ID: 1187250444

View in Genome Browser
Species Human (GRCh38)
Location X:17593417-17593439
Sequence CCTTTGGTCTTCAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187250437_1187250444 12 Left 1187250437 X:17593382-17593404 CCCACTGGGAAGGAACATATTTT 0: 1
1: 0
2: 0
3: 26
4: 236
Right 1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG 0: 1
1: 0
2: 3
3: 14
4: 215
1187250436_1187250444 20 Left 1187250436 X:17593374-17593396 CCAGTGGGCCCACTGGGAAGGAA 0: 1
1: 0
2: 3
3: 21
4: 183
Right 1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG 0: 1
1: 0
2: 3
3: 14
4: 215
1187250438_1187250444 11 Left 1187250438 X:17593383-17593405 CCACTGGGAAGGAACATATTTTG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG 0: 1
1: 0
2: 3
3: 14
4: 215
1187250432_1187250444 30 Left 1187250432 X:17593364-17593386 CCAGTGGATTCCAGTGGGCCCAC 0: 1
1: 0
2: 2
3: 14
4: 159
Right 1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG 0: 1
1: 0
2: 3
3: 14
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187250444 Original CRISPR CCTTTGGTCTTCAGGAAAAC AGG Intronic
900663000 1:3795357-3795379 CCTTTGGCTTTCTGTAAAACAGG + Intronic
901346852 1:8552363-8552385 CCTTTGATCTTCAAGAAGAATGG + Intronic
901603709 1:10442848-10442870 CCTTTGGTCACCAGGTAAAAGGG + Intronic
901844803 1:11975082-11975104 CCTTGGTTTTTCAGGAAGACAGG - Exonic
901857916 1:12056001-12056023 CCTTTGGCCATCAGGACGACGGG + Intergenic
905277638 1:36829085-36829107 CCCTTGGGCTTCAGGAAGGCTGG + Intronic
905844136 1:41212637-41212659 GGTTTGTTTTTCAGGAAAACTGG - Intronic
908477356 1:64503128-64503150 TCTTTCATCTTCTGGAAAACTGG - Intronic
908540690 1:65119497-65119519 CATTTGACCTTCAAGAAAACTGG + Intergenic
908667530 1:66509834-66509856 CCTTTGGGCTTCAGGACAGCTGG - Intergenic
908678963 1:66637616-66637638 CCTTTGGTTTTCATGCAAACTGG + Intronic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
915713293 1:157921623-157921645 GCTTTGATCTCTAGGAAAACTGG + Intergenic
915935922 1:160090203-160090225 CATTTGGGTTTCAGTAAAACAGG + Exonic
916948427 1:169754939-169754961 GCTTGGGTCTTCAGCAAAATTGG + Intronic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
918811060 1:189121289-189121311 GCTTTGGGCATCAGGAAACCTGG + Intergenic
919662984 1:200265722-200265744 CCTTTGGTAGTCAAGAGAACTGG + Intergenic
920418434 1:205813564-205813586 CCTCTGGCCTTCGGGAAGACCGG + Intronic
920577943 1:207076166-207076188 CATTTGGTCTTCAGAGACACTGG + Exonic
921099063 1:211912558-211912580 CATCTGGTCTGCAGGAGAACAGG + Intergenic
921251563 1:213303168-213303190 CCTTAGGTCTTCAGCAAGCCAGG + Intergenic
923272288 1:232367631-232367653 CCTTTGCTGTTTAGGAGAACAGG + Intergenic
923731042 1:236550294-236550316 CCTTTGTTCTTTTGGGAAACGGG - Exonic
1063017707 10:2095073-2095095 TCTTTAGTCCTCAGGATAACAGG - Intergenic
1063040477 10:2332558-2332580 ACATTGATCTTCAGGAAAACAGG - Intergenic
1064674806 10:17750104-17750126 CCTTTGGTCATCTGGAAAGGAGG - Intergenic
1064738672 10:18409970-18409992 CCTTTGGTCTTCTGGAAGTGAGG + Intronic
1067169268 10:43892817-43892839 CATTTAGTCTTCAGAAACACAGG - Intergenic
1068645374 10:59460708-59460730 CCTTTGGTACTCAAGAAAAATGG + Intergenic
1068927329 10:62553950-62553972 CCTTTGGATTTCAGGAACAATGG - Intronic
1069762539 10:70822323-70822345 CCTTTGGTTTAAAGGAAAAGAGG + Intronic
1070148307 10:73790279-73790301 CCTGTGGTCTTCAGGTAAATCGG + Exonic
1076267696 10:129121667-129121689 TCTTTGGTCTTTAGGTAAAATGG - Intergenic
1076531916 10:131150538-131150560 CCCTGGGTGTTCAGGAAAGCTGG - Intronic
1081184835 11:40029388-40029410 TCTTAGATCTTGAGGAAAACTGG - Intergenic
1081358416 11:42142791-42142813 CCCTTAGTCTTCATCAAAACTGG - Intergenic
1084401504 11:68946511-68946533 CCTTTGGCCCACAGGAAAAAAGG - Intergenic
1084710604 11:70841591-70841613 CCTTGGTTCTTCAGGAATTCTGG + Intronic
1086844485 11:91731263-91731285 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1087814263 11:102641225-102641247 CCTTTAGGCTTCAGGAACACTGG - Intergenic
1087832257 11:102832004-102832026 CCTTTCATTTTTAGGAAAACAGG - Intergenic
1088449837 11:109969160-109969182 GCTTTTGGCTTCAGGTAAACCGG - Intergenic
1089095455 11:115916533-115916555 CCTTTAGTCCTCAGGAGAGCAGG + Intergenic
1091409621 12:230492-230514 CCTTTTCTCATCAGGAAAATGGG + Intronic
1092032080 12:5294574-5294596 CATCTGGGCTTCAGGAAATCGGG + Intergenic
1093421064 12:18975648-18975670 ACTTTTGTCTTTTGGAAAACGGG + Intergenic
1096016749 12:48283221-48283243 CATTTGGTCATCAGGAGAAGGGG - Intergenic
1096967269 12:55638310-55638332 CCCTTGGCCTTCAGGAAGAGGGG + Intergenic
1096980942 12:55728103-55728125 CCTCAGGTGTCCAGGAAAACTGG + Intronic
1098855549 12:75649036-75649058 TCATTGTTCTTCTGGAAAACTGG - Intergenic
1102333674 12:112058453-112058475 ACTTTTATCCTCAGGAAAACAGG + Intronic
1104214168 12:126719937-126719959 CCTTTGTTGGTCAGGAAATCTGG - Intergenic
1104694077 12:130850172-130850194 CCTTTGGAATTCAGGAAAAGCGG + Intergenic
1106240796 13:27911563-27911585 CCTTTGGACTGCAGGGAATCAGG - Intergenic
1109272313 13:60268282-60268304 TCTTAGATCTTAAGGAAAACCGG + Intergenic
1110881522 13:80577981-80578003 CCTTTGGTTTGCATGGAAACTGG + Intergenic
1111736470 13:92146525-92146547 CCTTAGGTTTTGGGGAAAACAGG + Intronic
1111871313 13:93836009-93836031 CTTTTAGTCTTTAGTAAAACCGG + Intronic
1112725613 13:102300877-102300899 CTTTGGGGCGTCAGGAAAACAGG - Intronic
1113681134 13:112245954-112245976 CCTGTGGTCATCAGAAACACGGG - Intergenic
1113967566 13:114162958-114162980 TCTTTCGCCTTCAGAAAAACTGG - Intergenic
1115833815 14:37374668-37374690 CATTTGGTCTTTGAGAAAACTGG - Intronic
1117965228 14:61200331-61200353 CCACTGGGTTTCAGGAAAACAGG + Intronic
1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG + Intronic
1123699088 15:22901513-22901535 TCTATGGTCTTCTGGAAAAGAGG + Intronic
1124955171 15:34355667-34355689 GGTTTCTTCTTCAGGAAAACGGG + Exonic
1125519199 15:40338895-40338917 TCTTTGTTCTGCAGGAAAAGCGG - Exonic
1127833905 15:62774537-62774559 CCTTTGGTGTTCAGAAGAAAAGG + Intronic
1129520615 15:76183766-76183788 TCTTGTTTCTTCAGGAAAACAGG - Intronic
1130039962 15:80398069-80398091 CAGTTCGACTTCAGGAAAACTGG - Intronic
1130666882 15:85877283-85877305 ACTTTTGTCTTCAGAAAAATAGG + Intergenic
1130880129 15:88047799-88047821 CCTTTGGTCTGGATGAAAAATGG + Intronic
1131221447 15:90587944-90587966 CCCTTGTTCTTCAAGAAAATGGG + Intronic
1131529459 15:93179472-93179494 CCTTTCGTCCTCTGGAAAAAGGG - Intergenic
1133644365 16:7749739-7749761 GCTTCGGTCTTTAGGAAGACAGG - Intergenic
1133682686 16:8135014-8135036 CCTTTCTTCTTCAGTAAAATTGG + Intergenic
1133878624 16:9759862-9759884 CCTTTGTGCTTCTGGAAAATGGG - Exonic
1133880469 16:9776975-9776997 CCTTTCATCTACAGGACAACTGG - Intronic
1134811387 16:17169847-17169869 GATTTGGTCTTCAGGGAACCAGG + Intronic
1135111398 16:19693176-19693198 AGTTTCTTCTTCAGGAAAACTGG + Intronic
1138826494 16:60326776-60326798 CCTTTTGTCTACAGAAAAAATGG - Intergenic
1140299196 16:73739706-73739728 TGTTTGGCCTTCAGGATAACTGG - Intergenic
1141063347 16:80895161-80895183 TCTTTGGTCTGCAGGATGACAGG - Intergenic
1141473291 16:84253909-84253931 CCTGAGGTCTCCAGGAAGACAGG + Intergenic
1141580527 16:84995261-84995283 CTTTTGGTGTTCTGGGAAACAGG - Intronic
1141939757 16:87267147-87267169 CCCTTGGCCTCCAGGAAATCTGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145985064 17:29040336-29040358 CCTTTTGTTCTTAGGAAAACAGG - Intronic
1146523034 17:33541327-33541349 TCTTTGGACTTCTGCAAAACGGG + Intronic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1153174137 18:2351571-2351593 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1155589751 18:27412929-27412951 CATTTACTTTTCAGGAAAACTGG + Intergenic
1156201544 18:34838149-34838171 CCTTTGCCCTTCAGAAAAGCTGG - Intronic
1156898556 18:42274172-42274194 CCTTTGGTCTTAAAGAAGGCTGG - Intergenic
1156956284 18:42968476-42968498 CCTTTGATCTTGGGGAAAATGGG - Intronic
1158437316 18:57442606-57442628 CCTTTGGTCTGGCGGACAACTGG + Intronic
1158575963 18:58638083-58638105 CTTTTTGTCCTCAGGAAGACAGG - Intergenic
1158596562 18:58821781-58821803 ACTTTGCTCTTCATGAAAATGGG + Intergenic
1159527522 18:69612262-69612284 CCTTAGGTTTTCAAGAAAACTGG + Intronic
1160217776 18:76948304-76948326 CCCTTGTTCTACAGAAAAACCGG - Intronic
1165281410 19:34801346-34801368 TCTTTGTTGTTCAGTAAAACTGG + Intergenic
1165405495 19:35628621-35628643 CCTGTGGTTTCCAGGAAGACCGG - Intergenic
1166879478 19:45918999-45919021 CCTTTGCTCATCTGTAAAACAGG - Intergenic
1168340103 19:55617851-55617873 CCTTTGTTCTTCAGGACCCCAGG - Exonic
1168662480 19:58178555-58178577 CCTTTGATGTTGGGGAAAACAGG + Intergenic
927721529 2:25386199-25386221 ACTTTGGTCTGTATGAAAACAGG + Intronic
935980570 2:108622161-108622183 CCTTCTGTCATCAGTAAAACAGG - Intronic
939409770 2:141809444-141809466 CCTGTGCTCTTCAGGCAACCAGG - Intronic
939997164 2:148930719-148930741 CACTTTGTCTTCAGCAAAACAGG - Intronic
940811376 2:158246563-158246585 CCTAAGGACTTGAGGAAAACTGG + Intronic
944415595 2:199476576-199476598 CCTCTGGTGTACAGGAAGACAGG - Intergenic
944496531 2:200312636-200312658 GTTTTGCTCTTCAGTAAAACTGG - Intronic
945402428 2:209401488-209401510 CCATTGGCCTTGGGGAAAACTGG + Intergenic
947934626 2:233993314-233993336 CATTTGTTCCTCAGGACAACTGG - Intronic
1169461943 20:5803091-5803113 CCCCTGGTCTTCAGGAATGCTGG - Intronic
1169939226 20:10919118-10919140 CCCTTGATCTTCAGAAACACAGG - Intergenic
1170949503 20:20924170-20924192 GATTTGCTCTTCAGTAAAACAGG + Intergenic
1171345060 20:24459729-24459751 CCTTTCTTCTTCAGCAAAAAAGG + Intergenic
1172646473 20:36473265-36473287 CCTTTGGCTTTCAGGACATCTGG - Intronic
1173051784 20:39569859-39569881 CCTCTTGTCCTCAGGAAAACAGG - Intergenic
1173562135 20:44013465-44013487 CCTCTGGTCTTCTGAAACACAGG + Intronic
1178268485 21:31167414-31167436 TGTTTGCTCTTCAGGAAACCTGG - Intronic
1180175789 21:46087553-46087575 TCTTTGCTTTTAAGGAAAACTGG - Intergenic
1182258895 22:29058589-29058611 CCCTTGGTCTTCAGTGAATCTGG + Intergenic
1184931704 22:47686178-47686200 CCTTTTCTCTTCTGCAAAACAGG + Intergenic
949734153 3:7151685-7151707 CCTTTGCCCTTTAGGAAAAAAGG + Intronic
951598026 3:24339383-24339405 CCTTTCTTCATCTGGAAAACGGG - Intronic
951831680 3:26936402-26936424 ACTTCGGTCTTCAGGAATAAAGG + Intergenic
954130448 3:48558001-48558023 CATTTTCTCTTCAGGAAAATGGG + Intronic
954940142 3:54364267-54364289 TATTTGGTCTTAATGAAAACAGG - Intronic
958684970 3:97380480-97380502 CCTTTGGGCTTCAGGAACACAGG + Intronic
959609239 3:108275849-108275871 TCTTAGATCTTGAGGAAAACCGG + Intergenic
961193259 3:124980294-124980316 ACTCTGGTCTTTAGGAAAAAAGG - Intronic
961830246 3:129619542-129619564 TCTTTGGCCTTCTGGAAAACGGG - Intergenic
962329888 3:134468550-134468572 ACTTTGGTCTTCAGGAAAAGGGG - Intergenic
962346033 3:134619602-134619624 CCTTCGGGCTGCAGGAAAACGGG - Intronic
962835087 3:139182855-139182877 CCTCTGTTCTTCAGGAGAGCAGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
965694686 3:171395305-171395327 CCTTTTGTCATCAGTAAAACAGG + Intronic
967622398 3:191649833-191649855 TCTTAGATCTTGAGGAAAACTGG - Intergenic
968427133 4:531639-531661 CCTTTGGGCTTCAGGATCAGGGG - Intronic
970243800 4:14037324-14037346 CCATCGTTCTTCAGGAAAGCTGG + Intergenic
971173721 4:24261071-24261093 TCTGTGATCTTCATGAAAACAGG - Intergenic
972272181 4:37522396-37522418 CCTTGGGTCTTAAGGAAACATGG - Intronic
974969388 4:68805388-68805410 TTTTAGGTCTTAAGGAAAACCGG - Intergenic
978912858 4:114085004-114085026 CCCTTAATCTTCATGAAAACAGG + Intergenic
980392354 4:132163069-132163091 TCTTAGATCTTGAGGAAAACTGG - Intergenic
986929785 5:12804284-12804306 CCTTTGTTCATCAGCACAACAGG - Intergenic
988193966 5:27976916-27976938 CCTGTGTTCTTCAGGAATATTGG + Intergenic
988326374 5:29773886-29773908 ACTTTGATCTCCAGGAAAATAGG - Intergenic
988986769 5:36627758-36627780 CCTTTGCTCTACAGGAGAAGAGG + Intronic
989538830 5:42595414-42595436 CCTTTGGCCACCAGGAAGACAGG + Intronic
990335320 5:54766904-54766926 CACTTAGTCTTCAGGAATACAGG + Intergenic
992885160 5:81151359-81151381 TTTTTGGTCCACAGGAAAACTGG + Intronic
995679238 5:114698631-114698653 TATTTTGTCTTCAGGAAATCTGG - Intergenic
996148483 5:120005514-120005536 CCTCCTGTTTTCAGGAAAACAGG - Intergenic
998558637 5:143150160-143150182 CCTTTGTTCTTCAGGAGAGATGG - Intronic
999888038 5:155945700-155945722 CTTCTGGGCTTCAGGAACACTGG - Intronic
1000235528 5:159356193-159356215 CCTTTGGGCATGAGGAAGACTGG - Intergenic
1001215864 5:169855119-169855141 CATTTGCTCTTCTGGAAAATGGG + Intronic
1001969012 5:175938758-175938780 CCCTCTGTCTTCAGGGAAACAGG - Intronic
1002883313 6:1271967-1271989 CCTAAGGTCTTCAGGTAAAGTGG + Intergenic
1002946491 6:1766313-1766335 CATTTGGGCTTCAGGAAACGCGG + Intronic
1004963404 6:20819501-20819523 CATTTGATCATCAGAAAAACAGG - Intronic
1006234506 6:32616846-32616868 TCTTAGATCTTGAGGAAAACTGG - Intergenic
1006947006 6:37791367-37791389 CCCTGGGTCTACAGGAGAACAGG - Intergenic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1009763711 6:68040493-68040515 TCTTAGATCTTGAGGAAAACTGG + Intergenic
1011939574 6:92826129-92826151 CCTTTGATCATCACGGAAACAGG - Intergenic
1012805695 6:103890277-103890299 ACTTTGGTATTCAGAAGAACTGG + Intergenic
1014773177 6:125479898-125479920 CCTTTGGAGTTCAGGAATAAAGG + Intergenic
1017229422 6:152056552-152056574 CCTTAGGGCTTCTGAAAAACAGG + Intronic
1018590728 6:165418641-165418663 TCTTTGGTCTTCTTGAAGACAGG + Exonic
1018717450 6:166544426-166544448 CCTTTGGTTACCAGGAAAGCTGG + Intronic
1020078805 7:5275509-5275531 TCTCTGGTCTTCAGGAAGAGGGG + Intronic
1022394673 7:29976144-29976166 GCGTTGGTCTGAAGGAAAACTGG - Intronic
1023258630 7:38336373-38336395 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1023325881 7:39055432-39055454 CCATTAGTATTCAGGCAAACAGG - Intronic
1023498927 7:40827748-40827770 CCTTTGGTCTTAAGCAAGGCTGG + Intronic
1024661630 7:51500826-51500848 CCTTTGGTCTTCAGTGATAATGG + Intergenic
1024835870 7:53517986-53518008 CCTTTGGTCTATGGGAAAATTGG - Intergenic
1025200091 7:56956676-56956698 TCTCTGGTCTTCAGGAAGAGGGG - Intergenic
1025671853 7:63620256-63620278 TCTCTGGTCTTCAGGAAGAGGGG + Intergenic
1027860697 7:83575684-83575706 CCTTTGGTGTTCAGAAAGAAGGG - Intronic
1028689581 7:93636619-93636641 CCTTTGGAATTCAGGCATACTGG - Intronic
1030974290 7:116101973-116101995 CTTTTAATCTTCAGGAACACTGG + Intronic
1031438866 7:121767552-121767574 CCGTTGGTGTGCAGAAAAACAGG - Intergenic
1031932175 7:127696683-127696705 CCCTTGGTCTTCAGCCAAAATGG + Intronic
1032532361 7:132632830-132632852 CCACTGGTCTTCAGCAAAATGGG - Intronic
1033789346 7:144772567-144772589 TGTTTGGACTTCAGGAAAAAAGG + Intronic
1034534099 7:151716237-151716259 CCCTTGGCCTTTAAGAAAACCGG + Intronic
1034627492 7:152504618-152504640 CCTATGGCCTTGGGGAAAACTGG + Intergenic
1034779245 7:153862117-153862139 CATTTGGACTTCAGAAAAGCAGG + Intergenic
1034825198 7:154255960-154255982 CATGTGGTCTTCAGGAAAACTGG - Intronic
1035557596 8:578434-578456 CCTGTGGACTTCAGCAAACCTGG - Intergenic
1036068994 8:5419277-5419299 CCTTTGGTCATCTAGGAAACTGG + Intergenic
1041042664 8:53862934-53862956 CCTTTGGGTTTTAGGAAATCGGG + Intronic
1042435580 8:68760906-68760928 CCTATGGTCTTCTAGAAGACAGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044334146 8:90957800-90957822 ACTTTGTTCTTTAGGAAAATGGG - Exonic
1044531873 8:93316536-93316558 CCTTCCTTCTTCAGAAAAACGGG - Intergenic
1045928440 8:107597663-107597685 TCTTAGATCTTGAGGAAAACTGG + Intergenic
1046150267 8:110214631-110214653 CCTGTGGTATTCAGCAAAAGTGG + Intergenic
1046337828 8:112813352-112813374 TCTTAGATCTTGAGGAAAACCGG + Intronic
1048524157 8:135186138-135186160 TCTCAGGTGTTCAGGAAAACTGG + Intergenic
1049152790 8:141046253-141046275 CCTGTGGTCTTCAGGAACTGGGG + Intergenic
1052247129 9:26349270-26349292 TCTTAGATCTTGAGGAAAACCGG - Intergenic
1053177226 9:35936430-35936452 CATTTGGTCTCCTGGAAAGCTGG - Intergenic
1054798169 9:69321795-69321817 GCTTTGATCTTGAGGAAAACTGG + Intergenic
1055793763 9:79951771-79951793 AATTTGGTTTTCAGAAAAACAGG - Intergenic
1058481124 9:105396411-105396433 CCTTTGGTCTTCAGAAGATAGGG - Exonic
1059947007 9:119419397-119419419 TCTTTGCTCTTAAGAAAAACTGG - Intergenic
1060103253 9:120857905-120857927 CCTTTGGTTTTCAGGACCCCTGG + Exonic
1060990296 9:127845149-127845171 TCTTTGATCTCCAAGAAAACAGG - Intronic
1061547183 9:131311255-131311277 CCTTGGGTCTTCATGGAAAGGGG - Intergenic
1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG + Intronic
1187590112 X:20708112-20708134 CCTGTTATCTTCAGGATAACAGG + Intergenic
1188261632 X:28031084-28031106 CCTTTGGTTTCCAGGCACACAGG + Intergenic
1188660829 X:32756683-32756705 CCTTTAATCTTCTGGATAACTGG + Intronic
1188721487 X:33528405-33528427 CCTTTGGACTTCAGGAATATTGG - Intergenic
1191801772 X:65088902-65088924 CCTTGGTTCTTCTGGAAAATGGG + Intergenic
1193463026 X:81812084-81812106 TCTTAGATCTTGAGGAAAACAGG + Intergenic
1193701776 X:84771616-84771638 CCTTAGATCTTCAGCAAAAAAGG - Intergenic
1194103472 X:89737451-89737473 CCTTTCTTCTTTAGGAACACTGG + Intergenic
1194453182 X:94070200-94070222 CCTTTAGACTTCAGGGAAAAAGG - Intergenic
1195152430 X:102085597-102085619 CCTTTGGTCATCTGTAAACCAGG - Intergenic
1197203733 X:123771960-123771982 CCTTAGGGCTTCAAGAAAGCAGG + Intergenic
1197575662 X:128208055-128208077 TCTTAGGTCTTGAGGAAAACCGG - Intergenic
1197575897 X:128211015-128211037 TCTTAGATCTTGAGGAAAACCGG - Intergenic
1198102239 X:133432342-133432364 GCTTTGAGCTTCTGGAAAACAGG + Intergenic
1198105233 X:133455401-133455423 GCTTTGAGCTTCTGGAAAACAGG - Intergenic
1198914179 X:141649055-141649077 CCTTTAGTCCTGAGGAAATCAGG - Intronic