ID: 1187249208

View in Genome Browser
Species Human (GRCh38)
Location X:17581738-17581760
Sequence ACCACGAAGGGGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187249208_1187249214 19 Left 1187249208 X:17581738-17581760 CCTTTCACCTTCCCCTTCGTGGT 0: 1
1: 0
2: 1
3: 25
4: 294
Right 1187249214 X:17581780-17581802 CAAGATCTCCTGCGAACGTTTGG 0: 1
1: 0
2: 0
3: 0
4: 28
1187249208_1187249213 -4 Left 1187249208 X:17581738-17581760 CCTTTCACCTTCCCCTTCGTGGT 0: 1
1: 0
2: 1
3: 25
4: 294
Right 1187249213 X:17581757-17581779 TGGTGACTTGAAACTGATGAAGG 0: 1
1: 0
2: 1
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187249208 Original CRISPR ACCACGAAGGGGAAGGTGAA AGG (reversed) Intronic
901889402 1:12249714-12249736 ACCACGAATATGAAGGTCAAAGG - Intronic
903270881 1:22187519-22187541 ACAAGGAAGAGGAAGGAGAATGG - Intergenic
903366804 1:22810380-22810402 AGCACGAAGGGGAGGCTCAATGG - Intronic
904070757 1:27795093-27795115 CCCACGACAGGGAAGTTGAAAGG - Intronic
906460507 1:46032448-46032470 TCCACAAAGGGGAAGCTGGAAGG - Intronic
907621288 1:55983449-55983471 AAGGCGAAGGGGAAGGGGAAGGG + Intergenic
908511711 1:64854819-64854841 GCCATGAAGGTGAAGGTGGAAGG - Intronic
908528249 1:65008628-65008650 AAGGCGAAGGGGAAGGGGAAGGG - Intergenic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
909793183 1:79701054-79701076 GCCACTGAGGGGAAGGAGAAGGG + Intergenic
909952245 1:81734350-81734372 AACATGGAGGGGAAGGTGATAGG + Intronic
909952332 1:81735107-81735129 AACATGGAGGGGAAGGTGATAGG + Intronic
910397019 1:86803773-86803795 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
910675211 1:89809308-89809330 AGCAGGAAGGGAAAGCTGAAGGG - Intronic
912220273 1:107666113-107666135 AAGAGGAAGGGTAAGGTGAAGGG - Intronic
916087894 1:161284495-161284517 AGCATGAAGGTGAAGGTGAAGGG - Exonic
916496427 1:165352457-165352479 ACCAGGAAGGCGACAGTGAAAGG + Intronic
919857249 1:201714329-201714351 ACAAGGAAGGAGAAGGAGAAGGG - Intronic
920026995 1:203006346-203006368 ACCGCACAGGGGAAGGTGATGGG + Intergenic
920549009 1:206842691-206842713 ACCTTGAAGGGGAAGGAGATGGG + Exonic
920667533 1:207974435-207974457 ACCAAGGAGGGGAAGGGGAAGGG - Intergenic
921020138 1:211227583-211227605 ATCACAAAGGGGAAGGAGAGGGG + Intergenic
922558524 1:226550282-226550304 AGCTCGGAGGGGAAAGTGAACGG - Intronic
1064493436 10:15884152-15884174 ACCAGGAAGAGGAAGGTTAGTGG + Intergenic
1065292558 10:24245620-24245642 AAAAGGAAGGGGAAGGGGAAGGG - Intronic
1067409962 10:46055542-46055564 AGGAGGAAGGGGAAGGAGAAGGG - Intergenic
1070532840 10:77352375-77352397 ACCATAAAGGGGAAAGGGAACGG - Intronic
1071586647 10:86829403-86829425 ACCATTAAGGGAAAGGTGAAAGG - Intronic
1072618073 10:97062911-97062933 AACCCCAGGGGGAAGGTGAAAGG + Intronic
1072914852 10:99531430-99531452 ACCTGGAAGGGGCAGGTGAAAGG - Intergenic
1074046502 10:109844370-109844392 TCCACAAAGGGGAAGAGGAAGGG + Intergenic
1074139526 10:110659794-110659816 AAGAGGAAGGGGAAGGGGAACGG - Intronic
1074849986 10:117432102-117432124 ACCACGTGGGTGAAGGTGAAGGG - Intergenic
1074976724 10:118587236-118587258 TCAACAAAGGTGAAGGTGAAGGG - Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076509198 10:131000037-131000059 ACCAGGAAAGGCAAGGTGCAGGG + Intergenic
1077680454 11:4235691-4235713 ACCACGATGGGGCACATGAAAGG - Intergenic
1077684734 11:4281109-4281131 ACCACGATGGGGCACATGAAAGG - Intergenic
1077690458 11:4336821-4336843 ACCACGATGGGGCACATGAAAGG + Intergenic
1077902752 11:6502947-6502969 ACCAGGCAGGGGGAGGAGAAGGG - Intronic
1078639977 11:13085357-13085379 ACCAGGAAGAGGAAGGGAAAGGG - Intergenic
1079028458 11:16967480-16967502 GCCACACAGGGGAAGGTGAGGGG + Intronic
1080384955 11:31805638-31805660 ACCACGAACAGGAAGGTGGGTGG + Intronic
1081353573 11:42085911-42085933 CCCGCGAAGGGGAACATGAAGGG - Intergenic
1081612363 11:44570260-44570282 AGCACAGAGGAGAAGGTGAAGGG - Intronic
1081612374 11:44570310-44570332 AGCACAGAGGAGAAGGTGAAGGG - Intronic
1081713023 11:45230040-45230062 ACCATGGAGGTGAAGGGGAAGGG - Intronic
1083593171 11:63907012-63907034 GCCAGGAAGGGGACTGTGAAGGG - Intronic
1083696629 11:64447805-64447827 GCCAGGAAGGGGAGGGGGAAAGG - Intergenic
1084007954 11:66333190-66333212 ACCAAGGACAGGAAGGTGAAAGG + Intronic
1084945885 11:72638199-72638221 ACCAAGAAGGGTCAGGTGACTGG - Intronic
1089282000 11:117381238-117381260 CCCTAGAAGGGGAAGGAGAATGG + Intronic
1089322608 11:117636562-117636584 TCCACGAAGGAGAGGGGGAAGGG + Intronic
1090744218 11:129693709-129693731 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1091235542 11:134019918-134019940 CCGACCAAGGGGAAGGGGAATGG + Intergenic
1091289158 11:134427667-134427689 CCCACGAAAGGGAAGGTGCCTGG - Intergenic
1091509517 12:1107807-1107829 ACCACAAAGGAGCAGGGGAAAGG - Intronic
1091533305 12:1381122-1381144 ACCGTCAAGGGCAAGGTGAAGGG - Intronic
1093591526 12:20907467-20907489 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
1094237026 12:28179697-28179719 ACAATGAAGAAGAAGGTGAAAGG + Intronic
1095300407 12:40578073-40578095 AGGAGGAAGGGGAAGATGAAGGG - Intergenic
1095978364 12:47955247-47955269 AGCAGGAAGAGGAAGGTCAAAGG + Intergenic
1096194982 12:49643990-49644012 ATCAAGAAGGAGAAGGTGAGGGG + Exonic
1097007727 12:55931265-55931287 TCCAGGCAGGGGAAGCTGAAAGG + Exonic
1099012658 12:77310142-77310164 CCCACTGAGGGGAAGGTGGAGGG - Intergenic
1100779407 12:98008033-98008055 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1100890799 12:99123764-99123786 AGCAGGCAGGGGAACGTGAAAGG - Intronic
1102200335 12:111053613-111053635 CCCACGAAGAGCAATGTGAATGG - Intronic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102844012 12:116158254-116158276 GGAATGAAGGGGAAGGTGAAGGG + Intronic
1107918963 13:45183464-45183486 AGCAAGACGGGGAAGGTAAAGGG + Intronic
1108291081 13:48961707-48961729 GATAGGAAGGGGAAGGTGAAAGG + Intergenic
1110497348 13:76184288-76184310 ACCAAAGAGAGGAAGGTGAATGG + Intergenic
1111745675 13:92265922-92265944 TCCCCAAAGGTGAAGGTGAAAGG + Intronic
1112441478 13:99427277-99427299 AGGACGGAGGGGAGGGTGAAGGG + Intergenic
1112753903 13:102609302-102609324 ACAATCATGGGGAAGGTGAAGGG + Intronic
1113524576 13:110964708-110964730 ACTAGGAAAGGGAAGGTGCATGG - Intergenic
1113545419 13:111145421-111145443 ACCCCGAAGCGAAAGGTCAAGGG + Intronic
1114224585 14:20725956-20725978 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1114817431 14:25977068-25977090 AGCAAGATGGGGAAGGGGAAGGG + Intergenic
1114885663 14:26846795-26846817 TCCACCAAGGGGAAGGTTATGGG - Intergenic
1115873467 14:37833743-37833765 CACACAAAGGAGAAGGTGAAAGG - Intronic
1116070053 14:40032399-40032421 ACCAACAAGGGGAAGTTCAATGG - Intergenic
1117144330 14:52821925-52821947 AACACGAAGGTGAATGTGCAAGG - Intergenic
1117409514 14:55438563-55438585 GCCATGATGGGGAAGGGGAAGGG - Intronic
1117993036 14:61453635-61453657 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
1118533901 14:66737203-66737225 AACAGGAAGAGGAAGGGGAAGGG - Intronic
1119583780 14:75812619-75812641 ACAACAAAGGGGAATGAGAAGGG - Intronic
1121329964 14:93043759-93043781 ACCAATGAGGGGAAGGAGAACGG - Intronic
1121554402 14:94825361-94825383 AGCAAGATGGGGAAGATGAATGG + Intergenic
1123996035 15:25718654-25718676 ACAACTTAGGGGAAGGGGAACGG + Intronic
1124167756 15:27343161-27343183 AACACGAAGGGGAGGGAGGAAGG + Intronic
1125202631 15:37113565-37113587 ACCAGGAGGGGGAAAGTAAAGGG - Intergenic
1126249970 15:46555876-46555898 CCCAGGAAGGGAAAGGAGAAGGG + Intergenic
1127446393 15:59067355-59067377 AGGAAGAAGGGGAAGGGGAAGGG - Intronic
1128483808 15:68065255-68065277 ACCATGAGTGGGAAGGTGAAAGG - Intronic
1128806416 15:70534332-70534354 AAGAAGAAGAGGAAGGTGAAGGG + Intergenic
1129095288 15:73200475-73200497 AGCAGGAAAGGGAAGGGGAAAGG + Intronic
1130607352 15:85330012-85330034 ACAAGGAAAGGGAAAGTGAAAGG + Intergenic
1132267881 15:100492967-100492989 ACAAAGAAGGGGACGGGGAATGG - Intronic
1132280350 15:100608537-100608559 ACCACGGTGGGGGAGGTCAAAGG - Intronic
1134607371 16:15581733-15581755 GCCACTAAGGGGAAGGGAAAGGG - Intronic
1135624387 16:23982032-23982054 AAAGGGAAGGGGAAGGTGAAGGG - Intronic
1135667936 16:24351583-24351605 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
1135963429 16:27016463-27016485 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1141001148 16:80309496-80309518 ACTACGGAGGGGAAAGTGGATGG - Intergenic
1142779505 17:2170065-2170087 ACCAAGATGGGGAAGGGTAAAGG + Intronic
1143258829 17:5583679-5583701 CCCAGGAAGGGGCAGGTGAGTGG - Exonic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1145287466 17:21516957-21516979 ACCTAGAAGGGGAAGGGGAAGGG + Intergenic
1146901594 17:36592504-36592526 ACCACGCAGGGCAAGGTGGCTGG + Intronic
1147976891 17:44253042-44253064 AACAGAAAGGGGAAGGGGAAGGG + Intronic
1149707060 17:58704600-58704622 ACAACCAAGAGCAAGGTGAAGGG - Intronic
1150498188 17:65625375-65625397 ACCAAGAAGGGGAAGGTCTTGGG - Intronic
1151624454 17:75267908-75267930 GCCAGGGAGAGGAAGGTGAAGGG + Intronic
1152609258 17:81307538-81307560 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1154369821 18:13749866-13749888 ACTCAGAAGGGGGAGGTGAAAGG - Intronic
1155604948 18:27594343-27594365 GCCACGAAAGGGAAGGTGCAAGG - Intergenic
1155697217 18:28697807-28697829 GCCACTGAGGGGAAGGAGAAGGG + Intergenic
1155720480 18:29005173-29005195 ACCATAAAGGGGAAGTTGAAAGG - Intergenic
1156526491 18:37772784-37772806 ACCAAGAAGGGAGAGGAGAATGG + Intergenic
1156782749 18:40870750-40870772 AGCACAAGGGGAAAGGTGAAGGG - Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1158735282 18:60072752-60072774 ACCCCCAAGTGGAAAGTGAAAGG - Intergenic
1159557392 18:69959721-69959743 ACCATGAGGTGGAAGGTTAATGG + Intronic
1161457529 19:4377002-4377024 GCCACAAAAGGGAAGGTGATGGG - Intronic
1162873701 19:13604791-13604813 AGGAGGAAGGGGAAGGGGAAGGG + Intronic
1163235663 19:16029099-16029121 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
1164992650 19:32695645-32695667 ATCAAAAAGGGGAAGGAGAAGGG - Intronic
926461465 2:13135098-13135120 AACACGGTGGAGAAGGTGAAAGG - Intergenic
926530097 2:14033476-14033498 ACCAGGAAAGGGAAGGGGGAGGG + Intergenic
927709334 2:25315134-25315156 ACCAGGAACTGGAAGGGGAAGGG - Intronic
928186693 2:29116185-29116207 ACCTGGGAGGGGAAGTTGAAAGG + Intronic
928268302 2:29831171-29831193 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
930140914 2:47950587-47950609 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
930270557 2:49251535-49251557 AAGAGGAAGGGGAAGGGGAAAGG - Intergenic
931081541 2:58777572-58777594 ACCCCCGAGGGGAAGGAGAAGGG + Intergenic
931757341 2:65385656-65385678 ACCAAGAAGTGGAAGGAGAAGGG + Intronic
931765819 2:65455618-65455640 AGCAGGAAGGGGAAGGACAAAGG - Intergenic
935666073 2:105513916-105513938 AACAAGAAGGTGAAGGGGAAGGG + Intergenic
937688513 2:124725440-124725462 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
937936294 2:127248241-127248263 CCCACGAAGGGGAAGATCTAGGG - Intergenic
938226275 2:129619130-129619152 GCCCCAAAGGGGAAGCTGAAAGG + Intergenic
939209032 2:139147568-139147590 ACCACGTGGCGGAAGGTGGAAGG - Intergenic
939357647 2:141124934-141124956 ACCACAAAGGGAAAGGTGGAAGG - Intronic
939734854 2:145830706-145830728 AGCACGAAAGGGAAGGTTAATGG + Intergenic
941078481 2:161033106-161033128 AACGGGAAGGGGAAGGGGAAGGG + Intergenic
942105347 2:172628483-172628505 ACCATGAAGTAGAGGGTGAAAGG - Intergenic
942204741 2:173608838-173608860 ATCAAGAAGGGCAAGGTCAATGG + Intergenic
942739033 2:179152317-179152339 ACCACAGAGAGAAAGGTGAAAGG + Intronic
943093080 2:183396694-183396716 ACAATCAAAGGGAAGGTGAAAGG - Intergenic
944096494 2:195974078-195974100 AGAAAGAAGGGGAAGGGGAAGGG + Intronic
944401891 2:199336762-199336784 ACCACAGAGTGGAAGATGAAGGG - Intronic
946010496 2:216560149-216560171 AGAAGGAAGGGGAAGGGGAATGG - Intronic
946142918 2:217706654-217706676 AGGAGGAAGGGGAAGGGGAAGGG + Intronic
946242089 2:218362679-218362701 ACCAGGAAGGGGCAGGGGACAGG - Intronic
946456714 2:219832436-219832458 AGCAGGAAGGGAAAGGTGAAAGG - Intergenic
948948288 2:241232980-241233002 AGGAAGAAGGGGAAGGGGAAGGG + Intronic
1169058303 20:2641737-2641759 ACCAGGAGGGGGATGGAGAAGGG + Exonic
1170532640 20:17309853-17309875 AAGAAGAAGGGGAAGGGGAAGGG + Intronic
1170938818 20:20831874-20831896 ACCAAGAAGAGGCAGGAGAAGGG + Intergenic
1174415488 20:50363594-50363616 ACCAAGCAGGGGCAGGTGGAGGG + Intergenic
1175349944 20:58310210-58310232 TCCAGGGAGGGGAAGGGGAAGGG - Intronic
1176720418 21:10388133-10388155 AGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177477180 21:21638906-21638928 AGCATGAAGGGCAAAGTGAATGG - Intergenic
1180709837 22:17832153-17832175 ACTGAGAAGGGGAAGGGGAAGGG + Intronic
1180720351 22:17903261-17903283 ACCAGGAATGGGAGGGGGAATGG - Intronic
1180763665 22:18229005-18229027 ACAATGAAGGGGAAGGGAAATGG + Intergenic
1180771979 22:18395538-18395560 ACAATGAAGGGGAAGGGAAATGG - Intergenic
1180786547 22:18550830-18550852 ACCTCAAAGGTGAAGGTGATGGG + Intergenic
1180803357 22:18645151-18645173 ACAATGAAGGGGAAGGGAAATGG - Intergenic
1180807462 22:18724806-18724828 ACAACGAAGGGGAAGGGAAATGG + Intergenic
1181131826 22:20736553-20736575 ACCTCAAAGGTGAAGGTGATGGG + Intronic
1181218359 22:21350111-21350133 ACAATGAAGGGGAAGGGAAATGG + Intergenic
1181236669 22:21451124-21451146 ACCTCGAAGGGGAGGGGGGAGGG + Exonic
1181243467 22:21490383-21490405 ACCTCAAAGGTGAAGGTGATGGG + Intergenic
1181833554 22:25582907-25582929 ACCACAAAGGAGGAGATGAATGG + Intronic
1182417903 22:30233056-30233078 ACCACGGTGGGGAAAGGGAAAGG + Intergenic
1183820798 22:40344500-40344522 AGCAGGAATGGGAAGGTGACTGG + Intergenic
1184451896 22:44587457-44587479 ACCACGATGGGGAGGGTGGCCGG - Intergenic
1184754498 22:46508390-46508412 ACCACGCAGGGGACGGTCAGGGG - Intronic
1203233817 22_KI270731v1_random:136528-136550 ACAACGAAGGGGAAGGGAAATGG - Intergenic
950748484 3:15109487-15109509 AACACGAAGGGAAAGGGGATAGG - Intergenic
951214827 3:20014132-20014154 ACCATGAAGGAGAAGCTGATGGG - Intergenic
953340988 3:42134159-42134181 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
953385974 3:42505813-42505835 ACCACAAAAGGGAAGGTGAGAGG + Intronic
953940651 3:47092861-47092883 ACCAGGAAGGGGTAGGTACATGG - Intronic
958635975 3:96747086-96747108 AACACAAAGGGAAAGGGGAAGGG + Intergenic
960900655 3:122551111-122551133 ACCTGGAAGGGGCAGGTGAATGG - Intronic
961435294 3:126912613-126912635 ACCAGGCAGTGGAGGGTGAAAGG + Intronic
962223943 3:133588757-133588779 ACCAAGTGGGGGAAGGGGAAGGG + Exonic
963004162 3:140710480-140710502 ACAATGCAGGGGAAGGGGAAGGG - Intergenic
963048622 3:141123664-141123686 ACCAGGCAGGGGAAGCAGAAGGG - Intronic
963542285 3:146607936-146607958 ACTATGAAGGTGAAGTTGAATGG - Intergenic
964833304 3:160910184-160910206 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
965688830 3:171333791-171333813 AGCACGATGGGGAAAGGGAAAGG - Intronic
965813659 3:172615377-172615399 ACCACTATGGGGAGGGTGCAGGG - Intergenic
966742766 3:183249597-183249619 ACCCAGAACTGGAAGGTGAAGGG - Intronic
968150299 3:196332474-196332496 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
968630616 4:1649120-1649142 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
968686829 4:1965730-1965752 ACCATCACGGTGAAGGTGAAGGG + Intronic
968747254 4:2366522-2366544 AGCTCGGAGGGGCAGGTGAAGGG + Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969558030 4:7926721-7926743 AGAAAGAAGGGGAAGGGGAATGG - Intronic
970328913 4:14958674-14958696 AGCACTAAGGGTAAGGAGAAGGG + Intergenic
970645298 4:18113832-18113854 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
971305144 4:25473349-25473371 ACGGGGAAGGGGAAGGGGAAGGG + Intergenic
971305153 4:25473376-25473398 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
972364677 4:38363317-38363339 ACAAGGAATGGGAAGGTGAGGGG - Intergenic
972891965 4:43568264-43568286 AGCAGGAAGAGGAACGTGAAAGG - Intergenic
974187753 4:58463473-58463495 ATCAAAAAGGGGAAGGAGAAGGG + Intergenic
974693718 4:65337370-65337392 GCCAGGAAGAGGAAGGGGAAGGG - Intronic
975957710 4:79861577-79861599 TCCACCACGGGGAATGTGAAAGG + Intergenic
977257171 4:94754232-94754254 TCCATGAAGAGGAAGGAGAAGGG + Intergenic
978268533 4:106858872-106858894 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
978417218 4:108489146-108489168 AACAAGAAGGGGATGGTGAGAGG + Intergenic
981950710 4:150403561-150403583 AAAAAGAAGGGGAAGGAGAAGGG - Intronic
981996469 4:150980644-150980666 AAAAGGAAGGGGAAGGGGAAGGG + Intronic
982364366 4:154559179-154559201 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
982487579 4:155985662-155985684 ACCAGGAAGGAGAAGAGGAATGG + Intergenic
982701554 4:158663365-158663387 ATCAAAAAGGGGAAGGTGAGGGG + Intergenic
985610782 5:886955-886977 CCCACGTAGGAGAAGGTAAAGGG - Intronic
985674315 5:1222991-1223013 AACACCAAGGGGAAGGGGATGGG - Exonic
986211995 5:5682660-5682682 ACTAGGAAGGGGAAGGTGAAGGG + Intergenic
986622954 5:9694968-9694990 ACCATGAACTGGAAGGAGAAAGG - Intronic
986946672 5:13029309-13029331 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946684 5:13029342-13029364 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
988541170 5:32111533-32111555 AGTAGGAGGGGGAAGGTGAATGG - Intergenic
990421710 5:55642031-55642053 ACAAGGAAGGGAAAGGGGAAGGG - Intronic
990881944 5:60548276-60548298 ATCATGAAGGGCAGGGTGAAAGG - Intergenic
992349680 5:75916292-75916314 ACGAGAAAGGGGAAGGGGAAGGG - Intergenic
992349709 5:75916383-75916405 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
992455606 5:76912749-76912771 ATCAAAAAGGGGAAGGAGAAGGG + Intronic
992754870 5:79894845-79894867 ACCTCGAAGGGGCAGGGGCATGG + Intergenic
993047807 5:82888406-82888428 ACCAGGAAGGTGGTGGTGAAGGG - Intergenic
994676911 5:102834755-102834777 ACCAGGAAGGGAAGGGTGGAGGG + Intronic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
999495760 5:152095365-152095387 ACCACAAAGCGGGAGGAGAAGGG - Intergenic
1000056228 5:157608914-157608936 TCCCCGAAGGAGAAGGGGAAGGG - Intergenic
1000101602 5:158022227-158022249 AGAAGGAAGGGGAAGGTGAAGGG - Intergenic
1000207739 5:159078313-159078335 ACCAGGAAGGAAAAGCTGAAAGG + Intronic
1001290529 5:170455296-170455318 AAGAAGAAGGGGAAGGGGAAGGG - Intronic
1002173675 5:177389365-177389387 AGCAGCAAGGGGAAGGGGAAGGG - Intronic
1002771532 6:293972-293994 ACCACCAATGGGAAGGCAAACGG - Intronic
1004079009 6:12372499-12372521 AGCACCAAGGAGAAGGTCAATGG - Intergenic
1004790512 6:19021482-19021504 ACCAAGAAGGAGAGGGTGAAGGG - Intergenic
1006567722 6:34974112-34974134 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
1006787740 6:36679524-36679546 ACCGCGAAGGGGCAGGGGAGAGG - Intronic
1007939445 6:45765440-45765462 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1008052686 6:46915944-46915966 ACCAGGAAAGGGAAAGGGAAAGG - Intronic
1010133283 6:72521261-72521283 AGCACGCAGGGGAAGGGGACTGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011990095 6:93504168-93504190 ATCATGAAGGGCAAGGTGACTGG - Intergenic
1013539032 6:111088713-111088735 ACTAGGATGAGGAAGGTGAAGGG + Intronic
1013886994 6:114979867-114979889 ACAACAAAGGTGAAGGGGAAAGG + Intergenic
1015966753 6:138701989-138702011 ACCATGAAGGGGAGGGAGAAAGG - Intergenic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1018397037 6:163386142-163386164 ACCAAAACGGGGGAGGTGAATGG - Intergenic
1018798844 6:167207468-167207490 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1019313629 7:374752-374774 ACACGGAATGGGAAGGTGAATGG + Intergenic
1020401703 7:7785817-7785839 ACCTAGGAGGAGAAGGTGAAAGG + Intronic
1020648710 7:10848144-10848166 GGCAAGAAAGGGAAGGTGAAAGG + Intergenic
1023042813 7:36187032-36187054 ACCAAGAAGGACAAGGTGAATGG - Intronic
1023332452 7:39132758-39132780 GCGAGGAAGGGGAAGGGGAAAGG + Intronic
1023552327 7:41383488-41383510 AGCACGAAGGAGAAGTTTAAAGG - Intergenic
1023974144 7:45015444-45015466 TCCAGGAAGGGGAAGGGGAAGGG - Intronic
1024232449 7:47373022-47373044 ACCACGGAGGTGTAGGTGCAGGG - Intronic
1025809553 7:64866788-64866810 AGCATGCAGGGGAAGGAGAAGGG + Intergenic
1026040639 7:66865597-66865619 AAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1028355938 7:89908240-89908262 ACCAGGAAGTGGAAGGAGACTGG + Intergenic
1028676262 7:93465775-93465797 AGCATGCAGGGGAAGGTAAAAGG - Intronic
1029440529 7:100584541-100584563 ACAACCAAGGGGGAGGGGAAGGG + Intronic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1033215096 7:139487657-139487679 AAGACAAAGGGGAAGGGGAAGGG + Intergenic
1033936628 7:146593363-146593385 CCCACTAAGGGGATGGAGAAGGG + Intronic
1036180018 8:6576499-6576521 ACGGGGAAGGGGAAGGGGAAGGG - Intronic
1037953886 8:23038100-23038122 AACACAAAGGGGAAATTGAAGGG + Intronic
1038042640 8:23737997-23738019 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1038111629 8:24506164-24506186 ACCACCAAGAGGAAGGGGAGGGG - Intronic
1038812702 8:30866366-30866388 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
1039131808 8:34273390-34273412 ACCAAGAAGGGGAGGGGGGAGGG - Intergenic
1040852400 8:51914577-51914599 AACAGGAAGGGGAAGGGGAAGGG - Intergenic
1041284837 8:56249557-56249579 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
1042781956 8:72501056-72501078 AGCTTAAAGGGGAAGGTGAAGGG - Intergenic
1044005610 8:86933025-86933047 ACCACAAAGAGGACGGAGAAAGG + Intronic
1044650753 8:94491839-94491861 ACCACCAAGAGGAAGGGGCAGGG - Exonic
1044666874 8:94640942-94640964 ACCACGTGGGGGAGGGGGAAGGG + Intergenic
1044982017 8:97726454-97726476 ACCACAAAGGAGAAGTTGATAGG + Exonic
1046915022 8:119670856-119670878 ACAATGAAGAGGAAGGTAAAAGG + Intronic
1047351868 8:124081765-124081787 ACAATGGAGGGGAAGGGGAATGG + Intronic
1048588910 8:135802923-135802945 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1049856483 8:144865144-144865166 ACCAGGAAGGAGTGGGTGAATGG + Intergenic
1053072459 9:35109326-35109348 AACAAGAAGGGGAAGGGGAAGGG + Exonic
1056181222 9:84084518-84084540 ACCAAAAAGGGGCAGGTAAATGG - Intergenic
1057138625 9:92713386-92713408 GCCACGAGAGGGAAGGGGAAGGG + Exonic
1057516612 9:95727280-95727302 ACCAGGAAGAGGAAAGAGAAGGG - Intergenic
1057643413 9:96850488-96850510 ACCAAGAAGGGGAGGGTGGGAGG + Intronic
1058485456 9:105439496-105439518 ACCAGGAAAGGGAAGGGGCAGGG + Intergenic
1059752451 9:117260630-117260652 ACCAAGATGGGAAAGCTGAAAGG + Intronic
1060323241 9:122585709-122585731 AGCACCACGGGGAAGGTAAATGG + Intergenic
1060983084 9:127804538-127804560 GGGACGAAGGGGAAGGTGAGGGG + Exonic
1061380020 9:130250107-130250129 AGAAAGAAGGGGAAGGGGAAGGG - Intergenic
1185540493 X:899405-899427 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
1187249208 X:17581738-17581760 ACCACGAAGGGGAAGGTGAAAGG - Intronic
1187308339 X:18117086-18117108 ACAATGAAGGGGAAGTTGATGGG + Intergenic
1187526978 X:20063291-20063313 GCCACCAAGGAGAAGGTGCACGG + Intronic
1187940063 X:24372663-24372685 AGTAAGAAGGGGAAGGGGAACGG + Intergenic
1188340788 X:28998732-28998754 GCAACTAAGGGGAAGGTTAATGG + Intronic
1190493616 X:51006491-51006513 AGCACTGAGGGGTAGGTGAAGGG + Intergenic
1191960624 X:66697481-66697503 ACCACGAAGTGGAAAATGAGGGG - Intergenic
1192249182 X:69397034-69397056 TCCACGAAGGGGGAGGGGGAGGG - Intergenic
1192264953 X:69531597-69531619 ACCAAGAAGCGGATGGGGAAGGG + Exonic
1192873875 X:75209047-75209069 ACCAGGAAGGAGTAGGTAAAGGG + Intergenic
1195328875 X:103780306-103780328 CCCACGAATGGGAAGATGAAAGG - Intronic
1196727057 X:118905257-118905279 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1199031276 X:143003406-143003428 ACAAAGGAGGGCAAGGTGAAAGG + Intergenic
1199487880 X:148368110-148368132 ACCAAGAAGGGGAAAAGGAATGG + Intergenic
1201356793 Y:13105094-13105116 ACCACAAAGGGGGAGGTCATGGG - Intergenic
1201568233 Y:15388457-15388479 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic