ID: 1187246856

View in Genome Browser
Species Human (GRCh38)
Location X:17560623-17560645
Sequence ATAGTGCTGAACCATGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187246856 Original CRISPR ATAGTGCTGAACCATGTGCT GGG (reversed) Intronic
900385791 1:2410058-2410080 ACAGTGCTGAGCCATGTCATAGG - Intronic
902564763 1:17304208-17304230 ATAATGCTGAAGCAAGAGCTAGG + Intergenic
903313227 1:22477314-22477336 ACAGTGCTTAACAATATGCTAGG + Intronic
904388968 1:30166902-30166924 ATAGTGCTGGATTTTGTGCTGGG - Intergenic
911493923 1:98606653-98606675 ATAGTGCTGAAAATTCTGCTAGG + Intergenic
914782508 1:150798561-150798583 ATAGTGCTCAATTATGTGCTGGG - Intronic
915757490 1:158276799-158276821 ATAGTGATGAACCCTGTATTTGG + Intergenic
917137799 1:171804337-171804359 AGAGTGCTGTACCATGTTGTAGG - Intronic
918669033 1:187189970-187189992 ATACTGCTTATCCATGAGCTAGG + Intergenic
919084541 1:192906367-192906389 AAAGTGCTTAACCTCGTGCTGGG - Intergenic
921081891 1:211746901-211746923 ACAGTGATGGAACATGTGCTTGG - Exonic
922435552 1:225601672-225601694 ATATTACTAAACCATGTGGTAGG + Intronic
1063109982 10:3027047-3027069 AAACTGCTGGACCATGTGGTTGG + Intergenic
1065266497 10:23982047-23982069 GTAGTGGTGAGCCATGTGCCTGG + Intronic
1071564383 10:86664165-86664187 ACAGTGATGGAGCATGTGCTGGG - Intronic
1073070305 10:100789035-100789057 ACAGTGCTGAACCAGGGTCTGGG - Intronic
1073806028 10:107099000-107099022 ATAGTGCAGAAGCTTGTGCTGGG - Intronic
1077518258 11:3015528-3015550 ATTGTGCTGTCCCATGAGCTTGG - Intronic
1081011697 11:37821006-37821028 ATAATGTGGAACCATGTGATAGG - Intergenic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1081932543 11:46882036-46882058 ATAGTGCTGAGCCCAGAGCTGGG - Intronic
1083351705 11:62034135-62034157 CAAGTGCTCAGCCATGTGCTAGG - Intergenic
1086755467 11:90556858-90556880 CTAGTGCTTAAACAGGTGCTGGG + Intergenic
1086910254 11:92463985-92464007 AAAGCCCTTAACCATGTGCTAGG - Intronic
1087097408 11:94332439-94332461 ATAGTGTTCATCCATGTGCAAGG + Intergenic
1088879674 11:113963609-113963631 GCAGTGCTGGTCCATGTGCTTGG - Intergenic
1100249665 12:92805172-92805194 ATAATGATGAACCATTTGGTTGG + Intronic
1100687968 12:97007271-97007293 ACTGTGCTGAAGCCTGTGCTGGG + Intergenic
1100824740 12:98463887-98463909 ACAGTGCCTAACCATTTGCTAGG + Intergenic
1104336995 12:127908098-127908120 ATTTTGCTGAATCTTGTGCTTGG - Intergenic
1106184377 13:27396182-27396204 ACAATGCTGACCCGTGTGCTGGG - Intergenic
1107080577 13:36370272-36370294 GTGGTGCTGATCCATCTGCTGGG + Intergenic
1108338104 13:49466930-49466952 ACAGGGATGAACCTTGTGCTTGG + Intronic
1109931150 13:69220371-69220393 ATAGTGCTGAAGAATATTCTAGG + Intergenic
1112185114 13:97120487-97120509 ATCCTGCAGAACCATGTGATAGG - Intergenic
1121872852 14:97425512-97425534 TTAGTGATGAGCCCTGTGCTAGG + Intergenic
1124377024 15:29134868-29134890 AAAGGTCTGAACCCTGTGCTAGG + Intronic
1125322700 15:38505702-38505724 TTAGTGCTCAACCTTATGCTAGG - Intronic
1127105830 15:55613955-55613977 GCAGAGATGAACCATGTGCTTGG + Exonic
1127952807 15:63826145-63826167 AGAGTGCTGCTCCAGGTGCTTGG - Intronic
1129155527 15:73714947-73714969 ATAGGGCAGAACTATGTCCTGGG - Intergenic
1131316813 15:91346352-91346374 ATAGTGCTTAACACAGTGCTGGG + Intergenic
1131842744 15:96454714-96454736 AAAGTGCTGAGCAATGTGCATGG + Intergenic
1133438606 16:5801707-5801729 ATAGAGATGAACCATCTGGTGGG + Intergenic
1144074043 17:11701128-11701150 ATATGGCTGAACCATGTCCTTGG + Exonic
1146810096 17:35896366-35896388 GAAGTTCTGAACCATGTGGTAGG + Intergenic
1148454575 17:47804140-47804162 AGAGTGCTGAACCAGGTGAGAGG - Intergenic
1148541837 17:48487205-48487227 ATAGTTCTTAACTTTGTGCTTGG - Intergenic
1148977302 17:51540711-51540733 ATAGTGCTTTACCAAGGGCTGGG - Intergenic
1155261645 18:24049518-24049540 TGGGTGCTGAACCCTGTGCTGGG + Intronic
1155652777 18:28160919-28160941 ACATTTCTGAACCTTGTGCTAGG - Intronic
1156020329 18:32593133-32593155 ATTGGGCTGAAGCATGTGCTTGG + Intergenic
1162838232 19:13335818-13335840 TTTATGCTGAACCTTGTGCTGGG - Exonic
1164290195 19:23861321-23861343 AAAGTGCTGAACCCTGTTCAAGG - Intergenic
1166886455 19:45963977-45963999 ATAGAGCTCACCCATGTCCTAGG + Intronic
1168467799 19:56618363-56618385 ACAGTGCTGAACAATTTGCACGG - Intronic
1168472222 19:56649035-56649057 ATAGTGCAGAAATAAGTGCTGGG + Intronic
925895055 2:8464765-8464787 ATAGTGCTGAACAATAAGATTGG - Intergenic
926922132 2:17949563-17949585 AATGTGCTGCACCATGTTCTTGG + Intronic
934476035 2:94594212-94594234 TGAGTGCTGAAACATGTGCCAGG - Intronic
934896352 2:98123394-98123416 GTAGGGCTGAACCACGTGCTTGG + Intronic
935217443 2:100985382-100985404 ACAGTGCTTAACCACGTGCCTGG - Intronic
935428536 2:102947154-102947176 ATAATGCTGAAATATGTCCTTGG + Intergenic
940238745 2:151540233-151540255 ATAGTTCTAAACCATGGCCTAGG - Intronic
940745781 2:157566247-157566269 ATAGCTCTGTACTATGTGCTGGG - Intronic
941551701 2:166924408-166924430 ATAAAGCTGATCCATGTCCTTGG - Intronic
943579295 2:189665805-189665827 AAAGTGCTTAGCCAAGTGCTTGG + Intronic
946401954 2:219472910-219472932 ACAGTGCAGCACCAGGTGCTGGG + Exonic
946725467 2:222657223-222657245 ATAGGGCTGCCCCATGGGCTGGG - Intergenic
946883249 2:224197134-224197156 ATTGTGTTGAACCCTATGCTGGG + Intergenic
1170293499 20:14797623-14797645 ATAGGGCTGAACCCGGGGCTTGG - Intronic
1170910992 20:20567983-20568005 ACAGTGCTGGACTCTGTGCTGGG - Intronic
1171002947 20:21433306-21433328 CTGGTGCTGAGCCATGTGCATGG - Intergenic
1174082274 20:47979009-47979031 ACAGTGCTGAACCAGGAGCAGGG + Intergenic
1185280804 22:49969095-49969117 ATGGGGCTGCATCATGTGCTGGG - Intergenic
953721774 3:45362405-45362427 ATTGTGCTAAACAATGTCCTGGG - Intergenic
955778128 3:62455322-62455344 AAATTGCTTAACCTTGTGCTAGG - Intronic
957124057 3:76134913-76134935 ATATTGTTGAAACATATGCTTGG - Intronic
958800211 3:98746129-98746151 ATAGGGCTGCTCCATCTGCTTGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
963126989 3:141825505-141825527 ATAGTTCTGAGACATATGCTAGG + Intergenic
970291324 4:14575649-14575671 CTAGTGCTGAACCCAGAGCTTGG - Intergenic
971477167 4:27083288-27083310 ATTGAGCTGTACTATGTGCTGGG + Intergenic
972059769 4:34854784-34854806 ATAGTTCTGGACCCTGGGCTAGG - Intergenic
974410956 4:61540049-61540071 ATAGTGCTGAAAAATGTACCTGG - Intronic
975101333 4:70516733-70516755 ATAGTGCTGAAGGATGTGGAAGG - Intergenic
978391807 4:108235150-108235172 ATGGTGTTGAACCCTCTGCTTGG + Intergenic
978804060 4:112782455-112782477 ATAGTGCTTACCTATGTGCCAGG + Intergenic
981236737 4:142425379-142425401 ATAGTGGAGGACCATTTGCTGGG - Intronic
982890593 4:160844514-160844536 ATGGTGCTAAAACATGTTCTTGG + Intergenic
988549238 5:32185436-32185458 ATGGTGCTGAACCATTTGTGAGG - Intergenic
990894975 5:60689131-60689153 TTAGTTCTCAACCATGTGCCAGG - Intronic
1005014002 6:21360510-21360532 AGAGTGGTGAAGCATGTGATGGG - Intergenic
1005396716 6:25389890-25389912 CTGGTGTTGAACTATGTGCTAGG + Intronic
1006745585 6:36339656-36339678 ACAGTTCCCAACCATGTGCTGGG + Intergenic
1007392533 6:41558343-41558365 CAAGTGCTGAACCAAGGGCTGGG + Intronic
1010285666 6:74074707-74074729 GTCATGCTGAACCTTGTGCTTGG - Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1014530626 6:122555114-122555136 TTAGTTATGAACTATGTGCTGGG + Intronic
1026404139 7:70047482-70047504 ATAGAGCTGAACCAAATGTTGGG + Intronic
1033483142 7:141761356-141761378 TTTGTGCTGGACCCTGTGCTAGG + Intronic
1035327571 7:158074928-158074950 ATACTGCTAAACCAAGGGCTAGG - Intronic
1042385810 8:68172877-68172899 ATGGAGCTGAAGCATGTCCTGGG - Intronic
1042530684 8:69811749-69811771 TTAGTGTTTAACCATGTGCCAGG + Intronic
1045448981 8:102300344-102300366 TTAGTGCTGAACGGTGTACTAGG - Intronic
1061487361 9:130926921-130926943 ATAGGCCTATACCATGTGCTGGG - Intronic
1061887522 9:133599336-133599358 ACAATGCAGCACCATGTGCTGGG - Intergenic
1186273477 X:7915496-7915518 AAAGTGCTGTACCAAGTGATAGG - Intronic
1187246856 X:17560623-17560645 ATAGTGCTGAACCATGTGCTGGG - Intronic
1188690740 X:33125295-33125317 TTATTGCTGAAGCATGTGATAGG + Intronic
1192988978 X:76429164-76429186 CTAGAGCTAAACAATGTGCTCGG - Exonic
1193630892 X:83887041-83887063 ATACTCCTGAACCATATCCTAGG + Intergenic
1195246289 X:102998545-102998567 AGAGTGCTGAACCAGGTGGAAGG - Intergenic
1195482326 X:105360071-105360093 ATAGCACACAACCATGTGCTCGG - Intronic
1196023517 X:111015035-111015057 CTAGTGCTAAACCCTGGGCTAGG - Intronic
1198431095 X:136567086-136567108 ATAATGCTCAACCATTGGCTGGG - Intergenic
1199151275 X:144489815-144489837 ATAGGGATATACCATGTGCTAGG - Intergenic