ID: 1187247111

View in Genome Browser
Species Human (GRCh38)
Location X:17562570-17562592
Sequence TGCTATAATCACAAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187247111 Original CRISPR TGCTATAATCACAAAGGGGT GGG Intronic
900753635 1:4417715-4417737 GGGAATAATCACAAAGGGGCCGG + Intergenic
911428898 1:97757999-97758021 TGAGATAATCAAAAAGGGGCAGG - Intronic
912246166 1:107964309-107964331 TTCTATAATAACGAAGGGGAGGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913555182 1:119959333-119959355 TGCTATATTCCCAAAGTGATAGG + Intronic
915007263 1:152650209-152650231 AGCTGTAATCCCAAAAGGGTGGG + Intergenic
915259194 1:154663935-154663957 TGCTAGAATCCCAAAGTGGCTGG + Intergenic
918250787 1:182701348-182701370 TGCTATTATCACTTAGGGGTTGG - Intergenic
923522081 1:234742878-234742900 TGAAATAATCACAAAGACGTTGG + Intergenic
1063125975 10:3137136-3137158 TGTTAAAACCACCAAGGGGTGGG + Intronic
1066166091 10:32789721-32789743 TGCTATTATCACAGAGGAGTAGG + Intronic
1068873044 10:61965815-61965837 GGCCATAATCTCAAAGAGGTAGG + Intronic
1070355949 10:75640414-75640436 TGCTAAAATCACAAAGGGAGGGG - Intronic
1072369209 10:94746589-94746611 GGCTATAATCTCAAAGTGCTGGG - Intronic
1072385022 10:94915864-94915886 GGCTATAATCTCAAAGTGCTGGG - Intergenic
1080649053 11:34208699-34208721 TGCTGTACTCACAGAGGGGCTGG - Intronic
1082779563 11:57276224-57276246 TGTTATAATAACAGAGGGCTGGG - Intergenic
1082907930 11:58332704-58332726 TTATATAATGACAAAGAGGTAGG - Intergenic
1083220073 11:61246503-61246525 TGCTGTAATCCCAAAGTGCTGGG - Intronic
1090498296 11:127236071-127236093 TTATATAATCACAAAGGACTGGG - Intergenic
1091363624 11:134999003-134999025 TGCTATGATCCCACAGGAGTTGG - Intergenic
1097972560 12:65650127-65650149 TCCTTTAATCACAAAGTGTTTGG + Intergenic
1099794770 12:87385482-87385504 TGCTATCATCTCAAAGTGCTGGG + Intergenic
1099978594 12:89572111-89572133 TGCTAGAATAACAAAGGGACAGG - Intergenic
1099991887 12:89731488-89731510 TGCTATAAGCCTAAAGTGGTAGG + Intergenic
1102322851 12:111953109-111953131 TGTTATCATCACAAAGTGTTGGG - Intronic
1104436367 12:128760148-128760170 TGCTGTAAGCAAAAAGGGGGTGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105979780 13:25506703-25506725 CACTATAATCCCAAAGGGCTGGG + Intronic
1106175196 13:27324291-27324313 TGCTATAAGCACACATGGATGGG - Intergenic
1109191929 13:59335347-59335369 TTCTATAATCACCAAGGAATAGG + Intergenic
1110213796 13:73003963-73003985 GGCTATAATCTCAAAGTGCTGGG + Intronic
1111736268 13:92143233-92143255 TAGTATAATCATAAAGGGCTTGG - Intronic
1111915960 13:94360616-94360638 TGCTAGAATCACAATGATGTTGG + Intronic
1112960044 13:105112800-105112822 TGCTGAAATCACAAAAGGGCAGG - Intergenic
1115336174 14:32246079-32246101 TGCTAGAATTACATATGGGTTGG + Intergenic
1117754827 14:58963955-58963977 TGCTATATTGACAAACTGGTGGG - Intergenic
1121315570 14:92959204-92959226 TGCTCTAAGGACAGAGGGGTGGG + Intronic
1121402486 14:93692455-93692477 TGCTATAATGTCAGAGGGTTAGG + Intronic
1122838067 14:104441085-104441107 TTGTATAATCAGAAAGGGATGGG - Intergenic
1123103346 14:105820597-105820619 TGCTATTATCTCAAAGTGCTGGG + Intergenic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1202837572 14_GL000009v2_random:90026-90048 AGTTTTAATCATAAAGGGGTGGG + Intergenic
1202906959 14_GL000194v1_random:80156-80178 ATCTTTAATCATAAAGGGGTGGG + Intergenic
1126077654 15:44928246-44928268 TGCTGTAATCCCAAAGTGCTGGG - Intergenic
1126708660 15:51431836-51431858 CTCTATAATTATAAAGGGGTTGG + Intergenic
1127468199 15:59265695-59265717 TGCTATAATCACAACACTGTGGG + Intronic
1128200970 15:65807673-65807695 GGGTTCAATCACAAAGGGGTAGG - Intronic
1129799017 15:78399527-78399549 TGCCATCATCAGAAACGGGTTGG + Intergenic
1132175857 15:99713836-99713858 TGCTATATACACAAAGAGTTTGG - Exonic
1133247551 16:4459217-4459239 TGCTACAAACACAGAGGGGCAGG - Intergenic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1135843587 16:25897858-25897880 TGCTAAAATGAGAAAGGGGGCGG - Intronic
1137516374 16:49148143-49148165 ATCTAAGATCACAAAGGGGTAGG + Intergenic
1139030296 16:62872789-62872811 TTCTATAATCACAAAGATATTGG + Intergenic
1139793515 16:69462286-69462308 TGCTTTTATCACAAAGTAGTTGG - Intronic
1148208752 17:45795515-45795537 TGCTATAATCAGGAAGGGGGAGG - Intronic
1148518596 17:48246374-48246396 GGCTATACCCACAAAGGTGTAGG - Intronic
1148818770 17:50348256-50348278 TAATAGAATTACAAAGGGGTTGG + Intronic
1150991023 17:70259336-70259358 GGCTGTGATCCCAAAGGGGTGGG + Intergenic
1153486699 18:5605719-5605741 TTCTAAAATCAGAAAGAGGTTGG - Intronic
1156856181 18:41783791-41783813 TGCCATCATCACAAAGAGGGAGG - Intergenic
1160277623 18:77452136-77452158 TTCTATAATTTGAAAGGGGTTGG + Intergenic
1161917375 19:7238811-7238833 TGCTTCAATCAGGAAGGGGTGGG + Intronic
1165844149 19:38807393-38807415 TGCAAAAAACACAAAGTGGTAGG + Intronic
1202635073 1_KI270706v1_random:37325-37347 AGCTTTAATCATAAAGGAGTGGG - Intergenic
1202650146 1_KI270706v1_random:172780-172802 AGCTTTAATCATAAAGGAGTGGG + Intergenic
928682541 2:33717150-33717172 TGCAATAGTCAGAAAAGGGTAGG - Intergenic
929537915 2:42795557-42795579 TGCTGTAATCACAAAGTGCTGGG + Intergenic
931118662 2:59192415-59192437 TACTAAAATCAGGAAGGGGTGGG + Intergenic
931331644 2:61292125-61292147 TACTATATTCACAAAGTTGTGGG - Intronic
931954731 2:67409054-67409076 TGGTATAATCAGAAATGGGAGGG - Intronic
932022326 2:68099712-68099734 TGCTCTAATGACAGAGGGGAGGG + Intronic
933559621 2:83874411-83874433 TTCTATAACCAAAAAGAGGTTGG - Intergenic
937761775 2:125613065-125613087 TGCTTTAAACACAGTGGGGTGGG - Intergenic
942254522 2:174082715-174082737 TCCTTTAATCACAAAGGATTTGG + Intronic
943893455 2:193321788-193321810 TGCTATAACCACAGACGGGGTGG + Intergenic
944881831 2:204020610-204020632 TGGTATAGTCACAAAAGGGTAGG - Intergenic
946673217 2:222128689-222128711 TGCTCTCATCACATAGGGTTGGG - Intergenic
947129446 2:226905972-226905994 TGCTGTTACCACAAAGGGGGGGG - Intronic
947972422 2:234335383-234335405 TTCTATAGGCACAAAGGGGTGGG + Intergenic
1170212930 20:13863224-13863246 GGCTATAACCACAAAGAGATAGG + Intronic
1171881225 20:30618507-30618529 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG + Intronic
1173689201 20:44946398-44946420 GGTTTTAATTACAAAGGGGTTGG + Intronic
1176601667 21:8799771-8799793 AGCTTTAATCATAAAGGAGTGGG - Intergenic
1176626307 21:9094957-9094979 AGCTTTAATCATAAAGGGGTGGG + Intergenic
1179272152 21:39859904-39859926 TGCAATAATCATAAAAGGGCAGG - Intergenic
1180343952 22:11691322-11691344 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1180365631 22:11935902-11935924 AGCTTTAATCATAAAGGTGTGGG + Intergenic
1183760655 22:39813260-39813282 TGCTACACTCACAAAAGAGTTGG - Intronic
949170324 3:988766-988788 TGCTATAGAAACAATGGGGTTGG - Intergenic
952692812 3:36229972-36229994 TTCTTTACTCATAAAGGGGTTGG - Intergenic
953940652 3:47092868-47092890 TGTTATAACCAGGAAGGGGTAGG - Intronic
956183705 3:66542884-66542906 TGCAATAAACACAAAGGTGCAGG + Intergenic
960071649 3:113437812-113437834 TGTTTTAATAACAAAGGGATTGG + Intronic
960421115 3:117446866-117446888 TGTTATAATCCCAAATGGCTTGG + Intergenic
961105964 3:124241859-124241881 TGCTAAAAGCACGAAGGGGTAGG + Intronic
963523448 3:146385667-146385689 TGCTATCATCTCAAAGAGCTGGG - Intergenic
963577709 3:147082752-147082774 TGATATAAAAACAAAGGGGGAGG + Intergenic
967166775 3:186787006-186787028 TGCTAGGATCCCAAAGGGCTGGG + Intronic
1202739591 3_GL000221v1_random:41898-41920 AGCTTTAATCATAAAGGAGTGGG + Intergenic
968880708 4:3297698-3297720 GGCTCCAATCCCAAAGGGGTGGG - Intronic
970115134 4:12686439-12686461 TGCTCTGCTCACAAATGGGTGGG + Intergenic
971904548 4:32710016-32710038 TGCCCTGATCACAAAGGGGCAGG + Intergenic
973364992 4:49201578-49201600 AGCTTTAATCATAAAGGAGTGGG - Intergenic
973395599 4:49590876-49590898 AGCTTTAATCATAAAGGAGTGGG + Intergenic
974666037 4:64962842-64962864 AGCAATAATCAGAAAGTGGTTGG - Intergenic
977050378 4:92121738-92121760 TTCTATAATCACAAAGGCTCTGG + Intergenic
979618313 4:122769523-122769545 TGCTAGAATCACAAAGATGAGGG - Intergenic
980459781 4:133094228-133094250 TGGTAGAATCACTAAGGAGTTGG + Intergenic
983524283 4:168744572-168744594 TCCTAAAATAACAGAGGGGTTGG - Intronic
1202762375 4_GL000008v2_random:123205-123227 AGCTTTAATCATAAAGGGGTGGG - Intergenic
991207499 5:64066257-64066279 TGCAGGACTCACAAAGGGGTTGG - Intergenic
994199228 5:96953337-96953359 AGGTATAATCACAAAATGGTTGG + Intronic
994583381 5:101675956-101675978 TGCTATAAACAAACTGGGGTGGG - Intergenic
997852918 5:137348454-137348476 TGCTGCAATCCCAGAGGGGTGGG + Intronic
999599153 5:153241519-153241541 TGTTAAAAACACAAAGGGCTGGG - Intergenic
1003349615 6:5303655-5303677 TGCAATAATCACAAAGATGGAGG - Intronic
1004259046 6:14091611-14091633 TGCTATTATCACCAAGGAATAGG + Intergenic
1008408715 6:51148082-51148104 TTCTATAATCAGTAAGGGCTGGG + Intergenic
1008562283 6:52734952-52734974 TGACATAATCACAAATGGCTTGG - Intergenic
1008927847 6:56906072-56906094 GGCTATATGTACAAAGGGGTTGG - Intronic
1015733105 6:136368114-136368136 TCCTTTAATCACCTAGGGGTAGG + Intronic
1015753603 6:136585760-136585782 TGCTGTAATCCCAAAGTGCTGGG + Intronic
1016869302 6:148800724-148800746 GGCTATAATCAAAAAGAGGGTGG - Intronic
1020473586 7:8567942-8567964 TTCTATAAATATAAAGGGGTTGG - Intronic
1028338821 7:89692758-89692780 TTCTATAATCACTATGGGTTTGG - Intergenic
1032774269 7:135094392-135094414 TGCTAGAATCATAAACTGGTAGG + Intronic
1033862460 7:145644620-145644642 CGCAATGTTCACAAAGGGGTGGG + Intergenic
1036714917 8:11112380-11112402 TGTTCTAACCACAAAGAGGTAGG + Intronic
1038960501 8:32513044-32513066 TTCTATAAAGACAAAGAGGTAGG + Intronic
1043234145 8:77840235-77840257 GGCTATCATCTCAAAGCGGTGGG + Intergenic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1049220488 8:141426663-141426685 GGCTCTATTCAGAAAGGGGTGGG + Intronic
1051392174 9:16577035-16577057 TCCTATAATCAAAAAGGTTTTGG - Intronic
1053758713 9:41335263-41335285 TGCTATAGTTACCAAGTGGTGGG + Intergenic
1058188898 9:101889487-101889509 TGGTAAAATCACAAAGGGAGAGG + Intergenic
1058192258 9:101933149-101933171 TGCTAAAACCCCAAAGAGGTAGG + Intergenic
1060513598 9:124251677-124251699 TACTAAAATCACAAAGGAGTTGG - Intergenic
1203749480 Un_GL000218v1:65376-65398 AGCTTTAATCATAAAGGTGTGGG + Intergenic
1203708237 Un_KI270742v1:71855-71877 AGCTTTAATCATAAAGGAGTGGG + Intergenic
1203543139 Un_KI270743v1:108086-108108 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1186178091 X:6946054-6946076 TGCTGAAATCACAAAGGGTAGGG - Intergenic
1187247111 X:17562570-17562592 TGCTATAATCACAAAGGGGTGGG + Intronic
1187281555 X:17861322-17861344 TACTATATACACCAAGGGGTGGG + Exonic
1195051005 X:101096854-101096876 TGCTAACATCACAAAAGTGTGGG - Intergenic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1201162841 Y:11180386-11180408 AGCTTTAATCATAAAGGGGTGGG + Intergenic
1201472062 Y:14344475-14344497 TGCTCTAAGCACAGAGGGATGGG + Intergenic
1201770691 Y:17614622-17614644 TTCTATAACCAAAAAGAGGTTGG + Intergenic
1201830864 Y:18291364-18291386 TTCTATAACCAAAAAGAGGTTGG - Intergenic