCTGGG + Intronic
946398904 2:219458345-219458367 GATGCTGATGCTGCTGGTCTGGG - Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
946760008 2:222984132-222984154 GCTGCTGTTGCTTCTGGTCTGGG + Intergenic
946854417 2:223939119-223939141 GATGCTGATGCTGCTAGTCCAGG - Intronic
946938449 2:224746129-224746151 GATGCTGATGCTCCTGTTCTAGG - Intergenic
947118552 2:226796095-226796117 GCTGCTGCTGCTGCTGCTCTCGG + Exonic
947315903 2:228857939-228857961 GATGCTGATGCTCCTGGTCTGGG + Intronic
947328825 2:229006790-229006812 GGTGATGCTGCTGCTGATCTAGG + Intronic
947369717 2:229432642-229432664 GGTGTTGATGCTGCTGGTCTGGG - Intronic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
947499123 2:230659512-230659534 GGGGCTGTTCCTGCAGGTTTTGG - Intergenic
947705568 2:232272848-232272870 GTGGCTAATGCTTCTGCTCTTGG + Intronic
947740313 2:232481855-232481877 GGGCCTGATGCTGCTGCTGTGGG - Intronic
947940065 2:234045888-234045910 GGTGCTGAAGCTGCTGGTCTGGG + Intergenic
948029886 2:234808723-234808745 GGTGCTGCTGCTGCTGATCTGGG + Intergenic
948084773 2:235238291-235238313 GGTGCTGATGCTGCTGGTGCAGG - Intergenic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
948494381 2:238337399-238337421 GGGCCTGGAGCTGCTGGTCCCGG + Intronic
948881084 2:240857485-240857507 GGCACTGCTGCTGCTGGCCTTGG + Intergenic
1168801482 20:646158-646180 GTTGCTGATGCTGCTGTTCAGGG - Intergenic
1168850202 20:971324-971346 GATGCTGATGCTGCTGGTCCAGG + Intronic
1168906238 20:1406107-1406129 GATGCTGATGCTGTTAGTCTGGG + Intergenic
1168958886 20:1854763-1854785 GCTGCTGCTGCTGCTGGTCCTGG - Intergenic
1168995203 20:2128067-2128089 CCAGGTGATGCTGCTGGTCTGGG - Intronic
1169163833 20:3406568-3406590 GGTGCTGATCTTGTTGGTCTGGG - Intronic
1169270882 20:4198574-4198596 GATGCTGATGCTGCTGTTCAGGG - Intergenic
1169325169 20:4669952-4669974 GATGCGGATGCTGCTGGTCCAGG + Intergenic
1169367462 20:5002330-5002352 GATGCTGATGCTACTGGTCTGGG + Intronic
1169509199 20:6245409-6245431 GATGCTGATGCTGCTGTTCCAGG + Intergenic
1169522462 20:6388188-6388210 GATGCTGTTGCTGTTGGTCTGGG + Intergenic
1169604937 20:7306704-7306726 GAGGCTGAGGCTGCTGGTCTGGG + Intergenic
1169619607 20:7490988-7491010 GATGCTGATGCTACTGATCTGGG - Intergenic
1169675355 20:8147133-8147155 GATGCTGATGCTGTTGGTCCAGG - Intronic
1169692105 20:8343430-8343452 GATGCTGCTGCTGATGGTCTGGG + Intronic
1169714821 20:8603569-8603591 GATGCTGATGTTGCTGGTCTAGG - Intronic
1169717026 20:8631233-8631255 GATGCTAATGCTGCTGGTCCAGG + Intronic
1169748385 20:8965936-8965958 GATGCTGTTGCTGCTGGTCCAGG - Intronic
1169781604 20:9316168-9316190 GGTGCTGATGATGCTGGCTTGGG - Intronic
1169785796 20:9358046-9358068 GATGTTGATGCTGTTGGTCTTGG + Intronic
1169809439 20:9594195-9594217 GATGGTGATGCTGCTGGCCTAGG - Intronic
1169921181 20:10735762-10735784 GGGGCAGAGGCTGATGGACTGGG + Intergenic
1169950935 20:11042435-11042457 GATGCTGATGCTGCTGATCTTGG + Intergenic
1170009275 20:11703789-11703811 GATGCTGATGCAGCTGGTCCAGG - Intergenic
1170091676 20:12596082-12596104 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1170238618 20:14136548-14136570 GGTGCTAATGCTGCTGGTCCAGG - Intronic
1170307754 20:14958890-14958912 GTTGTTGATGCTGCTAGTCTGGG + Intronic
1170314631 20:15029511-15029533 GAGGCTGATACTGCTAGTTTAGG + Intronic
1170331196 20:15212816-15212838 GCTGCTGATGCTGCTGGCCTAGG - Intronic
1170597191 20:17814990-17815012 GGTACTGATGTTGCTGGTCCAGG + Intergenic
1170672992 20:18452296-18452318 GATGCTGATGCTGCAGGTCTGGG + Intronic
1170763553 20:19272516-19272538 GATGTTGATGCCGCTGGTCTAGG + Intronic
1170765917 20:19290046-19290068 GGGGCTGCTGCTGCTGGTGGTGG - Intronic
1171047225 20:21821554-21821576 AATGCTGATGCTGCTGGTTTTGG - Intergenic
1171172899 20:23031614-23031636 GAGGCTGATGCTGCCAGTCTGGG + Intergenic
1171177339 20:23062431-23062453 TGCAGTGATGCTGCTGGTCTGGG - Intergenic
1171178697 20:23075292-23075314 TCTGCTGATGCTGCTGGTCCAGG - Intergenic
1171247774 20:23626525-23626547 GGTGCTGCTGCTGCTGGTCCAGG + Intergenic
1171252150 20:23656516-23656538 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1171267493 20:23783646-23783668 GGTGTTGATGGTGATGGTCTTGG - Intergenic
1171367239 20:24633622-24633644 GACCCTGATGCTGCTGGTCCAGG - Intronic
1171377674 20:24704490-24704512 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1171866231 20:30488862-30488884 GGGGCTCATGAGGCGGGTCTCGG - Intergenic
1172200813 20:33124839-33124861 GGGTCTGATGCAGCTGGATTGGG + Intergenic
1172289970 20:33769265-33769287 GATGCTGGTGCTGCTGGCCTGGG - Intronic
1172490966 20:35337517-35337539 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1172672938 20:36646748-36646770 CCCGCTGAGGCTGCTGGTCTAGG - Intergenic
1172850367 20:37958094-37958116 AATGCTGATGCTGCTGGTGTTGG + Intergenic
1172884830 20:38223872-38223894 GTTGCTGATGCTGCTGGCCTGGG + Intronic
1172940263 20:38649251-38649273 GTTGCAGATGCTGCTGGTCGGGG + Intronic
1172970933 20:38872627-38872649 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1173003636 20:39123408-39123430 GGCGCTGCTGCTGCTGCTCCAGG + Intergenic
1173158616 20:40636060-40636082 AATGCTGATGCTGCTGGTCTGGG + Intergenic
1173175955 20:40765081-40765103 GATGCTGATGCGGCTGGCCTGGG - Intergenic
1173347332 20:42213094-42213116 GAAGCGGATGCTGCTGGTCCAGG - Intronic
1173349522 20:42232464-42232486 GATGCTGATGCTACTGGTCCAGG + Intronic
1173423751 20:42925768-42925790 GAGGCAGATGCTTCTGGTCCAGG + Intronic
1173436838 20:43040963-43040985 GATGCAGATGCTGCTGGTCGGGG - Intronic
1173478620 20:43381929-43381951 GCTGCTGCTGCTGCTGGTCTGGG - Intergenic
1173549603 20:43923517-43923539 GGTGCTGATGGTGCCAGTCTGGG + Intronic
1173704392 20:45099215-45099237 GATGCTGATGCTGCTGGTCCGGG - Exonic
1173832193 20:46097723-46097745 GTTGCTGATGCTGCTAGTCCAGG - Intergenic
1174709268 20:52687427-52687449 GATGCTGATGCTCCTGGTCCAGG + Intergenic
1174845437 20:53938749-53938771 GGTGCTGAGGCTGCTGGTCCTGG + Intronic
1174847576 20:53958050-53958072 GATGCTGAAGCTGCTGGTCCTGG - Intronic
1174891845 20:54403674-54403696 GAGGGTAATGCTGCTGGTCAGGG - Intergenic
1174930533 20:54809100-54809122 GGTGCTGATACTGCTAGTCTGGG - Intergenic
1175012383 20:55752717-55752739 GGTGCTGCTGCTGCTGGTGCTGG - Intergenic
1175160022 20:57001492-57001514 GGTGCCGAGGCTGCTGCTCTGGG - Intergenic
1175189552 20:57202157-57202179 GGTTCTGATGCAGCAGGTCTGGG + Intronic
1175308160 20:57992204-57992226 GGTGCTGATACTGCTGACCTGGG - Intergenic
1175503867 20:59468581-59468603 GAGGTGGATGCTGCTGGTCCAGG + Intergenic
1175573660 20:60043299-60043321 GATGCTGATGCTGCCGGTCCAGG - Intergenic
1175586134 20:60141568-60141590 GCAGGTGATGTTGCTGGTCTGGG + Intergenic
1175715076 20:61249943-61249965 GATCTTGATGCTGCTGGTCTGGG + Intergenic
1175872913 20:62216863-62216885 GCGGAAGATGCTGCTGGTGTGGG - Exonic
1175916907 20:62430263-62430285 GGGGCTGGGGCTGCTGGGCCTGG + Intergenic
1176155730 20:63619417-63619439 AGGACTGACGCTGCTGGCCTGGG - Exonic
1176268572 20:64223513-64223535 GGGGCCGATTCTGCTTGGCTGGG + Intronic
1176677197 21:9790437-9790459 TGAGGTGATGCTGCTGGCCTGGG - Intergenic
1178298553 21:31431421-31431443 GATGCTGATGTTGCTGGTCTGGG + Intronic
1178523893 21:33308731-33308753 GGTGCTGATGCTGCTGGTCTAGG - Intergenic
1178886150 21:36486378-36486400 GAGGCTGCAGCTGCTCGTCTGGG + Intronic
1179110109 21:38438967-38438989 GGAGGTGATGCTGCTGGTCCCGG + Intronic
1179535560 21:42049320-42049342 GACACTGATGTTGCTGGTCTGGG + Intergenic
1179613040 21:42564763-42564785 CGGCCTGATGCTGCTGCTCGCGG + Exonic
1180083404 21:45496955-45496977 GGGGCTGGTGCTTCTGGGCTTGG + Intronic
1180180699 21:46117571-46117593 TGGGCTGGGGCTGCTGGGCTGGG - Intronic
1180199314 21:46215180-46215202 CGGGCCGATGCTGATGCTCTTGG + Exonic
1180312941 22:11253722-11253744 GGGGCTCATGAGGCGGGTCTTGG - Intergenic
1180609261 22:17085139-17085161 GGGGCTGCTCCTGCTGCTCCTGG + Exonic
1180704876 22:17803144-17803166 GGTGATGTTGCTGCTGGTCCAGG + Intronic
1180975340 22:19844976-19844998 GGGGCTGGTGCCCCTGGCCTCGG + Intronic
1181055714 22:20259690-20259712 GGAGCTGGAGCTGCTGGCCTGGG - Intronic
1181507147 22:23367072-23367094 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1181582765 22:23837202-23837224 GGGGCAGGCTCTGCTGGTCTAGG - Intronic
1181620646 22:24089003-24089025 GGGACTGAAGCTGCTGCCCTAGG + Intronic
1181750173 22:24983716-24983738 GGGGCTGAAGCTGGGGGTCTGGG + Intronic
1181856786 22:25787407-25787429 AATGCTGATGCTGCTGGTCCAGG + Intronic
1181867526 22:25870685-25870707 GATGCTGATGCTGCTGGTTCAGG - Intronic
1181868136 22:25875557-25875579 GATGCTGATGCTGCTGGTCTGGG - Intronic
1181913166 22:26256683-26256705 GATGCTGATGCTGCTGGTCCAGG - Intronic
1181983138 22:26780613-26780635 GAGGCTGAGGCTGCTGGTCCAGG - Intergenic
1182050116 22:27306213-27306235 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1182067855 22:27443110-27443132 GAAACTGATGCTGCTGGTCCCGG - Intergenic
1182098124 22:27639445-27639467 CGGGCTGATGCAGCTGGACGGGG - Intergenic
1182494542 22:30696495-30696517 GTGGCTGGTGATGCTGGTCCAGG + Intronic
1182678099 22:32055901-32055923 CTTGCTGATGCTGCTGGTCTGGG - Intronic
1182795146 22:32986453-32986475 GGGGCTGAAGCTGAGGGTCAGGG + Intronic
1182904407 22:33922423-33922445 GGCGCTGCTGCTGCTGGTGGGGG - Intronic
1182933044 22:34193135-34193157 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1182963695 22:34502069-34502091 GATGCTGATGCTGATGTTCTGGG - Intergenic
1183038409 22:35157920-35157942 GGTGCTGATGCTGCTGGATCTGG - Intergenic
1183089668 22:35513007-35513029 GATGCTGATGCAGCTGGTCTGGG + Intergenic
1183093109 22:35536837-35536859 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1183472266 22:38016035-38016057 GGGCCTGACACTGCTGGTGTGGG - Intronic
1183489975 22:38110974-38110996 GGGGCTGCTGCTGCTGGGTCTGG - Intergenic
1184076521 22:42182685-42182707 GTTGCTGATGCTGCTGTTCCAGG - Intronic
1184120346 22:42445864-42445886 GGGGCTGCAGCTCCTGGTCAGGG + Intergenic
1184519721 22:44986179-44986201 GGCGGTGATGCTGCTGGTGATGG - Intronic
1184718068 22:46293216-46293238 GGGGCTGATTCTGCTGGGACAGG + Exonic
1184842762 22:47062196-47062218 GATGCTGAGGCTGCTGGTCCAGG - Intronic
1184923649 22:47623065-47623087 GGGACTGATGCTGCTGGCCTGGG + Intergenic
1185020575 22:48372392-48372414 GAGGCTGATCCCGCTGTTCTGGG - Intergenic
1185231694 22:49687503-49687525 CGGGATGCTGCTGCTGGCCTGGG + Intergenic
949192458 3:1266835-1266857 GGGGCTGAAGGTGTTGGTTTTGG - Intronic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949613694 3:5730408-5730430 GCAGCTGATGCTACTGGTCTGGG + Intergenic
949744273 3:7270116-7270138 GATGCTGATGCTGCTGATCTGGG + Intronic
949830001 3:8204116-8204138 AATGCTGATGCTGCTGGTCCAGG + Intergenic
949887690 3:8709493-8709515 GATGCTCATGCTGCTGGTCTGGG + Intronic
949961711 3:9317772-9317794 GATGCTGATGCTGCTGGTCCAGG + Intronic
949963558 3:9335604-9335626 GATGCTGATGCTACTGGTGTGGG - Intronic
950604271 3:14064538-14064560 GGGGCTGCTGCTGCTGCTGCTGG - Exonic
950604279 3:14064592-14064614 GGGGCTGCTGCTGCTGCTGCTGG - Exonic
950604302 3:14064754-14064776 GGGGCTGCTGCTGCTGCTACTGG - Exonic
950837391 3:15933849-15933871 GATGCTGATGCTGCTGATCAGGG - Intergenic
950884755 3:16353492-16353514 TGAGCTGCTGCTGCTGGTGTGGG - Intronic
950899420 3:16483814-16483836 AATGCTGATGCTGCTGGTCTGGG - Intronic
950918340 3:16667732-16667754 GATGCTGATGCTCCTGGCCTGGG - Intronic
951040279 3:17982020-17982042 GATGCTGATGCTGCTGGTCTAGG + Intronic
951049868 3:18082296-18082318 GATGCTGATGCTGCTGGTCTAGG - Intronic
951066920 3:18277339-18277361 GAGGCTGATGCTGCTGGTCCAGG + Intronic
951068043 3:18290536-18290558 GATGCTGTTGCTGCTGGTCCAGG + Intronic
951133730 3:19078506-19078528 GATGCTGTTGCTGCTGATCTGGG + Intergenic
951192899 3:19790882-19790904 GATGCTGATGATGCTGGTCCAGG + Intergenic
951286723 3:20822231-20822253 GGTGCTAATTCAGCTGGTCTAGG - Intergenic
951360597 3:21720226-21720248 GATGACGATGCTGCTGGTCTAGG - Intronic
951405624 3:22293724-22293746 GAAGTTGATTCTGCTGGTCTTGG - Intronic
951590657 3:24261011-24261033 GATGCCGATGCTGCTGGTCTGGG + Intronic
951626997 3:24676479-24676501 TGGGCTGATGCTGATGCTCATGG + Intergenic
951663374 3:25095341-25095363 GGTGCTGATGTTGCTGGTCCAGG - Intergenic
951696803 3:25453573-25453595 GATGCTGATGCTGCTTGTCCAGG + Intronic
951771180 3:26259305-26259327 GGGAATGATGTTGCTGGTCTAGG - Intergenic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
951981480 3:28571913-28571935 GGTGCTACTGCTGCTGGTTTGGG + Intergenic
951995200 3:28719751-28719773 GCTGCTGCTGCTGCTGGTCTGGG + Intergenic
952110013 3:30111588-30111610 GTTGCTGATGCTGGTGGTCCCGG + Intergenic
952123096 3:30267772-30267794 GATGCTGATGCTGCTGGTCTAGG + Intergenic
952187349 3:30984381-30984403 GACGCTGATGCTGCTGGTCCAGG + Intergenic
952324398 3:32307832-32307854 GACGTTGATGTTGCTGGTCTGGG + Intronic
952348303 3:32509470-32509492 GATGATGATGCTGCTGGTCTAGG + Intergenic
952576554 3:34781134-34781156 GATGCTGATGCTGCTGGTCTTGG + Intergenic
952655503 3:35780667-35780689 GATGCTGATGCTTCTTGTCTGGG - Intronic
952740410 3:36728912-36728934 GATGCTGATGGTGCTGGTCCAGG - Intronic
952827548 3:37536936-37536958 GATGCTAATGCAGCTGGTCTGGG - Intronic
952839705 3:37635509-37635531 GAGGTTGATGCTGCTGGTTCAGG - Intronic
952853650 3:37749939-37749961 GATGCTGCTGCTGCTGGTCCAGG - Intronic
953137129 3:40190698-40190720 GGTGCTGATGCTGCTGGTCTGGG - Intronic
953200000 3:40770065-40770087 GATGCTGATGCTGCTGGCCCTGG - Intergenic
953308485 3:41853243-41853265 AATGCTCATGCTGCTGGTCTAGG + Intronic
953344399 3:42163232-42163254 GATCCTGATGCTGCTGGTCAGGG - Intronic
953467172 3:43132411-43132433 GATACTGATGCTGCTGATCTGGG + Intergenic
953476877 3:43212668-43212690 GGTGCTGTGGCTGCTGGCCTGGG - Intergenic
953484606 3:43283623-43283645 GAAGCTGATGCTGCTAGTCCAGG + Intergenic
953704879 3:45223696-45223718 GATGCTGATGTTGCTGGTCCAGG + Intergenic
953735355 3:45489520-45489542 GCTGCTAATGCTGCTGGTCCAGG + Intronic
953772583 3:45790370-45790392 GATGCTGAAGCTGCTGGCCTGGG + Intronic
953781243 3:45872645-45872667 AATACTGATGCTGCTGGTCTGGG + Intronic
953827541 3:46267081-46267103 GATGCTGATGATGCTGGTCCTGG + Intergenic
953831254 3:46299276-46299298 GTGGCTGAGACTGCTGGTCTGGG - Intergenic
953910761 3:46891841-46891863 GGGACTGGTGATGCTGGTGTTGG + Intronic
953959253 3:47254873-47254895 GTTTCTGATTCTGCTGGTCTAGG - Intronic
954578645 3:51691086-51691108 GAGGCTGAGGCTTCAGGTCTAGG + Intronic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
955475152 3:59328858-59328880 GATGCAGATGCTGCTGGTCCGGG - Intergenic
955531156 3:59874510-59874532 GATGCTGATGCTGCTGGTCCAGG + Intronic
955661825 3:61307659-61307681 AATGCTGATGCTGCTGGTCTGGG - Intergenic
955704055 3:61709956-61709978 GCTGCTGATGCTGCTGTTCCTGG + Intronic
956362215 3:68460807-68460829 GATGCTGATGCTGCTAGTCTGGG + Intronic
956525029 3:70149428-70149450 GAAGCTGATGCTGCTGGTCTAGG - Intergenic
956583793 3:70842667-70842689 GATGCTGATACTGCTAGTCTGGG + Intergenic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
956998108 3:74851304-74851326 GATGCTTATGCTGCTGGTCTAGG + Intergenic
957031702 3:75249835-75249857 AATGCTGATGCTGTTGGTCTGGG - Intergenic
957337984 3:78857562-78857584 GATGCTGATGCTGCTGGTCTGGG - Intronic
958156499 3:89762014-89762036 GCAGCTCAGGCTGCTGGTCTAGG + Intergenic
959374456 3:105571260-105571282 GATGCTGATACTGCTGGTCTGGG + Intronic
959505689 3:107154105-107154127 GATGCTGATGGTGCTGGTCAAGG - Intergenic
959622068 3:108409383-108409405 GAGGCCGGTGCTGCTGATCTGGG - Intronic
959843647 3:111007423-111007445 GGTCCTTGTGCTGCTGGTCTGGG - Intergenic
959860093 3:111206856-111206878 GGTGGTGATGCTCCTGGTCCAGG + Intronic
959912465 3:111779126-111779148 GATGTTGATGCTGCTGGTCCAGG + Intronic
960047230 3:113210638-113210660 GATGCTGATGCTGCAGGTCAGGG - Intergenic
960129954 3:114045288-114045310 GAGGCTGTTGGTGGTGGTCTGGG - Intronic
960165299 3:114394665-114394687 GATGCTGATGCTACTGGTCTGGG + Intronic
960301465 3:116007953-116007975 GATGCAGATGCTGCTGGTTTAGG + Intronic
960536973 3:118825534-118825556 GATGCTGGTGCTGCTTGTCTGGG - Intergenic
960631316 3:119734174-119734196 GATGCTGCTGCTGCTGGTCCAGG + Intronic
960903583 3:122576158-122576180 GAACCTGATGTTGCTGGTCTGGG + Intergenic
961093570 3:124136378-124136400 GATGCTGATGCTGCTGGTCTGGG + Intronic
961189165 3:124943034-124943056 CATGCTGGTGCTGCTGGTCTGGG - Intronic
961387592 3:126531144-126531166 GAGGCTGCGGCTGCTGGTCTGGG - Intronic
961534837 3:127564008-127564030 GGTGCTGGTGCTGGTGGTTTTGG - Intergenic
961576128 3:127837871-127837893 GAGGTCTATGCTGCTGGTCTGGG - Intergenic
961860095 3:129909855-129909877 GATGCTGATGCTGCTGTTCCAGG - Intergenic
961924104 3:130458414-130458436 GATGCTGATGCTGCTTGTGTAGG - Intronic
961981378 3:131083017-131083039 GATGCTGATGATACTGGTCTGGG - Intronic
962099860 3:132330370-132330392 GATGGTGATGCTGCTGGTCCAGG - Intronic
962171974 3:133110894-133110916 GATGCTAATGCTGCTGGTCCAGG + Intronic
962207608 3:133447758-133447780 GATGCTGATCCTGCTGGTCCTGG + Intronic
962302306 3:134253187-134253209 GGTGATGATACTGCTGGTCTGGG - Intergenic
962425028 3:135262136-135262158 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
962469773 3:135695915-135695937 AATGCTGATGCTGCTGGTCTGGG - Intergenic
962897566 3:139729994-139730016 GCTGCTGGTGCTGCTTGTCTGGG + Intergenic
962942675 3:140140138-140140160 GATGCTGATGCTGATGGTCCAGG + Intronic
963103529 3:141626277-141626299 AATGCTGATGCTGCTAGTCTTGG - Intergenic
963106598 3:141652808-141652830 GATGCTGAGGCTGCTGGTCTTGG + Intergenic
963690541 3:148495789-148495811 GATGCTGATGCTGCAGGTCCAGG + Intergenic
964221469 3:154351638-154351660 GATGCTGAAGCTGCTGGTGTAGG + Intronic
964421549 3:156509392-156509414 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
964503264 3:157371492-157371514 GATGCTGATGCCGCTGGTCCAGG - Intronic
964663516 3:159147950-159147972 GCTGTTGATGCTGCTGGTCTGGG - Intronic
965403431 3:168241208-168241230 AATGCTGATGCTGCTGGTTTGGG + Intergenic
965408078 3:168295283-168295305 GTTGCTGATGCTGCTAGTCCAGG + Intergenic
965507465 3:169532271-169532293 GATGCTGATGCTGCTGGCCCAGG + Intronic
965603350 3:170476044-170476066 GACATTGATGCTGCTGGTCTGGG + Intronic
965607416 3:170510942-170510964 GGGGCTGCTGATGCTGGCCTCGG - Intronic
965641007 3:170829019-170829041 AATGCTGATGCTGCTGGTCCAGG - Intronic
965733525 3:171797395-171797417 AATGCTGATGCTGCTGGTTTGGG - Intronic
965740842 3:171872980-171873002 GATGCCGATGCTGCTGGTCTGGG - Intronic
965867801 3:173226574-173226596 GAAGCTGATGCTGCTGGTCCAGG + Intergenic
966755561 3:183368136-183368158 GATGCTGATGCTGCTGGTCTGGG - Intronic
966825873 3:183964559-183964581 GATGCTGATGCTGCTGATCTGGG + Intronic
966927526 3:184655098-184655120 GATGCTGATGTTGCTGGTCCAGG + Intronic
967035161 3:185643524-185643546 ATAGCTGATGCTGCTGGTCTGGG + Intergenic
967113197 3:186313572-186313594 GATGCTGATGCTGCTGGTCCAGG - Intronic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
967815822 3:193797437-193797459 GATGTTCATGCTGCTGGTCTGGG - Intergenic
967852023 3:194089525-194089547 GAGGCAGATGCTGCTGGTGTGGG - Intergenic
967970836 3:194998393-194998415 GATGCTGATGCTGCTGGTCCTGG - Intergenic
968019017 3:195367270-195367292 GGTGCTGATGCTGCTGGTCCAGG + Intronic
968083453 3:195863277-195863299 GGAGCAGATGCTGGTGGCCTGGG + Intergenic
968298676 3:197596744-197596766 GCTGGTGATGCTGCTGGTCTGGG + Intergenic
968425696 4:521854-521876 TGGGGTGATGGTGCTGGCCTCGG + Exonic
968547944 4:1208115-1208137 AGGGCTCATGCAGCTGCTCTTGG + Intronic
969032568 4:4226624-4226646 GCTGCTGCTGCTGCTGGCCTGGG - Exonic
969110250 4:4839916-4839938 AAGGCTGATGATGCTGGTTTGGG + Intergenic
969156567 4:5216232-5216254 AATGCTGATGCTGCTGGTCTGGG + Intronic
969472871 4:7400016-7400038 GCTGCCCATGCTGCTGGTCTGGG + Intronic
969929305 4:10614559-10614581 TTGGGAGATGCTGCTGGTCTGGG - Intronic
970321335 4:14878490-14878512 GACACTGATGCTGCTGGTCTGGG + Intergenic
970453060 4:16191122-16191144 GGGGCTCATGCTGCTGGTCTGGG - Intronic
970600183 4:17636008-17636030 GGGGCAAATGCTGTTGGACTTGG + Intronic
970730085 4:19092215-19092237 AGTGCTGATGCTTCTGGCCTAGG + Intergenic
970884820 4:20976176-20976198 GAGGATCATGCTGCTGGTCCAGG - Intronic
971143957 4:23956342-23956364 GACATTGATGCTGCTGGTCTTGG + Intergenic
971247807 4:24945946-24945968 GATGCTGATGCTGTTGGTCTGGG + Intronic
971464475 4:26940944-26940966 AGTGCTGATACTGCTGGTCCAGG + Intronic
972578296 4:40372320-40372342 TGTGCTGATGCTGCTGGTCCGGG - Intergenic
973155231 4:46943597-46943619 GGGGATGATGAGGCTGGACTGGG - Intronic
973201279 4:47505337-47505359 AGTACTGATGCTGCTGGTCCTGG - Intronic
973575866 4:52288728-52288750 AATGCTGATGTTGCTGGTCTGGG + Intergenic
974033259 4:56795182-56795204 GCTGCTGATGCTGCTGGTCAGGG - Intergenic
974074262 4:57154640-57154662 GTGGCTGATGCTACTGGTGGAGG + Intergenic
974095703 4:57361568-57361590 GATGCTGATGTTGTTGGTCTAGG + Intergenic
974180659 4:58380126-58380148 GTGGCTTATGCTGCTAATCTAGG + Intergenic
975372764 4:73607618-73607640 GGTACAGATGCTGCTGGTCTGGG - Intronic
976088018 4:81425956-81425978 AATGCTGATGCTGCTGGTCCTGG - Intergenic
976281975 4:83334728-83334750 GCCGCTGATGCTGCTGCTCCTGG - Exonic
976476008 4:85483810-85483832 GGAACTGATGCTGCTGGTCCTGG - Intronic
976625761 4:87179982-87180004 AAGGCTGATGCTGCTGGTCGAGG + Intronic
977124224 4:93144146-93144168 GGTGCTCATATTGCTGGTCTAGG + Intronic
977152410 4:93529369-93529391 GGTGCTGATGCAGCTGGACCAGG - Intronic
977249582 4:94675050-94675072 GAAGCTGATCCTGCTGGTCTGGG + Intergenic
977761750 4:100746163-100746185 GCAGCTCATGCTGCTGATCTTGG - Intronic
977957063 4:103040835-103040857 GAGGCTGATGCTGCCAGTCTAGG - Intronic
978642823 4:110891644-110891666 GTTGCTGATACTGCTAGTCTGGG - Intergenic
979341503 4:119529906-119529928 GATGCTGATGCTGCTGGTCCAGG - Intronic
979504974 4:121485366-121485388 GGTGCTTATGCTGCTGTTCCAGG + Intergenic
979559034 4:122081556-122081578 GATGCTGATGCTGCTGATCTGGG - Intergenic
979753376 4:124307226-124307248 GGGGCTGACACTGCTTGTCTAGG + Intergenic
979947063 4:126845287-126845309 TGGTGTGATACTGCTGGTCTTGG + Intergenic
980501027 4:133654549-133654571 GATGCTGATGCTGTTGGTTTGGG - Intergenic
981211135 4:142106809-142106831 GATGCTGATGCCGCTGGCCTGGG + Intronic
981440541 4:144777252-144777274 AAGGCTAATGCTGCTGGCCTGGG - Intergenic
981947284 4:150362630-150362652 GATACTGATGCTGCTGGTCCAGG + Intronic
982355098 4:154457855-154457877 GTTGTTGATGCTGCTGGTCCAGG + Intronic
982468008 4:155755152-155755174 GAAGCTTCTGCTGCTGGTCTTGG - Intergenic
982658575 4:158178815-158178837 GAAGCTGATGCTGCTGGTTCAGG - Intergenic
982843795 4:160224328-160224350 GTGGCTCAGGCTGCTGGTGTAGG + Intergenic
983091499 4:163508359-163508381 GGTGCTGTTGCTGCTGGTTTAGG + Intronic
983198745 4:164837930-164837952 GATGCTGATGCAGTTGGTCTAGG - Intergenic
983701481 4:170600714-170600736 GATGCTGATGTTGCTGGTCCAGG - Intergenic
983898573 4:173108021-173108043 GATGCTGATGCTGCTGGCCTGGG - Intergenic
983905506 4:173177228-173177250 GATGCTGATGCTGCTGGTCCAGG + Intronic
983924879 4:173389666-173389688 GATGCTGAAGCTGCTGTTCTGGG + Intronic
984432307 4:179664772-179664794 TGAGCTGCTGCTGCTGCTCTGGG + Intergenic
984663336 4:182397815-182397837 GATGTTGATGCTGCTGGTCTGGG + Intronic
985279447 4:188270811-188270833 GGGGCTGCTGCTGCTGGTGCTGG - Intergenic
985326476 4:188776412-188776434 GGGCTTGCTGCTGCTGTTCTGGG + Intergenic
985398347 4:189568343-189568365 TGAGGTGATGCTGCTGGCCTGGG + Intergenic
985610338 5:884478-884500 TGGTCTGGTGCTGCTGGGCTGGG + Intronic
985695723 5:1339053-1339075 GGGGCTGACCCTGCTGTCCTGGG - Intronic
985708533 5:1415222-1415244 GGCGCTGGTGCTGCGGGCCTGGG + Intronic
985904279 5:2821139-2821161 GGGGGTGATTCTGCTGGTCCAGG - Intergenic
985926662 5:3024703-3024725 GGGGCGCATGCTGCTGGACCAGG - Intergenic
986651403 5:9966689-9966711 GAGGCTGATGCAGCTGGTGCTGG + Intergenic
986726571 5:10602325-10602347 GACGCTGATGCCGCTGGTCCTGG + Intronic
986734887 5:10661318-10661340 GGTGCTGATGTTACTGGTCCGGG - Intergenic
986771347 5:10976922-10976944 GATGCTGATGCTGCTGGTCTTGG - Intronic
987093687 5:14529659-14529681 GAGGCCGATGCTGCTGGTCCAGG - Intronic
988459731 5:31423402-31423424 GATGCAGATGCTGCTGGTCTGGG + Intronic
988625126 5:32866697-32866719 GATGCTGATGCTGCTGGTCCAGG + Intergenic
988706880 5:33735313-33735335 GATGCTGATGCTGCTGGTCCGGG + Intronic
989168491 5:38453051-38453073 GATGCTGGGGCTGCTGGTCTGGG - Intronic
989246893 5:39265000-39265022 GAGGCTGACGCTGCTGGTCCAGG - Intronic
989260983 5:39420102-39420124 GATGTTGATGCTGCTGGTTTGGG + Intronic
989355466 5:40539331-40539353 GGGCTTGCTGCTGCTGGTGTTGG + Intergenic
989475284 5:41867976-41867998 GATGTTGATGCTGCTGGTCTGGG - Intronic
989617115 5:43348291-43348313 GGGGCTGATGCTGCTGGGAGTGG - Intergenic
990173277 5:53079119-53079141 GATGCTTATGCTGCTGGTCCAGG + Intronic
990356763 5:54975419-54975441 GGTGCAGATGCTGCTGGTCTAGG - Intergenic
990459372 5:56016898-56016920 GATGCTGGTGCTGCAGGTCTGGG + Intergenic
991567715 5:68021759-68021781 GCTGCTGCGGCTGCTGGTCTGGG - Intergenic
991921753 5:71664195-71664217 GACACTGATGCTGCTGGTCTGGG + Intergenic
992072024 5:73157069-73157091 GGTGCTGCTGCTGCTGGTTCTGG + Intergenic
992097101 5:73373014-73373036 GATGCTGATGCTTCTTGTCTGGG + Intergenic
992496299 5:77297510-77297532 GATGCTGATGCTGCTGGTTCAGG + Intronic
992714628 5:79497864-79497886 CATGCTGATGCTGCTGGTCCAGG - Intronic
992890038 5:81195637-81195659 GATGCTGATGCTGCTGGCCCGGG - Intronic
993486712 5:88495972-88495994 GCTGCTGATGCTGCCGGTCTGGG + Intergenic
993699962 5:91107157-91107179 GGTACTGATTCGGCTGGTCTGGG + Intronic
993817755 5:92573428-92573450 GGAGCTGATGCTGTTGATCAGGG + Intergenic
993972813 5:94441193-94441215 GATGTTGATGCTGCTGGTTTGGG - Intronic
994046370 5:95314906-95314928 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
994123687 5:96146491-96146513 GATGCTGATGCTATTGGTCTTGG + Intergenic
994188991 5:96846636-96846658 CATGCTGTTGCTGCTGGTCTGGG + Intronic
994323865 5:98426158-98426180 GCTGCTGCTGCTGCTGGTCTTGG - Intergenic
995127504 5:108593172-108593194 GGAGCTAATTCTGCTTGTCTTGG - Intergenic
995337010 5:111011273-111011295 GAGGCTGAAGAAGCTGGTCTTGG - Intergenic
995385996 5:111589621-111589643 GATGCTGATGCTGCTGGTCTGGG - Intergenic
995530459 5:113086953-113086975 GATGCTGATGCTGCCGGTCGGGG + Intronic
995733652 5:115273796-115273818 GATGCTGATTTTGCTGGTCTAGG + Intronic
995891315 5:116955337-116955359 GAGGCTAATGCTGCTTGTCAAGG + Intergenic
996034066 5:118738687-118738709 GATGCTAATGCTGCTGGTCCTGG - Intergenic
996072369 5:119147876-119147898 GACGCTGATGCTGCTGGCCTGGG - Intronic
996172020 5:120305164-120305186 GATGCTGATGCTGCTGGTCTGGG + Intergenic
996452893 5:123646963-123646985 GATGTTGATGATGCTGGTCTCGG - Intergenic
996518586 5:124401054-124401076 GGTGTCGAGGCTGCTGGTCTGGG + Intergenic
996522346 5:124441323-124441345 GATGTTGATCCTGCTGGTCTGGG + Intergenic
996555913 5:124778677-124778699 GATGTTGATGTTGCTGGTCTGGG - Intergenic
996577246 5:124988974-124988996 GATGCTGATGCTGCTGGCCCAGG + Intergenic
996588546 5:125119319-125119341 GATGCTGATGCTGCTGGTCTCGG - Intergenic
996992854 5:129657296-129657318 GTGACTGGTGCTGCTGGTGTTGG - Intronic
997082874 5:130761561-130761583 GTTGCTGATGCTGCTGGTCCAGG - Intergenic
997257790 5:132442596-132442618 GATGCTGATGCTGCTGGTCTGGG + Intronic
997614284 5:135235934-135235956 GATGCTGATGTTGCTGGTCCAGG + Intronic
997840849 5:137237860-137237882 GTTGCAGATGCTGCTGGTCTGGG + Intronic
997965470 5:138352828-138352850 GCGGCTGCTGCTGCTGTTCGCGG + Exonic
998262738 5:140643612-140643634 GGGGTTGCTGCTGTTGGACTTGG + Exonic
998307859 5:141096710-141096732 GAGGCTGGTGGTGCTGGTCAAGG + Exonic
998315028 5:141174749-141174771 GAGGCTGGTGGTGCTGGTCAAGG + Exonic
998315605 5:141179951-141179973 GAGGCTGGTGGTGCTGGTCAAGG + Exonic
998316145 5:141184473-141184495 GAGGCTGGTGGTGCTGGTCAAGG + Exonic
998946786 5:147348499-147348521 GATGCTGATGCTGCTGATCTGGG + Intronic
999041765 5:148421295-148421317 GGAGCTGATACTGCTGGTCTGGG + Intronic
999094608 5:148966789-148966811 GAGCCTGATGCTGGTGGTCTCGG - Intronic
999120201 5:149203671-149203693 GGTGTTGATGCTGCTGGTGCTGG - Intronic
999132966 5:149298794-149298816 GCAGCTGATGCTGGTGGTCCTGG - Intronic
999142720 5:149373119-149373141 GATGCTGGTGCTGCTGGTCTGGG - Intronic
999177256 5:149640133-149640155 AGGGCAGAAGCTGCTGGTCTTGG + Intergenic
999418402 5:151419709-151419731 GGTGCTGATGCAGCTGGACTGGG + Intergenic
999626677 5:153528581-153528603 GATGCTGATGCTGCTGGTCCAGG + Intronic
999708923 5:154299160-154299182 GATGCTGATATTGCTGGTCTGGG - Intronic
999712326 5:154329604-154329626 GGGGATGATGATGCTTGTGTTGG - Exonic
999893188 5:156000898-156000920 GTTGCTGATGCTGCTGATCCAGG + Intronic
999960706 5:156753046-156753068 GATGCTGATGCTGCTTGTTTCGG - Intronic
1000045388 5:157517994-157518016 GCTGCTGATGCTGGTGCTCTGGG + Intronic
1000157273 5:158564069-158564091 GGGGCAGATGCAGCTCCTCTAGG - Intergenic
1000165306 5:158642607-158642629 GATGCTGAAGCTGTTGGTCTGGG - Intergenic
1000348174 5:160331866-160331888 GATGCTGATGCTGCTGGTTCAGG - Intronic
1000568885 5:162885545-162885567 GTTGCTGATACTGCTGGTCCAGG - Intergenic
1000703328 5:164479999-164480021 GAGGATGATGTTGCTGGTCCAGG - Intergenic
1001003625 5:168030550-168030572 GATGCTGATTCTGCTGGTCTGGG + Intronic
1001012064 5:168107563-168107585 GGGTCTGATGCAGGTGGTCAGGG + Intronic
1001073317 5:168605525-168605547 GGGTCTGATGCTCCTGCCCTGGG + Intergenic
1001102007 5:168822112-168822134 GATATTGATGCTGCTGGTCTAGG + Intronic
1001123508 5:168998786-168998808 GACAGTGATGCTGCTGGTCTGGG - Intronic
1001156158 5:169274063-169274085 GATGCTGATACTGCTGGTCCGGG - Intronic
1001279069 5:170372974-170372996 GGGGGAGATGCAGCTGGCCTGGG + Intronic
1001404178 5:171463935-171463957 GATACTGATGTTGCTGGTCTGGG + Intergenic
1001700075 5:173700478-173700500 GATGCTGGTGCTGCTGGTCCCGG + Intergenic
1001780476 5:174364626-174364648 GATGCTGATGCTGCTGGCCCAGG - Intergenic
1001827578 5:174758190-174758212 GACACTGATGCTGCTGGTCGTGG + Intergenic
1001920576 5:175596555-175596577 GCTGCTGCTGCAGCTGGTCTGGG + Intergenic
1001922144 5:175609171-175609193 GGAGCTGGTGCTGCTGGCCCTGG + Intergenic
1002168990 5:177364871-177364893 GATGCTGATGCTGCTGGTTCAGG - Intronic
1002286456 5:178165725-178165747 GGGGCTCAGGCTGCTGGTTGCGG + Intergenic
1002322318 5:178383209-178383231 GGTGCTGCGGCTACTGGTCTGGG + Intronic
1002515457 5:179754785-179754807 GATGCTGATGCTACTGGCCTGGG + Intronic
1003120589 6:3316122-3316144 GATGCTGATGCTGCTGGCCCAGG + Intronic
1003123050 6:3333737-3333759 GAGGCTGCTGCTGCAGGTCTGGG - Intronic
1003165040 6:3670292-3670314 GAAGATGCTGCTGCTGGTCTGGG + Intergenic
1003180079 6:3783651-3783673 GAGGCTGGTGCTGCTGATCCAGG + Intergenic
1003453707 6:6261470-6261492 GATGCTGTTGCTGCTGGTCGGGG - Intronic
1003492538 6:6636136-6636158 GAGGCTGATGATGCTGGCCCAGG + Intronic
1003500255 6:6697240-6697262 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1003557531 6:7154232-7154254 GATGCTAATGCTGCTTGTCTGGG - Intronic
1003774078 6:9339842-9339864 CCAGATGATGCTGCTGGTCTGGG + Intergenic
1004132294 6:12931964-12931986 GATGCTGATACAGCTGGTCTGGG - Intronic
1004170429 6:13291656-13291678 CCTGCTGATGCTGCTGGTCCAGG + Intronic
1004171463 6:13298732-13298754 GATGCTGATGCTGCTTGTCCAGG - Intronic
1004429803 6:15533210-15533232 GGGGCTGGGGCTGCTGGTGTGGG - Intronic
1004510578 6:16281121-16281143 GATACTGCTGCTGCTGGTCTGGG - Intronic
1004518900 6:16344036-16344058 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1004526152 6:16409893-16409915 TGGGCTGATGATGCTGGTTGCGG + Intronic
1004534774 6:16489956-16489978 GATGCTGATACTGCTGGTCCAGG + Intronic
1004684714 6:17931977-17931999 GATGCTGATGCTGTTAGTCTGGG - Intronic
1004685923 6:17943613-17943635 GACTCTGATGCTGCTGATCTGGG + Intronic
1004879338 6:19991402-19991424 GACACTGATGCTGCTGGTCTGGG + Intergenic
1005017940 6:21391655-21391677 GATGCTGACACTGCTGGTCTGGG - Intergenic
1005148560 6:22721343-22721365 TATGCTGATGCTGCTGGTTTGGG + Intergenic
1005348070 6:24909874-24909896 CGGGCTGATTCTGCTGGGATGGG - Intronic
1005630922 6:27707141-27707163 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1006170959 6:32092254-32092276 GATGCTGATGCTGCAGGTCCAGG + Intronic
1006305257 6:33214774-33214796 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1006470608 6:34226726-34226748 GGTCCTGCTGCTGCTTGTCTGGG - Intergenic
1006652538 6:35563475-35563497 GGAGCTGATGTTGATGTTCTGGG + Intergenic
1006709066 6:36049581-36049603 GAAACTGATGCTGCTGATCTGGG + Intronic
1006796760 6:36737118-36737140 TGGGCTCATGCTGCTGGTGGTGG + Intergenic
1006806971 6:36794852-36794874 CATGCTGGTGCTGCTGGTCTGGG - Intronic
1006808035 6:36801352-36801374 GATGCTGATGCTGTGGGTCTGGG + Intronic
1006904808 6:37526049-37526071 GGTTCTGATGCTGCTGGCCCAGG - Intergenic
1007034262 6:38658515-38658537 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1007115820 6:39342713-39342735 GTTGCTGAGGCTGCTGGTCCTGG + Intronic
1007240141 6:40418953-40418975 GATGCTGATGCTGCTGGTCTTGG - Intronic
1007311730 6:40952086-40952108 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1007998119 6:46330207-46330229 GATGTTGATGCTGTTGGTCTGGG - Intronic
1008018825 6:46552744-46552766 GCTGCTGCTGCTGCTTGTCTGGG - Intronic
1008081279 6:47196846-47196868 GAAGCTGATGCTGCTGGTTCAGG - Intergenic
1008487259 6:52049885-52049907 GATGCTGATTCTGCTGGTCTGGG - Intronic
1008496407 6:52138457-52138479 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1008617887 6:53243698-53243720 GGTGCTGAGGCTGCTGGTCTGGG + Intergenic
1008670296 6:53761427-53761449 GATGCTGATGCTGCTGGTCTTGG + Intergenic
1008806355 6:55433646-55433668 GGGGATTATCCTGCTGGTCTTGG + Intergenic
1008857211 6:56103901-56103923 GGTGCTGAGACTGCTAGTCTTGG + Intronic
1009923863 6:70096787-70096809 AATGCTGATGCTGCTGGTCTGGG - Intronic
1010003500 6:70971387-70971409 GATGCTGATGCTGCTAGTCAGGG + Intergenic
1010444060 6:75931503-75931525 GATGCTGATGCATCTGGTCTGGG + Intronic
1011026194 6:82872137-82872159 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1011714322 6:90088626-90088648 GAGGCTGATGCAGCTGGTCCAGG - Intronic
1011732554 6:90280700-90280722 GATGCCGATGCTGCTGGTCCAGG + Intronic
1011739995 6:90349999-90350021 GATGCTGCTGCTGCTGGTCCAGG + Intergenic
1011825683 6:91302867-91302889 CGGGTTGATGCTGCTGGTTTGGG + Intergenic
1012400115 6:98835575-98835597 GGGGCGGCGGCTGCTGGTGTGGG - Exonic
1012546069 6:100420871-100420893 GGGGGTGGAGCTGCTGGTATAGG + Exonic
1012568095 6:100685441-100685463 GCTGCTGATGCTGCTGATCAGGG - Intronic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1012988297 6:105898463-105898485 GATGCTGATGCTGCTGATCTGGG + Intergenic
1013226097 6:108120079-108120101 GAGGCTGCTGCTGCTGATTTCGG - Intronic
1013309920 6:108884264-108884286 GATGCTGATGCTGCTGGTCCAGG - Intronic
1013481715 6:110558548-110558570 GGGGGTGATGGTGGTGGTCTTGG + Intergenic
1013646458 6:112146409-112146431 GATGCTGCTGCTGCTTGTCTGGG - Intronic
1013669453 6:112383366-112383388 GATGCTGATGTTACTGGTCTAGG - Intergenic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1013765429 6:113568801-113568823 GATGCTGATGCTGCTGGCCCAGG + Intergenic
1014015333 6:116523072-116523094 GATACTGATGCTGCTGGTCTAGG + Exonic
1014209721 6:118695569-118695591 GATGCTGATGTTGCTGGTCTTGG + Intronic
1014558021 6:122856586-122856608 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1014774762 6:125495476-125495498 GATACTGATGCTGCTGTTCTGGG + Intergenic
1015007653 6:128302906-128302928 GGGGTTGAAGATGCTGGTTTAGG - Intronic
1015029460 6:128576810-128576832 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1015073940 6:129132095-129132117 GGTGCTGAGGCTGTTGCTCTGGG - Intronic
1015226677 6:130865023-130865045 GAAGCTGATGCTGCTGATCCAGG + Intronic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1016884928 6:148950267-148950289 GATGCTGATGCTGCAGGTCTGGG + Intronic
1016900121 6:149092841-149092863 GATGCTGAGGCTGCTGGTGTTGG - Intergenic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017649740 6:156570043-156570065 GGGTCCAATGCTGCTGGTCTAGG + Intergenic
1017703135 6:157095191-157095213 TCTGCTGAAGCTGCTGGTCTGGG + Intronic
1017795126 6:157836921-157836943 GATGCTGATGCTGCTGGTCTAGG + Intronic
1018201320 6:161398376-161398398 GATGCTGATGGTGCTAGTCTGGG - Intronic
1018422583 6:163652383-163652405 GGGGCTGCTGCTGCTGGTGGTGG - Intergenic
1018482666 6:164207392-164207414 TGGGCTGAAGCTGCTGGCCCAGG + Intergenic
1018847461 6:167565561-167565583 GCGGGTGGTCCTGCTGGTCTTGG - Intergenic
1018913788 6:168120567-168120589 GGTGCTGTTGCTGCTGGCCTGGG - Intergenic
1019096855 6:169588720-169588742 CAGGCTGCTGCTGCTGGTCCAGG + Intronic
1019445009 7:1066645-1066667 GGGTCTGGGGCTGGTGGTCTGGG - Intronic
1019524876 7:1476422-1476444 GGAGCTGGTGCTGCGGGTCCAGG - Exonic
1019649284 7:2147863-2147885 GGGCCTGCTGCTGCTGGTCAAGG + Intronic
1020040388 7:4996826-4996848 GTGGCTGGTACTGCTGCTCTGGG + Intronic
1020371931 7:7441734-7441756 GATGCTGATGCTGCTGGTTCAGG + Intronic
1020582155 7:10016577-10016599 GCTGTTGATGCTGCTGGTCTTGG + Intergenic
1021164001 7:17311384-17311406 GATGCTGATCCTGCTGGTCTAGG + Intronic
1021253811 7:18364564-18364586 GGTGCCCATGCTGCTGGTCCAGG - Intronic
1021372308 7:19863737-19863759 GATGCTTATGCTGCTGGTATAGG - Intergenic
1021436372 7:20621453-20621475 GGTGCCTATGCTGCTGCTCTTGG + Intronic
1021570152 7:22056925-22056947 GCTGCTGCTGCTGCTGATCTGGG + Intergenic
1021614158 7:22485900-22485922 GATGCTGATGCTGCTGGTTTGGG + Intronic
1021903396 7:25310085-25310107 GGTGCTGATGCTGCTGGTTCAGG - Intergenic
1021930636 7:25577864-25577886 CCAGGTGATGCTGCTGGTCTAGG + Intergenic
1021952525 7:25789375-25789397 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1022128498 7:27380467-27380489 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1022212043 7:28220696-28220718 GAGGCGGATGCTGCTGGTCCAGG - Intergenic
1022216313 7:28265661-28265683 GATGTTGATGCTGCTGATCTAGG + Intergenic
1022242597 7:28527472-28527494 GATGCTGATGCTGCTGGTCTGGG + Intronic
1022275096 7:28847438-28847460 GCGTCTGGAGCTGCTGGTCTAGG - Intergenic
1022329103 7:29360788-29360810 GGAGCTGATGGGGCTGGCCTGGG + Intronic
1022429619 7:30303716-30303738 GATGCTGATGCTGCTGGTCTGGG - Intronic
1022463347 7:30633191-30633213 GATACTGATGCTGCTGGTCTAGG - Intronic
1022476761 7:30716111-30716133 GGGGCTCAGGGTGCTGTTCTGGG - Intronic
1022799401 7:33761399-33761421 GATGCTGATGCTGCTGGACCAGG + Intergenic
1022913975 7:34928217-34928239 GGTGTTGATGCTGTTGGTCCAGG - Intergenic
1023044842 7:36201963-36201985 GATGCTGATGCTGCTGGTCCAGG - Intronic
1023115090 7:36854955-36854977 GAGGCTGCGGCTGCTGCTCTTGG + Exonic
1023270045 7:38452763-38452785 GCTGCTAATGCTGCTGGTGTTGG - Intronic
1023325662 7:39052959-39052981 GATGCTGATGCTGCTAATCTGGG - Intronic
1023388584 7:39685327-39685349 GGGTCTGATGCAGCTGAGCTAGG + Intronic
1023488244 7:40709901-40709923 GGTGCTGCTGCTGCTAGTCAGGG + Intronic
1023499100 7:40829271-40829293 GCTGCTGCTGCTGCTGCTCTGGG + Intronic
1023576048 7:41628080-41628102 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1023689151 7:42768291-42768313 GATGCTGATGCTGCTAGCCTGGG - Intergenic
1023727478 7:43159026-43159048 GGTGCTGGAGCTGCTGGTCTAGG + Intronic
1023852562 7:44158522-44158544 TGGGCAGATGCTGCAGGCCTGGG + Intronic
1024299735 7:47877740-47877762 TAGTCCGATGCTGCTGGTCTGGG - Intronic
1024305947 7:47929684-47929706 GATGCTGATGCTGCTGGCCCTGG - Intronic
1024652675 7:51419107-51419129 GTGGCTGTGGCTGCTGCTCTGGG - Intergenic
1024672847 7:51612466-51612488 GATGTTGATGCTGCTGGTCTGGG - Intergenic
1024931730 7:54671530-54671552 GGAGCTGCTGCTCATGGTCTTGG - Intergenic
1025004497 7:55343826-55343848 GGTGATGATGGTGGTGGTCTTGG - Intergenic
1025037855 7:55609746-55609768 GTGGCTGTGGCTGCTGCTCTGGG - Intergenic
1025207874 7:57003939-57003961 GCTGCTGCTGCTGCTGCTCTCGG - Intergenic
1025233169 7:57216534-57216556 GGAGCTGGTGCTGCTGTTCTAGG + Intergenic
1025664066 7:63572933-63572955 GCTGCTGCTGCTGCTGCTCTCGG + Intergenic
1026121548 7:67542216-67542238 GATGCTGATTCTGTTGGTCTGGG - Intergenic
1026282845 7:68937032-68937054 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1026402364 7:70027491-70027513 GATGCTGCTGCTGCTGGTCTGGG - Intronic
1026566230 7:71491782-71491804 GGTGCTGATGCTGCTGGCCTGGG + Intronic
1026896316 7:74012043-74012065 GCAGCTGGTGCTGCTGGTCTTGG - Intergenic
1027002195 7:74661217-74661239 CAGGCTGATTCTGCAGGTCTGGG + Intronic
1027436588 7:78171424-78171446 GAGTCTGATGCTGCAGGCCTGGG + Intronic
1027585747 7:80056644-80056666 GTTGCTGATACTGCTGGTCCAGG - Intergenic
1027678387 7:81188064-81188086 GGTTCTAATGCTGCTGGTCCAGG - Intronic
1028125776 7:87111457-87111479 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1028144081 7:87302744-87302766 AATGCTGATGCTGCAGGTCTGGG - Intergenic
1028228733 7:88280388-88280410 GATGCAGATGCTGCTGGTCCTGG + Intronic
1028235395 7:88355059-88355081 GGTGCTGATGCTGGCAGTCTGGG + Intergenic
1028243190 7:88446006-88446028 GATACTGATGCTGCTGGTCTGGG - Intergenic
1028304489 7:89246406-89246428 GAGGCTTAAGCTGCTGGTCCAGG - Intronic
1028325366 7:89517800-89517822 GATGCTGACCCTGCTGGTCTTGG - Intergenic
1028632531 7:92950778-92950800 GGTGCCAATGCTGCTGGTCCAGG - Intergenic
1028838492 7:95400334-95400356 GATGCTGATGCTGCTGGCCCAGG + Intergenic
1028940072 7:96511998-96512020 GGTGCTGCTGCTGCTGTTCCTGG + Intronic
1029033969 7:97499161-97499183 GTTGTTGATGCTGCTGGTCTGGG + Intergenic
1029261921 7:99308570-99308592 GACACTGATGCTGCTGGTCCCGG - Intergenic
1030060263 7:105615941-105615963 GGTGCTGCTGCTGCTACTCTGGG + Intronic
1030110544 7:106023069-106023091 GGTGCTGATTCTGATGGTCTAGG - Intronic
1030111746 7:106032581-106032603 TGGGCTGAGGATGCTGGTCTGGG + Exonic
1030261678 7:107571615-107571637 AATACTGATGCTGCTGGTCTGGG - Intronic
1030574708 7:111271621-111271643 GATGCTGATGTTGCTGGTCACGG + Intronic
1030655047 7:112158181-112158203 TGTGCTGATGCTTCTGGTCTTGG + Intronic
1030851955 7:114498977-114498999 GATGCTGTTGCTGCTGGTCCAGG - Intronic
1031041368 7:116841772-116841794 GGTGCTGATGCTGCTTGTCAGGG - Intronic
1031126426 7:117778513-117778535 GATACTGATGCTGCTGGTCTGGG - Intronic
1031432180 7:121685243-121685265 CAGGCTGATGCTGGTGGTCAAGG - Intergenic
1031463507 7:122080481-122080503 GGGGTTGAGGCAGCTGGTTTGGG - Intronic
1031914328 7:127548426-127548448 GACTTTGATGCTGCTGGTCTGGG - Intergenic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032442954 7:131956190-131956212 GATGCTGATGCTGCTGGTTCAGG - Intergenic
1032609438 7:133396060-133396082 GATGCTGATGCTGCTGGTCTGGG - Intronic
1032677134 7:134141389-134141411 GAGGCTGATGCTGCTGGTCCGGG + Intronic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1033171079 7:139085070-139085092 AGTGCTGATGGTGCTGGTCCGGG - Intronic
1033257713 7:139816581-139816603 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033301757 7:140192441-140192463 TGTGCTGATGCCACTGGTCTGGG + Intergenic
1033363612 7:140655219-140655241 GATGCTGATGCTGTTGGTTTGGG - Intronic
1033673013 7:143511265-143511287 GGTGCTGCTGCTGCTGCCCTCGG - Intergenic
1034219017 7:149430229-149430251 GCAGCTGATGCTTCAGGTCTTGG + Intergenic
1034269541 7:149796960-149796982 GCTGCCGATGCTGCTGGTCCAGG - Intergenic
1034517086 7:151589468-151589490 GATGCTGAAGCTGCTAGTCTGGG + Intronic
1034837767 7:154368322-154368344 GAGGCTGATGCTGCTGCCCCGGG - Intronic
1034849109 7:154477260-154477282 GGTGCTGGTGCTGCTGGTGGTGG - Intronic
1034909479 7:154982682-154982704 GGGGCAGATGCTGCTGATCCAGG + Intronic
1035485810 7:159225105-159225127 GATGCTGATGCTACTGGGCTGGG - Intergenic
1035933392 8:3809662-3809684 GATGCTGATGCTGCTAATCTGGG + Intronic
1036568912 8:9962425-9962447 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1036578319 8:10049512-10049534 GATGCTGACGCTGCTGGTCCAGG - Intergenic
1036592782 8:10183936-10183958 GGTGCTGCTGCTGGTGGTATTGG + Intronic
1036698325 8:10993865-10993887 TGGGCTGAGGCTGCAGGTATAGG - Intronic
1036719443 8:11159546-11159568 GAAGCTGATGCTGCTGATGTAGG - Intronic
1036905979 8:12708742-12708764 GGGGCAGATGCTGCTTGTCGAGG + Intergenic
1036908752 8:12733121-12733143 GTGACAGATGCTGCTGGTCAGGG + Intronic
1037602889 8:20413006-20413028 GAAGTTGATGCTGCTGGTTTGGG - Intergenic
1037606116 8:20438592-20438614 GGGGCTGGTGATGCTGGTGCTGG + Intergenic
1038199809 8:25401394-25401416 GATATTGATGCTGCTGGTCTGGG + Intronic
1038534462 8:28343986-28344008 GGTGCAGATCCTGCTGGTTTGGG + Intergenic
1038815714 8:30902002-30902024 TGTGCTGATGCTGCTGATCTAGG - Intergenic
1038887759 8:31684086-31684108 GGTATTGATGCTGCTGGTCTGGG - Intronic
1039078739 8:33715500-33715522 GATGCTGATGCTGGTGGTCTGGG + Intergenic
1039141941 8:34400427-34400449 GTTGCTGATGCTGTAGGTCTAGG + Intergenic
1039371954 8:36994027-36994049 GATGGTGATGCTGCTGGTCTGGG + Intergenic
1039571127 8:38587232-38587254 GAGATGGATGCTGCTGGTCTCGG - Intergenic
1039844856 8:41318789-41318811 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1041203165 8:55471387-55471409 CGTGCTGATGCTGCTGGTTGAGG - Intronic
1041696456 8:60741906-60741928 GTGGCTGCTGCTGCTGGTAGGGG - Exonic
1041698841 8:60765637-60765659 GCGGCTGCTGCTGCTGAGCTTGG + Intronic
1041790624 8:61692810-61692832 TGATCTGATGTTGCTGGTCTAGG + Intronic
1042095961 8:65216327-65216349 GGTGCTGCTGCTGCTCCTCTGGG - Intergenic
1042274677 8:66991919-66991941 TCTGCTGCTGCTGCTGGTCTAGG + Intronic
1042404546 8:68388858-68388880 CATGCTGATGCTGCTGGTCCAGG + Intronic
1042804896 8:72760497-72760519 GATGCTGTTGCTGCTGGTCCAGG - Intronic
1043034314 8:75177778-75177800 GTGGCTCAGGCTGCTGGTCCAGG - Intergenic
1043474203 8:80590497-80590519 GCTGCCAATGCTGCTGGTCTGGG - Intergenic
1043504460 8:80888566-80888588 AGGGTTGGTGTTGCTGGTCTGGG - Intergenic
1043655755 8:82663077-82663099 GTGGCTCAGGCTGCTGGTCCAGG + Intergenic
1043822916 8:84890654-84890676 TATACTGATGCTGCTGGTCTGGG + Intronic
1044069182 8:87735031-87735053 GATGTTGATACTGCTGGTCTTGG - Intergenic
1044107564 8:88230224-88230246 GATGCAGATGCTGCTGGTCTAGG + Intronic
1044199619 8:89418349-89418371 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1044407126 8:91840409-91840431 GATGCTGATGCTGCTGGACTGGG + Intergenic
1044412392 8:91898388-91898410 GACGCTGGTACTGCTGGTCTGGG + Intergenic
1044443862 8:92250787-92250809 GCAGCTGGTGCTGCTGGTCCTGG + Intergenic
1044555635 8:93559167-93559189 GTGGCTGATGATGGTGGTCAGGG - Intergenic
1044939353 8:97324849-97324871 GGGGCTGACCCTGCTGGTGGGGG + Intergenic
1045183433 8:99811532-99811554 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1045295267 8:100867171-100867193 GGACCTGGTGCTGCTGGCCTGGG - Intergenic
1045377792 8:101592527-101592549 AGAGCTGATGTGGCTGGTCTGGG - Intronic
1045403970 8:101846818-101846840 TCAGCTGATGCAGCTGGTCTGGG + Intronic
1045642579 8:104268314-104268336 GGTGCTAATGCTGCTGATCTGGG + Intergenic
1045679067 8:104639590-104639612 GATGCTGATGCTGCTATTCTGGG - Intronic
1045745167 8:105409875-105409897 GATGCTAATGCTGCTGGTCCAGG + Intronic
1045852900 8:106724528-106724550 GCTGCTGCTGCTGATGGTCTGGG - Intronic
1045894191 8:107194562-107194584 GATGCTAATGCTGCTGGTCAGGG - Intergenic
1046154280 8:110266922-110266944 GATGCTGATGATGCTGGTCTAGG - Intergenic
1046581290 8:116095598-116095620 GATGCTGATACTGCTGGTATGGG - Intergenic
1046836331 8:118805783-118805805 GCTGCTGCTGCTGGTGGTCTAGG + Intergenic
1046868709 8:119179894-119179916 GGTGCTGATGTTGCTAGTCCAGG + Intronic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1047343993 8:124009710-124009732 GGAGCTGGTGCTGCTGTTCTAGG + Intronic
1047570039 8:126087803-126087825 AATGCTGATGCTGCTGGTCTGGG - Intergenic
1047807263 8:128373456-128373478 GGTGCTGCTGCTGCTGGTGTAGG + Intergenic
1047807306 8:128373837-128373859 GGTGCTAATGCTGCTGGTGCTGG + Intergenic
1048488435 8:134869840-134869862 GATGCTGATGCTGCTAGTCCGGG - Intergenic
1048524551 8:135190332-135190354 TGGGCTGAAGCTGCTGTGCTGGG - Intergenic
1048918866 8:139209797-139209819 GATGTTGACGCTGCTGGTCTGGG - Intergenic
1049096454 8:140551189-140551211 GGGGGTGAGGGTGCTGGTATGGG - Intronic
1049149430 8:141024910-141024932 TGGACTGATGCTGATGGTCCAGG + Intergenic
1049235638 8:141510893-141510915 GGGGGTGATGCTGATGGTGGAGG + Intergenic
1049284602 8:141767686-141767708 GGGGCTGAGGCTGCTGGCTCAGG + Intergenic
1049708577 8:144053770-144053792 TGGTCTGAGGCTGCAGGTCTGGG - Intronic
1049737977 8:144220150-144220172 TGAGCTAATGCTGCTGGTCTGGG - Intronic
1049923771 9:389586-389608 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1049952047 9:654904-654926 GATGGTGATGCTGCTGATCTCGG + Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1050003006 9:1098572-1098594 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1050005853 9:1129444-1129466 GATACTGATGTTGCTGGTCTGGG + Intergenic
1050054633 9:1639093-1639115 AGAGCTGATGCTGCTGGTCCTGG - Intergenic
1050064358 9:1743304-1743326 AGGGCAGCTGCTGCTGGGCTGGG - Intergenic
1050227263 9:3474064-3474086 GATGCTGAGGCTGCTGGGCTGGG + Intronic
1050242348 9:3650178-3650200 GGTGCTGATACTTCTGGTCCAGG + Intergenic
1050247265 9:3703731-3703753 GGTGCTGATGCTGCTGGTCCAGG - Intergenic
1050250536 9:3739393-3739415 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1050280036 9:4040880-4040902 AGTGCTGATGCTGCTGGACCAGG - Intronic
1050291202 9:4156878-4156900 GATGCTGATGCTGTTGGTCCAGG - Intronic
1050295137 9:4196979-4197001 GTGGCTTAGGCTGCTGGTCCAGG - Intronic
1050515595 9:6441052-6441074 GGTGCTGATGCTCCTGGCCAAGG - Intronic
1050516982 9:6454974-6454996 GATGTTGATGCTGCTGATCTTGG + Intronic
1050646064 9:7720838-7720860 GCTGCTGATGTTGCTGGTTTGGG + Intergenic
1050702739 9:8359210-8359232 GCTGCTGATGCTGCTGGTCATGG - Intronic
1050799187 9:9587686-9587708 GATGTTGATGCTGCTGTTCTGGG + Intronic
1050800918 9:9613072-9613094 GATGCTGATGCTGCTGGTTCAGG + Intronic
1051125579 9:13800865-13800887 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1051206594 9:14694633-14694655 GATACCGATGCTGCTGGTCTAGG - Intergenic
1051491456 9:17670963-17670985 GATGCTGAGGCTGCTGGCCTGGG + Intronic
1051807539 9:21012392-21012414 GATGCTGATGCCACTGGTCTAGG + Intronic
1051871617 9:21744465-21744487 GATGCTGATGCTGCTGGCTTGGG - Intergenic
1052024453 9:23559070-23559092 GATGCTGATGCTGCTAGTCTAGG + Intergenic
1052086548 9:24273725-24273747 GATACTGATGCTGCTGGTCTGGG + Intergenic
1052349405 9:27443145-27443167 GATCCTGATGCTGCTGGTCTAGG + Intronic
1052496976 9:29239600-29239622 GATGCTGATGCTGTGGGTCTGGG - Intergenic
1052996101 9:34552304-34552326 GGAGCTGGTGGTGCTGGTCGTGG + Exonic
1053257702 9:36632197-36632219 GATGCTGATGCTGCAGGTCTTGG + Intronic
1053354360 9:37433669-37433691 GCCACTGATGCTGCTGGTCCAGG + Intronic
1053598906 9:39590659-39590681 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1053856660 9:42345176-42345198 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1054729403 9:68685565-68685587 GATGCTGAGGCTGCTGGTCCAGG + Intergenic
1054870894 9:70046236-70046258 GATGCTGATGATGCTGGTCTCGG + Intronic
1054931817 9:70642905-70642927 GAGGCCGCTGCTGCTGATCTGGG + Intronic
1055023756 9:71697186-71697208 GATCCTGATGCTGCTGGTCTGGG + Intronic
1055115481 9:72600920-72600942 GATGCTGAGGCTGCTGGTCCAGG + Intronic
1055219633 9:73913095-73913117 AATGCTGATGTTGCTGGTCTGGG - Intergenic
1055257110 9:74384600-74384622 AGTGCTAATGCTTCTGGTCTAGG - Intergenic
1055296308 9:74837287-74837309 GGTTCTGATTCTGCAGGTCTGGG + Intronic
1055296316 9:74837349-74837371 GATGCTGATGCTGCTGGTCCAGG + Intronic
1055355715 9:75435182-75435204 CTAGGTGATGCTGCTGGTCTGGG + Intergenic
1055403686 9:75951316-75951338 GGGGCTGATGCTGGTCCACTGGG - Intronic
1055483109 9:76729352-76729374 GATGCTGATGTGGCTGGTCTGGG + Intronic
1055604389 9:77953164-77953186 TAAGCTGCTGCTGCTGGTCTGGG + Intronic
1055642053 9:78326764-78326786 GGGGGTTCTTCTGCTGGTCTTGG + Intronic
1055715532 9:79113589-79113611 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1055753015 9:79528089-79528111 TAGGCTGATGCTGCTGGCCCAGG + Intergenic
1055818285 9:80232504-80232526 GCAGCTGAGGCTGCTGGTCTAGG + Intergenic
1055868197 9:80841320-80841342 GATGCTGATGCTGCTGGTCCTGG - Intergenic
1056101403 9:83303544-83303566 GGGAGTGATGATGCTGGTCCAGG + Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056183257 9:84106108-84106130 GCATCTGATGCTGGTGGTCTAGG - Intergenic
1056307472 9:85304052-85304074 GATGCTGATGCTGCTGGTTCAGG - Intergenic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056493267 9:87129210-87129232 AGGGCTGGTGCTGCTGATCTGGG - Intergenic
1056545736 9:87611824-87611846 GATGCGGATGCTGCTGGTCTGGG + Intronic
1056575445 9:87852960-87852982 GATGCTGATGCTGTTGGACTGGG + Intergenic
1056823260 9:89859462-89859484 GATGCTGATGTTGCTGGTCTAGG + Intergenic
1056825443 9:89873534-89873556 TGTCCTGATGCTGCAGGTCTGGG + Intergenic
1056826483 9:89879569-89879591 GATGTTGATGGTGCTGGTCTGGG + Intergenic
1056928635 9:90855852-90855874 GATGCTGATGCTGCTGGTCTGGG + Intronic
1057201417 9:93142368-93142390 GGGGCTGATGCTGCTGGCCCAGG + Intergenic
1057230600 9:93319341-93319363 GGGGCTGCGGGTGCTGGGCTGGG + Intronic
1057356418 9:94335604-94335626 GATGCTGATGCTGATGGTCCAGG - Intergenic
1057611154 9:96544963-96544985 GGTCCTGGTGCTGCTGGCCTGGG - Intronic
1057651331 9:96922023-96922045 GATGCTGATGCTGATGGTCCAGG + Intronic
1057966271 9:99506355-99506377 TGTGCTAATGCTACTGGTCTTGG - Intergenic
1057985617 9:99710718-99710740 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1058000176 9:99856837-99856859 GATGCTGATGCTGCTGGTCTGGG + Intronic
1058071790 9:100608853-100608875 GGGGCTGATGGTACAAGTCTTGG + Intergenic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1058424271 9:104862807-104862829 GATGCTGATGCTGCTGACCTGGG + Intronic
1058623657 9:106911571-106911593 GATGCTGATGCTGCTGGTCCAGG + Intronic
1058703219 9:107618171-107618193 GATGCTGTTACTGCTGGTCTGGG - Intergenic
1058734656 9:107883311-107883333 GATGTTGATGCTGTTGGTCTGGG - Intergenic
1058867759 9:109177246-109177268 AATGCTGATGCTGCTAGTCTGGG - Intronic
1058894364 9:109386898-109386920 GAGGCTGCTGCTGCTGCTCCTGG + Intronic
1058981673 9:110176179-110176201 GATGCTGCTGCTGCTGGTCCAGG + Intergenic
1059432520 9:114258616-114258638 GGGGCTGATGCTGGTGGGAGGGG + Intronic
1059952969 9:119486994-119487016 GATGCTGCTGCTGCTGGTCTGGG - Intergenic
1060237580 9:121876760-121876782 GGCACTGATGCTGCTGGGCTGGG - Intronic
1060416704 9:123435794-123435816 GGTGCTGCTGCTGCTGGATTTGG + Intronic
1060509480 9:124221683-124221705 GGGTCTGATGCTGCCCCTCTAGG - Intergenic
1060788079 9:126466137-126466159 GTGGGTGATTATGCTGGTCTGGG + Intronic
1060908546 9:127330022-127330044 GATGCTGATACTGCTGGCCTAGG - Intronic
1060921212 9:127421892-127421914 GATGCTGCTGCTGCTGGCCTGGG + Intergenic
1060941152 9:127543606-127543628 GGGGCTGAGGTTGCGGATCTTGG - Intronic
1061039696 9:128132821-128132843 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1061141795 9:128771836-128771858 GGGGCTGAGGCTCCTGGGCCCGG + Exonic
1061669923 9:132182901-132182923 GAGGCTGCTGAAGCTGGTCTGGG - Intronic
1061883410 9:133579031-133579053 GGTGCTGATGCTGCGGCTCCTGG + Exonic
1061884869 9:133586370-133586392 GGGACTGGTGCTGCCGGGCTTGG + Intergenic
1061909775 9:133716491-133716513 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1061909797 9:133716548-133716570 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1062079767 9:134617650-134617672 GAGGGAGATGCTGCTGGTTTGGG + Intergenic
1062146299 9:134991613-134991635 GGATCTGCTGCTGCTTGTCTCGG + Intergenic
1062295317 9:135822150-135822172 GGAGCTGCTGGTGCTGGACTTGG + Exonic
1062382441 9:136292998-136293020 GGGGCTGGTGGGGCTGGTGTTGG - Intronic
1062617241 9:137403416-137403438 GCTGCTGCTGCTGCTGGGCTGGG - Intronic
1185778411 X:2824598-2824620 GACGCTGATGCTGCCGGACTAGG + Intergenic
1186470828 X:9821036-9821058 GATACTGATGCTGCTGGTCTGGG - Intronic
1186516998 X:10173710-10173732 GGTGCTGATTCAGCAGGTCTGGG - Intronic
1186563006 X:10632677-10632699 AGGGCCGATGCTGTTGGTTTTGG + Intronic
1186610003 X:11129783-11129805 GATGCTGATGCTGCTGGGCCAGG + Intergenic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1186763522 X:12747683-12747705 GAGGCTGATGCTGCTGGCCCAGG + Intergenic
1186764932 X:12761072-12761094 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1186839343 X:13469522-13469544 GATGCTGATGCTGCTAGTCCAGG + Intergenic
1186894520 X:13992604-13992626 GATGCTGATGTTACTGGTCTAGG + Intergenic
1186908141 X:14133175-14133197 GAGGCCGATGCTCCTGGTGTGGG + Intergenic
1186932718 X:14412582-14412604 GGTGACAATGCTGCTGGTCTGGG + Intergenic
1186974501 X:14886699-14886721 ACTGCTGATGCTGCTGGTCAGGG - Intronic
1186996405 X:15128226-15128248 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1187067985 X:15859514-15859536 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1187105647 X:16238790-16238812 GATGCTGATGCTGCTGATCTGGG + Intergenic
1187117870 X:16371774-16371796 GATGCTGATACTGCTGGTCTGGG + Intergenic
1187147740 X:16653357-16653379 GGTGCCAATGCTGCTGCTCTGGG - Intronic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1187345776 X:18462352-18462374 GATGCTGATGCTGCTGGTCTGGG - Intronic
1187389955 X:18879344-18879366 GGGGATGCTGCTGCTGCTGTGGG - Intergenic
1187510535 X:19913642-19913664 GATGCTGATGTTGCTGGTCTGGG + Exonic
1187528597 X:20076138-20076160 GATGCTGATGCTGCTAGTCTAGG + Intronic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1187707577 X:22023533-22023555 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1187717553 X:22118262-22118284 GCGACTGCTGCTGCTGGTCGTGG + Intronic
1187719989 X:22140087-22140109 AATTCTGATGCTGCTGGTCTGGG + Intronic
1187726486 X:22208588-22208610 GATGCAGATGCGGCTGGTCTGGG - Intronic
1187940677 X:24377824-24377846 GATGCTGATGCTGATGGTCCTGG + Intergenic
1188022655 X:25175547-25175569 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188060113 X:25590662-25590684 GGGGCTGCAGCTGCTGGTGCTGG - Intergenic
1188138013 X:26513309-26513331 CATGCTGATGCGGCTGGTCTAGG + Intergenic
1188254429 X:27943018-27943040 GATGCTGCTGCTGGTGGTCTAGG - Intergenic
1188350677 X:29127375-29127397 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188354694 X:29176405-29176427 GATGTTGATGCTGCTGGTCTAGG + Intronic
1188362673 X:29275159-29275181 GCAGGTGATGCTGCTGGTCCAGG - Intronic
1188437117 X:30173687-30173709 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1188511111 X:30937502-30937524 GATGCTGTTGCTTCTGGTCTGGG + Intronic
1188538721 X:31225752-31225774 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188650106 X:32621823-32621845 TGGGCTGATGCTGTTGGTCCAGG - Intronic
1188709486 X:33377202-33377224 GGGGCTGCTGGTGCAAGTCTTGG - Intergenic
1188710399 X:33390065-33390087 GTTGTTGATGCTGCTGGTCCAGG - Intergenic
1188968365 X:36582196-36582218 GTTGCTGATGCTGCTGCTTTAGG - Intergenic
1189045924 X:37590906-37590928 GCTACTGCTGCTGCTGGTCTGGG + Intronic
1189075608 X:37910824-37910846 GATGTTGATGCTGCTGGTGTAGG + Intronic
1189124035 X:38426442-38426464 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189171752 X:38916242-38916264 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1189211932 X:39290987-39291009 GCTGCTGATGCTGCTGGTCGAGG + Intergenic
1189250721 X:39599058-39599080 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1189363101 X:40368563-40368585 GCAGCTGATTCTGCAGGTCTGGG + Intergenic
1189403119 X:40690934-40690956 TGGGCTGATGATGATGGCCTTGG - Intronic
1189741392 X:44120588-44120610 GATGCTGAGGCTGCTGGTCTAGG - Intergenic
1189862893 X:45291593-45291615 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1189870924 X:45381918-45381940 GGTGCTGGGGCTGCTGGTGTGGG - Intergenic
1189875048 X:45427542-45427564 GATTCTGGTGCTGCTGGTCTGGG + Intergenic
1189943913 X:46157403-46157425 GATGCTGATGCTGCTGGTCCGGG - Intergenic
1190367315 X:49708499-49708521 GATGCTGAGGCTGCTGGTCTGGG + Intergenic
1190399344 X:50016071-50016093 GATGCTGATGCTGCTAGTCTTGG - Intronic
1190455767 X:50626518-50626540 GATGCTGATGCAGCTGGTCCTGG - Intronic
1190464254 X:50709820-50709842 GATGCTGATGCTACTGGTCCAGG - Intronic
1190522993 X:51299027-51299049 GGTGCTGCTGCTGCTGATTTAGG - Intergenic
1190827604 X:54031956-54031978 GATGCTGATGCTGCTGGTCCAGG + Intronic
1190827648 X:54032291-54032313 AATGCTGATCCTGCTGGTCTGGG + Intronic
1191011118 X:55760434-55760456 GATGCTGATCCTGCTGGTCCAGG + Intergenic
1191634133 X:63358107-63358129 TGGGCTGATGCTGCAGCTTTAGG - Intergenic
1191668853 X:63730620-63730642 GATACTGATGCTGCTGGTCTGGG + Intronic
1191747877 X:64509875-64509897 GGTGTTGATGCTGTTGGTCCAGG + Intergenic
1192150672 X:68710482-68710504 GATGTTGATGCTGCTAGTCTGGG + Intronic
1192175742 X:68884168-68884190 GGTGTTGAAGCTGCTGGTCTGGG - Intergenic
1192264210 X:69527849-69527871 GATGGTGATGCTGCTGGTCCAGG + Intronic
1193349157 X:80438205-80438227 GATGCTAATGCTGCTGGTCAGGG - Intronic
1193801421 X:85941272-85941294 GTTGCTCATGCTGCTGGTCTAGG - Intronic
1194721522 X:97346172-97346194 GATGCTGATGTTGCTGGTCCAGG - Intronic
1194872076 X:99144811-99144833 GATGCTGATGCTGCTGATCTAGG + Intergenic
1195372362 X:104189921-104189943 GATGCTGAAGCTGCAGGTCTTGG - Exonic
1195404872 X:104501835-104501857 GAGGCTGATGCTACTGGTCCAGG - Intergenic
1195416154 X:104621557-104621579 GCAGCTCAGGCTGCTGGTCTAGG - Intronic
1195418051 X:104641710-104641732 TGGGCTGCAGCTGCCGGTCTTGG - Intronic
1195652484 X:107299843-107299865 TGAGCTGAAGCTGCTGGTCCGGG - Intergenic
1195762001 X:108256639-108256661 GATGCTGATGCTCCTGGTCCAGG - Intronic
1195821782 X:108953518-108953540 GGTGCTGATGCTGCTGGTAAAGG - Intergenic
1195865849 X:109432044-109432066 GATGCTGATGCAGCTGGTCCAGG - Intronic
1195961221 X:110388743-110388765 GATGCTGATGCTCCTGGTCCAGG + Intronic
1196087251 X:111697397-111697419 GGTGATGATGATGCTGGTCCAGG - Intronic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1196963944 X:121035093-121035115 AATGCTGATGCTGCTGGCCTAGG - Intergenic
1197285793 X:124593498-124593520 GCGGCTCAGGCTGCTAGTCTAGG + Intronic
1197328882 X:125128852-125128874 TGTGCTGATGCTGTTGGTGTTGG + Intergenic
1197440952 X:126489426-126489448 TATTCTGATGCTGCTGGTCTGGG - Intergenic
1197594747 X:128451536-128451558 GGTGCTGATGGTGGTGGTCAAGG + Intergenic
1197693876 X:129530138-129530160 GATGCTGATGCTGTTGGTCCGGG + Intergenic
1197717401 X:129719386-129719408 GATGCTGATGTTGCTGGTCCAGG + Intergenic
1198228018 X:134664266-134664288 AATGCTGATGCTGTTGGTCTGGG + Intronic
1198464597 X:136893570-136893592 GGTGTTGATGCTGCTATTCTGGG - Intergenic
1198501736 X:137256365-137256387 GATGCTGCTGCTGCTGATCTGGG + Intergenic
1198562068 X:137861147-137861169 GATGCTGATGCTGCTGGTCGGGG + Intergenic
1198651159 X:138865079-138865101 GGTGCTGATGCTGCTGGTCAAGG + Intronic
1198710187 X:139493064-139493086 GGCCCTGGTGCTGCTGATCTGGG + Intergenic
1198793907 X:140375524-140375546 GGTGTTGATACTGCTGGTCCTGG - Intergenic
1198950854 X:142070521-142070543 GATGCTGACGCTGCTGGTCTGGG - Intergenic
1199236797 X:145502357-145502379 GGAGGTGATGCTGCAGATCTGGG - Intergenic
1199766362 X:150944492-150944514 GATGCTGATGCTGCTGGTCCGGG + Intergenic
1199917710 X:152362096-152362118 GGGGCTGAGGCTGCAGAACTGGG - Intronic
1201291525 Y:12425132-12425154 GATGCTGATGCTGCTGGACCAGG - Intergenic