ID: 1187251557

View in Genome Browser
Species Human (GRCh38)
Location X:17603087-17603109
Sequence CTTTGGAAGGTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44414
Summary {0: 1, 1: 15, 2: 331, 3: 4746, 4: 39321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187251557_1187251563 -8 Left 1187251557 X:17603087-17603109 CCTCCCACTTTCACCTTCCAAAG 0: 1
1: 15
2: 331
3: 4746
4: 39321
Right 1187251563 X:17603102-17603124 TTCCAAAGTGTTGGGATTACAGG 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
1187251557_1187251566 30 Left 1187251557 X:17603087-17603109 CCTCCCACTTTCACCTTCCAAAG 0: 1
1: 15
2: 331
3: 4746
4: 39321
Right 1187251566 X:17603140-17603162 CCAGCCTATAATTCTTTAAGTGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187251557 Original CRISPR CTTTGGAAGGTGAAAGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr