ID: 1187251557 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:17603087-17603109 |
Sequence | CTTTGGAAGGTGAAAGTGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 44414 | |||
Summary | {0: 1, 1: 15, 2: 331, 3: 4746, 4: 39321} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187251557_1187251563 | -8 | Left | 1187251557 | X:17603087-17603109 | CCTCCCACTTTCACCTTCCAAAG | 0: 1 1: 15 2: 331 3: 4746 4: 39321 |
||
Right | 1187251563 | X:17603102-17603124 | TTCCAAAGTGTTGGGATTACAGG | 0: 978 1: 32713 2: 325405 3: 254412 4: 133373 |
||||
1187251557_1187251566 | 30 | Left | 1187251557 | X:17603087-17603109 | CCTCCCACTTTCACCTTCCAAAG | 0: 1 1: 15 2: 331 3: 4746 4: 39321 |
||
Right | 1187251566 | X:17603140-17603162 | CCAGCCTATAATTCTTTAAGTGG | 0: 1 1: 0 2: 0 3: 11 4: 131 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187251557 | Original CRISPR | CTTTGGAAGGTGAAAGTGGG AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |