ID: 1187250132

View in Genome Browser
Species Human (GRCh38)
Location X:17590261-17590283
Sequence ATCTAAAAGCTTATGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187250129_1187250132 -1 Left 1187250129 X:17590239-17590261 CCCTTTGATCTGGTAATTCAAAA 0: 1
1: 0
2: 2
3: 84
4: 337
Right 1187250132 X:17590261-17590283 ATCTAAAAGCTTATGCTAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1187250130_1187250132 -2 Left 1187250130 X:17590240-17590262 CCTTTGATCTGGTAATTCAAAAT 0: 1
1: 0
2: 2
3: 35
4: 279
Right 1187250132 X:17590261-17590283 ATCTAAAAGCTTATGCTAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187250132 Original CRISPR ATCTAAAAGCTTATGCTAGG TGG Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
904092952 1:27957789-27957811 ATCAAAAAGCTTATGAGTGGTGG - Intronic
908224485 1:62042203-62042225 CTCTAACAGCATATGCTATGCGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909519797 1:76554352-76554374 ACCTAAAAACTTCTGCTATGGGG + Intronic
913031203 1:114904411-114904433 ATAGAAAAGCTAATTCTAGGCGG - Intronic
919183538 1:194116385-194116407 CTCTCAAAGCTTATGCTATATGG + Intergenic
919365327 1:196652913-196652935 ATTAAAAAGCTTATTCTTGGAGG + Intronic
1064834321 10:19508639-19508661 ATATAAAATATTATACTAGGAGG + Intronic
1066724973 10:38381959-38381981 TTCTAAATGCTTATGATAAGAGG - Intergenic
1073987121 10:109222453-109222475 ATCGAAAAGATCATGCTATGAGG - Intergenic
1080586865 11:33690587-33690609 ATCACAAAACTTCTGCTAGGTGG + Intergenic
1082892921 11:58159421-58159443 TTCTGTAAGCTGATGCTAGGTGG - Intronic
1082966276 11:58968928-58968950 ATCTAAAAGCTTACCCTACTTGG + Intronic
1088556745 11:111069510-111069532 ATATAAATGCTTATTCTACGTGG - Intergenic
1093532365 12:20182360-20182382 GTCAAAAAGCTTAGGCTAGATGG - Intergenic
1098996354 12:77125337-77125359 ATCTGCAAGCTTATTGTAGGAGG + Intergenic
1101363835 12:104053219-104053241 ATCTATAACATTCTGCTAGGTGG - Intronic
1103971157 12:124673603-124673625 GTGAACAAGCTTATGCTAGGAGG - Intergenic
1110668183 13:78142820-78142842 ATGTAAAAGCTAATTCTATGAGG + Intergenic
1111884188 13:93998442-93998464 ACCTTAAAGCTTTTGCTAGAAGG - Intronic
1111890348 13:94073732-94073754 ATTTAAAGGCTTATCCTAGAGGG - Intronic
1112603762 13:100882927-100882949 ATCTAAAAACTGATGCAATGTGG + Intergenic
1112973590 13:105289918-105289940 ATTTAAAGGCTTATTCAAGGTGG + Intergenic
1115013581 14:28581246-28581268 ATGTAAAAGCTTGTGCTATTTGG - Intergenic
1124213894 15:27790502-27790524 ATCCAAAACATTATGGTAGGTGG + Intronic
1126013218 15:44323417-44323439 ATCTAAAACCTTAAGCTTGGAGG - Intronic
1129921861 15:79326230-79326252 ATCCAAAAGGATATGCTATGTGG + Intronic
1139732374 16:68957693-68957715 ATCTAAAGTCTTATGCTTGCTGG - Intronic
1144325486 17:14175685-14175707 CTCTAAAAGATCATTCTAGGTGG + Intronic
1144474362 17:15572573-15572595 CTCTAAAAGATCATTCTAGGTGG + Exonic
1148316940 17:46709424-46709446 ATCTTAAAGCTTCTGCTGTGAGG + Intronic
1149272623 17:54997227-54997249 AGCTAAGATCTTATTCTAGGAGG + Intronic
1149678920 17:58490584-58490606 ACCAAACAGCATATGCTAGGAGG + Exonic
1155030498 18:21979585-21979607 ATTTAAAATCTTCTGCTAAGAGG + Intergenic
1157068487 18:44378890-44378912 ATCAAAAAGCTTATCCAAGTCGG + Intergenic
1158346354 18:56520648-56520670 ATCTTAAGCCCTATGCTAGGTGG + Intergenic
931999046 2:67866914-67866936 ATTTAAAAGCATCTGCAAGGGGG - Intergenic
935512973 2:103999303-103999325 ATCTAAAACATTATGCTATAGGG - Intergenic
937006339 2:118520161-118520183 ATCTAAAAGCCTAAGAAAGGTGG + Intergenic
941953992 2:171185725-171185747 ATGTAAAAGCGTATGCTAGAAGG - Intronic
1173282562 20:41642630-41642652 AGGTAAAAGCATTTGCTAGGTGG - Intergenic
1178250719 21:31000869-31000891 ATCTTAAAGGGAATGCTAGGAGG - Intergenic
953771931 3:45784137-45784159 ATCTAAAACCTGATGCCAAGTGG + Intronic
954772782 3:52987811-52987833 TTCTAAAATCTTATTCTAGTAGG + Intronic
957015255 3:75055826-75055848 ATCATAAAGCTTATGCCATGTGG + Intergenic
958981664 3:100727380-100727402 TTCTAAAAGCTTATAATTGGTGG + Intronic
964733308 3:159890854-159890876 ATCTAAAAGCATTTCCAAGGGGG + Intronic
975495533 4:75031877-75031899 TTTTAAAAGCTTATGAAAGGAGG - Intronic
976912799 4:90328082-90328104 ATCTAAAAACTTAAGATAGAGGG + Intronic
977187357 4:93956175-93956197 ATCTAAATGCTTATAGTTGGGGG - Intergenic
979538985 4:121857742-121857764 ATTTAAAAGCATAGGCTATGGGG + Intronic
983170674 4:164532481-164532503 AGAAAAAAGCTTATGCTAGTGGG + Intergenic
984041247 4:174736596-174736618 TTGTAAAAACTTATGCTAAGTGG - Intronic
987268670 5:16282104-16282126 ATCTCATAGTTTATGCTAAGTGG - Intergenic
987868730 5:23582645-23582667 ATCTAAAAGAGGATGCTAGTAGG + Intergenic
989167260 5:38444190-38444212 ATCTAAAAGCTTGTGCCATATGG - Intronic
989408929 5:41094961-41094983 ATTGAAAAGCTTTAGCTAGGCGG + Intergenic
992882921 5:81128589-81128611 TGCTAAAAGCATATGCAAGGTGG + Intronic
994573437 5:101543488-101543510 ATCTAAAGGCATAAGCTAGAGGG - Intergenic
995212716 5:109558717-109558739 CTCTAAAAGCTTATGAGAGAAGG - Intergenic
1000587183 5:163114804-163114826 ATCTGAGATCTTATACTAGGAGG - Intergenic
1001776878 5:174335571-174335593 CTCTAAAAGCTTAAGACAGGAGG - Intergenic
1009807280 6:68617064-68617086 ATCTAAATGTTTATAATAGGAGG - Intergenic
1011049847 6:83133444-83133466 TTCTAAATGCTTGTGATAGGTGG - Intronic
1011185089 6:84665829-84665851 ATCTAAAACCTTATGCTATCAGG + Intergenic
1016695031 6:146984234-146984256 AGCAGAAACCTTATGCTAGGAGG + Intergenic
1017539895 6:155390408-155390430 ATTGAAAACATTATGCTAGGTGG + Intergenic
1021982272 7:26066299-26066321 ATCTAAAAACTGGTGCTAGGTGG + Intergenic
1023112677 7:36829938-36829960 AGTTAAAAGGTTATGCTTGGAGG + Intergenic
1027762875 7:82302048-82302070 ATATAAAAGCGTAGGCCAGGCGG - Intronic
1033568190 7:142600155-142600177 CTCTCAAAGCGAATGCTAGGTGG - Intergenic
1052801101 9:32969209-32969231 AGCTAAAAGCTTCTGCTTGCAGG + Intergenic
1053340720 9:37326139-37326161 AGCAAAAAGCTTATGATAGAAGG + Intronic
1053459360 9:38256742-38256764 ATTTAAAAGCCTAGGCCAGGAGG - Intergenic
1056146839 9:83739241-83739263 CTCAAATAGCTTATGCTTGGGGG - Intergenic
1057435433 9:95035924-95035946 ATCTGAAAGCATGTGGTAGGAGG - Intronic
1187250132 X:17590261-17590283 ATCTAAAAGCTTATGCTAGGTGG + Intronic
1192408658 X:70912325-70912347 AACTTATAGCTTATGTTAGGAGG - Intergenic
1200050085 X:153424558-153424580 ATGTAAAAGCTTAAACTATGGGG + Intergenic