ID: 1187254035

View in Genome Browser
Species Human (GRCh38)
Location X:17625210-17625232
Sequence GTGGCTTAATAGAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 2, 2: 31, 3: 129, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187254035 Original CRISPR GTGGCTTAATAGAAGACTGC TGG Intronic
905318519 1:37098922-37098944 GTGGCTTAGGAGCAGAGTGCAGG + Intergenic
905957083 1:42006635-42006657 CTGGCTTAATAGAAGACAACTGG + Intronic
905986534 1:42288796-42288818 CTGACTTAATAGAAGACAGCTGG - Intronic
906222359 1:44091274-44091296 CTGGCTAAACAGAAGACAGCTGG + Intergenic
906978374 1:50600751-50600773 CTGTCTTAATAGAAGACAACTGG - Intronic
907087895 1:51694321-51694343 CTGACTTAATAGAAGACAGCTGG + Intronic
907978069 1:59452980-59453002 TGGTCTTAATAGAAGACTCCCGG + Intronic
907997425 1:59647073-59647095 GTGGCATGATAAAAGACTGAGGG + Intronic
908687598 1:66739527-66739549 GAGGCTTCATACCAGACTGCTGG - Exonic
909165049 1:72211534-72211556 ATGAATTAATAGAAGACAGCTGG - Intronic
909461732 1:75923592-75923614 CTGGCCTAATAAAATACTGCAGG + Intronic
909675146 1:78231163-78231185 CTGGCTTCATAGAAGACAACTGG - Intergenic
909816952 1:80006524-80006546 GTGGCTTAGGAGACCACTGCTGG - Intergenic
909953078 1:81743279-81743301 GTGCTTTAATAGAAAACGGCAGG + Intronic
910010759 1:82458707-82458729 CTGGCTTACTAGAGGACAGCTGG + Intergenic
910420519 1:87057063-87057085 CTGGCTTAATAGAAGACAACTGG - Intronic
910871623 1:91838828-91838850 CTGGCTTAATACAAGACCACTGG + Intronic
911593040 1:99769636-99769658 CTGGCTTAATAGAAGACAGTAGG + Intergenic
912992516 1:114502917-114502939 GTGGTTTAATAGAATATGGCTGG + Intronic
914974117 1:152342602-152342624 CTAGCTTAATAGAAGACAACTGG - Intergenic
915080980 1:153352278-153352300 ATGGCTTCAAAGAAGACAGCTGG - Intergenic
915098665 1:153483025-153483047 GTGGATGAAGAGAAGACTGTTGG - Intergenic
915155032 1:153868376-153868398 CTGGCTTAATAGCAGACAGCTGG + Intronic
915469928 1:156119749-156119771 GTGGCTTTACAGAAGACAGCAGG + Intronic
915856649 1:159395834-159395856 CTGGTTTAATAGAAGACAGCTGG - Intergenic
916157903 1:161875098-161875120 CTGGCTTAATAGAAACCAGCTGG + Intronic
916833857 1:168521389-168521411 GTGACTTGATGGAAGACTGTGGG + Intergenic
917178920 1:172271464-172271486 GTAGTTTAACAGAAGACAGCTGG + Intronic
917578696 1:176350614-176350636 CTGGCTTAATAGAGCACAGCTGG - Intergenic
917657985 1:177146181-177146203 CTGGCTTAATAGAAGACAGATGG + Intronic
917707032 1:177645317-177645339 CTGGCTTTATAGCAGACTCCAGG - Intergenic
917946019 1:179971718-179971740 CTGGTTTAATAGAAGACATCTGG + Intronic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
919066421 1:192697252-192697274 GTGTTTTAATAGTAAACTGCAGG + Intergenic
919437896 1:197586228-197586250 CTGGCTTAATAGAAGTCAGCTGG - Intronic
919908539 1:202095401-202095423 CTGGCTTAATAGAAGACAGCTGG - Intergenic
919962087 1:202481443-202481465 TTGGCTTAATAGAAGACAGTGGG - Intronic
921032757 1:211348185-211348207 GTTGCTTAATAGAAGATAGCTGG - Intronic
923293940 1:232574460-232574482 GTGGCTGAAGAGAAGACAGCTGG - Intergenic
924323667 1:242874187-242874209 CTGGCTCAGCAGAAGACTGCTGG - Intergenic
924932804 1:248746010-248746032 CTGACTTAATAAAAGACAGCTGG - Intronic
1063154235 10:3363814-3363836 CTGGCTTAATGCAAGACAGCTGG + Intergenic
1063421890 10:5919063-5919085 CTGGCATAACAGAAGACTGCTGG - Intronic
1064488510 10:15823443-15823465 TTGGCTTATTAGTAGACAGCCGG - Intronic
1065206833 10:23364932-23364954 CTGGCTTAATGGAAGAGAGCTGG - Intergenic
1065401795 10:25311950-25311972 CTGGCCTAATAGAAGACAGATGG + Intronic
1065652641 10:27909514-27909536 GTGTCTTAAAAGAAGACTCAGGG + Intronic
1066335662 10:34475302-34475324 TTTGCTTAATAGAAGACATCTGG + Intronic
1066982296 10:42428551-42428573 TGCGCTTAATAGAAGACAGCTGG - Intergenic
1068034299 10:51740523-51740545 CTGGATTGATAGAAGACAGCTGG + Intronic
1068066759 10:52141603-52141625 GTGGCTTAACAGATTATTGCTGG - Intronic
1068911653 10:62384536-62384558 GTGGCTTCATAGAAGGCAGCTGG + Intronic
1069409386 10:68137226-68137248 CTGGCTTAATGGAAGACAGCTGG + Intronic
1069713335 10:70504696-70504718 CTGGCTTAACAGAAGACAGCTGG + Intronic
1070206656 10:74270409-74270431 CTGACTTAGTAGAAGACAGCTGG + Intronic
1071684498 10:87740794-87740816 CTGACTTAATAGAAGACAGCTGG - Intronic
1072846306 10:98834799-98834821 CTGGCCTAATAGAAGACAGCTGG - Intronic
1072911002 10:99500606-99500628 GCATCTTAAAAGAAGACTGCAGG - Intergenic
1073014722 10:100388851-100388873 CTGACTTAATAGAAGACAGCTGG - Intergenic
1074518089 10:114190158-114190180 TTGGCTTAACAGAAGACAGCTGG - Intronic
1074957016 10:118401152-118401174 CTAGCTTAATAGAAGGCAGCTGG + Intergenic
1074991715 10:118714115-118714137 CTAGCTTAATAGAAGACAGCTGG + Intronic
1075315770 10:121452091-121452113 CTGCCTTAATAGAAAACAGCTGG - Intergenic
1078138713 11:8674773-8674795 CTGGCTTAATAAAAGACGGCTGG + Intergenic
1078742804 11:14083225-14083247 CTGGCTTAATAGAATACACCTGG + Intronic
1079414434 11:20220354-20220376 CTGGCTTAGTAAAAGACAGCTGG - Intergenic
1079552584 11:21718672-21718694 GAGGCTTAACAGAATTCTGCTGG - Intergenic
1080116056 11:28622701-28622723 GTGGCTGGAGAGAAGACTACAGG + Intergenic
1080136941 11:28865978-28866000 GTGGCTTAAAAGAACAATTCTGG - Intergenic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1080885979 11:36368690-36368712 CTGGCTTAATAGAAGACAGTTGG - Intronic
1080892319 11:36419721-36419743 CTGGCTTCATAGAAGACAGTTGG + Intronic
1080924607 11:36743327-36743349 ATGGTTTAATAGAAGACAGCTGG - Intergenic
1081631654 11:44693786-44693808 GTGGCTTAAGTGAAGAAGGCAGG + Intergenic
1081865843 11:46360138-46360160 CTGGCCTAATAGAAGGCAGCTGG - Intronic
1084756766 11:71244630-71244652 GAGGTTTAATGGAAGACAGCTGG - Intronic
1085314060 11:75532857-75532879 ATGTCTTGATAGAAGACAGCTGG + Intergenic
1085377049 11:76073941-76073963 CTAGCTTAATAGAAGCCAGCTGG - Intronic
1086998174 11:93383559-93383581 GTGACTAAATTGAAAACTGCTGG + Intronic
1087142863 11:94782831-94782853 CTTGCTTAATATAAGACAGCTGG - Intronic
1087670588 11:101101691-101101713 CTATCTTAATAGAAGACAGCTGG - Intronic
1088262497 11:107957466-107957488 TTGCCTTAATTGAAAACTGCTGG - Intronic
1088530611 11:110804381-110804403 CTGGCTTAAAAGAAGGCAGCTGG - Intergenic
1089486464 11:118850325-118850347 CTGGCTTCACAGAAGACAGCTGG + Intergenic
1089562070 11:119348438-119348460 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
1089727047 11:120491170-120491192 CTGGCATAATAGAATACAGCTGG + Intergenic
1091676433 12:2494115-2494137 GGGGCTTAATAGATGACGGGTGG - Intronic
1091932693 12:4409468-4409490 CTGGCTGAGTAGAAGACAGCTGG + Intergenic
1092123760 12:6061896-6061918 CTGGCTTAATAGGAGACAGCTGG - Intronic
1092658289 12:10710755-10710777 ATGGTTTAATAGAAGATAGCTGG - Intronic
1092764204 12:11838091-11838113 CTGGCTTAATGGAAGATGGCTGG + Intronic
1092830018 12:12434592-12434614 CTGCCTTAATAGAAAACAGCTGG - Intronic
1093374856 12:18412489-18412511 GTGGCTTAATGAAAGAGAGCTGG - Intronic
1093531315 12:20167683-20167705 CTGACTTAATAGAACACAGCTGG + Intergenic
1093950258 12:25157461-25157483 CTGACTTAACAGAAGACAGCTGG - Intronic
1094201295 12:27797172-27797194 GTGGCTTGTTAGAAGGCCGCAGG + Intronic
1094278945 12:28712895-28712917 CTGGCTTGATAGAAGACAGATGG + Intergenic
1094286757 12:28802868-28802890 CTGGCTTAATAGGAGACAGCTGG + Intergenic
1095868712 12:47002257-47002279 TTGGTTTAATAAAAGACAGCTGG - Intergenic
1096269629 12:50154546-50154568 CTGGCTTAATAGAAGACAGCTGG - Intronic
1097669577 12:62519620-62519642 CTGGCTTAATAGGAGACAGCTGG + Intronic
1097902581 12:64888084-64888106 GTGGTTTAATAGAAGACAGCTGG - Intergenic
1098720128 12:73887215-73887237 GTGGCTCAATAAGAGACTGTAGG - Intergenic
1099255982 12:80312301-80312323 GTGGCTTAATAGCACACTGGGGG - Intronic
1099861312 12:88228591-88228613 GTGGCTGAGAAGATGACTGCTGG - Intergenic
1100508790 12:95247397-95247419 TTGGCTTAATAGAAAATTGCCGG - Intronic
1101287845 12:103334512-103334534 GTGGCTTTATAAAAGAAGGCAGG + Intronic
1101976096 12:109360145-109360167 GTGGATAAATATGAGACTGCAGG + Intronic
1102011441 12:109621643-109621665 CTGGCTTAATAGAACACAGCTGG - Intergenic
1103623428 12:122202233-122202255 TTGGCTTAATTGAAGACAGCTGG + Intronic
1104027605 12:125039928-125039950 GTAGCTAAAGAGAAGACAGCTGG - Intergenic
1106907969 13:34429101-34429123 CTGGCTCACTAGAAGACAGCTGG + Intergenic
1107265413 13:38547557-38547579 GAGGATTAATAGAAGACAACTGG + Intergenic
1107281015 13:38735079-38735101 TTGGCTTAATAGAGGACAGCTGG + Intronic
1107633761 13:42370970-42370992 CTGGCTTACTAGAGGACAGCTGG - Intergenic
1108221808 13:48241717-48241739 ATAGCTTAATAGAAGATAGCCGG + Intronic
1108318608 13:49263726-49263748 TTGGCTTAATAGAAGACAACTGG - Intronic
1108794865 13:54018472-54018494 GTGCCTTCATGGAAAACTGCCGG + Intergenic
1110013592 13:70370644-70370666 CTGGCTTAATACAAGACAGCTGG + Intergenic
1110896834 13:80763298-80763320 GTGGCTTATTAGAAGAGTATTGG + Intergenic
1113136136 13:107091543-107091565 CTGGCTTAATGGAAGACAGCTGG + Intergenic
1114508426 14:23236108-23236130 GTAGCTTAATAGAAAGCTGGTGG - Intronic
1115366744 14:32566228-32566250 CTGGCTTAATAGAAAATGGCTGG - Intronic
1115687791 14:35814264-35814286 TTGGCTTAATTAAAGACAGCTGG + Intergenic
1116484802 14:45434820-45434842 GTGGCTTCATAAAAAACAGCTGG - Intergenic
1118277884 14:64401883-64401905 ATGGCTTAGTAGAAGAGAGCTGG + Intronic
1118305494 14:64651639-64651661 GTTGATTAACAGAAGATTGCAGG + Intergenic
1118710667 14:68516409-68516431 CCGGCTTAATAGAAGACAGCTGG + Intronic
1118757672 14:68856783-68856805 CTGGCTTAATAGAAACCAGCTGG - Intergenic
1119172820 14:72547565-72547587 GTGGCTAAATGGGACACTGCCGG + Intronic
1120176714 14:81302056-81302078 GTGGTTTATTAGAAGGCTGGAGG + Intronic
1120549485 14:85851879-85851901 CTAGTTTAATAGAAGACAGCTGG + Intergenic
1121058859 14:90884949-90884971 GTGGCTAAATATAAGAAAGCAGG + Intronic
1122198408 14:100107162-100107184 GTGGTTTAATGGAAAACTGCTGG - Intronic
1122244421 14:100391959-100391981 CTGGCTTAATACAAGACAGCTGG - Intronic
1122528821 14:102410261-102410283 CTGGCTTAATAGAAGATGGCTGG + Intronic
1122676555 14:103419539-103419561 CTGGCTTAATAGAAGTTAGCTGG + Intronic
1124686185 15:31784398-31784420 CTGGCTTAATAGAAGACAGCTGG - Intronic
1126532122 15:49722227-49722249 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1126596909 15:50392295-50392317 TTGGCTTAATAGAAAACAGATGG + Intergenic
1127112122 15:55685568-55685590 TTAGCTTAATAGAAGACAGCTGG - Intronic
1127545397 15:59989799-59989821 CTGGCTTAATAGAAGACAACTGG + Intergenic
1127669264 15:61179350-61179372 CTGGCTTAATAGAAAACAGCTGG - Intronic
1128044695 15:64607413-64607435 CTGGTTTAATAGAAGACAGCTGG - Intronic
1128221229 15:65970090-65970112 GTGGCTTAAGAGCAGACTGAAGG - Intronic
1128558646 15:68649805-68649827 CTGGCTTATTAGAAGACAGCTGG + Intronic
1128928882 15:71685556-71685578 CTGGCCTAATAGAAGACAGCTGG + Intronic
1129104893 15:73299757-73299779 CTGGCTTAATAGAAGACAGCTGG + Intronic
1129353855 15:74974380-74974402 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130298000 15:82660634-82660656 GAGGCTGAAGAGAAGACTGCTGG - Intronic
1130350364 15:83085934-83085956 CTGGCTTAATAGGAGACAGCAGG - Intergenic
1130616382 15:85412407-85412429 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130675033 15:85944553-85944575 CTGGCTTAATGGAAGATGGCCGG + Intergenic
1131466502 15:92659551-92659573 CTGGCTTAATAGAAAATAGCTGG - Intronic
1131917544 15:97286563-97286585 TTGGCTTCAGAGAAGAGTGCGGG - Intergenic
1132878663 16:2151431-2151453 TTGGCTTAAGGGAAGCCTGCAGG + Intronic
1133010851 16:2910999-2911021 CGGGCTTAAAAGAAGACTACTGG + Intergenic
1134049772 16:11129397-11129419 CTGGCTTAATAGAAGACATCTGG + Intronic
1134512308 16:14858503-14858525 GTAGCTTAGAAGGAGACTGCAGG + Intronic
1134699945 16:16257003-16257025 GTAGCTTAGAAGGAGACTGCAGG + Intronic
1134971880 16:18537656-18537678 GTAGCTTAGAAGGAGACTGCAGG - Intronic
1135137103 16:19893135-19893157 CTGACTTAATAGAGGACAGCGGG - Intergenic
1135536718 16:23300458-23300480 TTGGCTTAATAAGAGACAGCTGG - Intronic
1135981672 16:27152599-27152621 GTGGCTGGAAAGAGGACTGCAGG + Intergenic
1137334111 16:47531634-47531656 TTGGCTTAATAGAAGACACTTGG + Intronic
1137699121 16:50483475-50483497 CTGGCTTAATAGAAAACAGCTGG + Intergenic
1137888726 16:52135346-52135368 CTGGCTTAATAGAAGACACCTGG - Intergenic
1138040179 16:53655155-53655177 CTGGCTTAATAGAAAACAGCTGG - Intronic
1138661776 16:58523813-58523835 CTTGCTTAATAAAAGACAGCTGG + Intronic
1139951120 16:70671036-70671058 GTGACTTAACAGAGCACTGCTGG + Intronic
1140936489 16:79675542-79675564 ATGGTTTAATGGAAGACTACGGG + Intergenic
1141884823 16:86884306-86884328 GTGGCTCCACAGAAGTCTGCAGG - Intergenic
1142076138 16:88119310-88119332 GTGGCTTTAAGGAAGAGTGCGGG - Intergenic
1142322954 16:89396609-89396631 GTGGCTTCATAGAAGACAGCAGG - Intronic
1144857727 17:18279103-18279125 CTGGCTTAATAGAAGAGAGCTGG - Intronic
1145080088 17:19887700-19887722 CTGGCTTAATAGAAGAAAACTGG + Intergenic
1149742580 17:59060793-59060815 CTGGCTTAGAAGAAGACTACTGG - Intronic
1151689857 17:75676037-75676059 CTGGCTTAATAGAATATGGCTGG + Intronic
1152333721 17:79688072-79688094 CTGGCTTGATAGAAGACAGCTGG - Intergenic
1153282858 18:3430287-3430309 CTGGTTTAATAGAAGACAGTTGG - Intronic
1154938741 18:21089425-21089447 CTAGCTTAATAGAAGACAACTGG + Intronic
1155139831 18:23034964-23034986 TTGGCTTAATAGAAGACAGTTGG - Intergenic
1155227950 18:23746510-23746532 GGGGCTTAATAGGAGAAAGCTGG - Intronic
1155473148 18:26211708-26211730 CTGGCTTAGTAGAAGACAGCTGG - Intergenic
1157623641 18:49030802-49030824 CTGCCTTAATAGAAGACAGCTGG + Intergenic
1157849894 18:51038641-51038663 CTAGCTTAATAGGAGACAGCTGG - Intronic
1157875274 18:51267448-51267470 CTGGCTTAATAGAAGACACCTGG - Intergenic
1161132618 19:2600328-2600350 CTGGCTTAATAGAAGACAGCTGG + Intronic
1164407590 19:27966710-27966732 TTGGCATAATAGAAGACAGATGG + Intergenic
1166548607 19:43649934-43649956 CCAGCTTAATAGAAGACAGCTGG - Intronic
1166796811 19:45431218-45431240 CAGGCTTAACAGAAGACAGCTGG - Intronic
1167407952 19:49326249-49326271 CTGGCTTCATAGAAGACAGCTGG + Intergenic
1167670148 19:50847418-50847440 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
1167823366 19:51949787-51949809 GAGGCTTAATAATTGACTGCTGG + Intergenic
1168495766 19:56848380-56848402 TTGACTTAATAGAAAACAGCTGG - Intergenic
926280160 2:11439738-11439760 CTGGCCTAATAGAAGACAGATGG + Intergenic
926555429 2:14352005-14352027 TTGGCTTAAAAGAAGACTGATGG + Intergenic
926644094 2:15270017-15270039 CCGGCTTAATAGAACACAGCTGG - Intronic
927530541 2:23794346-23794368 CTGGCTTAATGGAAGACCACTGG + Intronic
927569213 2:24143598-24143620 CTTGCTTAATAGAAGACAGGTGG - Intronic
928746371 2:34420479-34420501 GTAGCTTAATAGAAGATAGCTGG - Intergenic
929763750 2:44827281-44827303 CTGGCTTAATAGAAGACAGCTGG + Intergenic
929989621 2:46774697-46774719 CTGACTCAATAGAAGACAGCTGG + Intergenic
931436460 2:62251460-62251482 CTGACTTAATAAAAGACAGCTGG - Intergenic
931678528 2:64722509-64722531 CTGGCTTAATAAAAGACAGCTGG - Intronic
932198600 2:69806012-69806034 CTGGCTTAATGGAAGACAGATGG + Intronic
932222854 2:70013488-70013510 TTGGCTTAATAGAAGATAGTTGG - Intergenic
932378217 2:71257177-71257199 CTGGCTTAATAAAAGACATCTGG - Intergenic
932655301 2:73606052-73606074 CTGGTTTAATGGAAGACAGCTGG - Intronic
933086087 2:78055912-78055934 GTGGCTTCATAGAAAAATGTAGG + Intergenic
933450293 2:82440984-82441006 GTTGCTTATTAGATGACTGATGG + Intergenic
933666084 2:84966326-84966348 TTGGCTTAAATGAAGACAGCTGG + Intergenic
935149599 2:100421819-100421841 CTGGCTTAATAGAAGACAGCTGG - Intergenic
935280022 2:101508898-101508920 CTGGCTTAATAGAAGACAGCTGG - Intergenic
935494707 2:103765998-103766020 GTGTCTTAAAGGAAGACTGATGG + Intergenic
935655185 2:105416300-105416322 TGAGCTTAATAGAAGACAGCTGG + Intronic
938805044 2:134798494-134798516 CTGACTTAGTTGAAGACTGCTGG + Intergenic
939500986 2:142983866-142983888 CTGACTTAATAAAAGACAGCTGG + Intronic
939516707 2:143177780-143177802 CTGGCTTAAGAGAAGACAGCAGG - Intronic
939612018 2:144322515-144322537 CTAGCTTAATAGAAAACAGCTGG + Intronic
940493598 2:154396630-154396652 CTGGCTTAATAGAAGATAGCTGG + Intronic
940851591 2:158692516-158692538 CTGGCATAAGAGAAGACAGCTGG + Intergenic
941085133 2:161108575-161108597 CTGGCTTAATAGGAGACAGCTGG - Intergenic
941169807 2:162122438-162122460 ATGACTTAATAGAAGACAGGTGG - Intergenic
941638148 2:167958543-167958565 CTTGCTTAATAAAAGACAGCTGG + Intronic
941707585 2:168676041-168676063 ATGGTTTAGTAGAAGACAGCTGG + Intronic
942577737 2:177382723-177382745 CTGACTTAGTAGAAGACAGCCGG - Intronic
943147070 2:184059132-184059154 CTGGCTAAATAGAAGACAGATGG - Intergenic
944950391 2:204742051-204742073 ATAGCTTATTAAAAGACTGCTGG - Intronic
946287436 2:218715157-218715179 CTGACTTAATAGAAGACAGCTGG + Intronic
946826026 2:223678773-223678795 TTGGCTTAACAGATGACTGCAGG - Intergenic
946847157 2:223869598-223869620 GTGGCTTGATAGGAGTCAGCAGG + Intronic
946979513 2:225193628-225193650 CTGGCTTAATACAGGACAGCTGG - Intergenic
947314768 2:228844150-228844172 CTGGCTTAATAGAAGACAGCTGG + Intergenic
947511896 2:230763210-230763232 CTGGCTTAATAGAAAACAGCTGG + Intronic
947574273 2:231260170-231260192 CTGGCTTGATGGAAGACAGCTGG + Intronic
948665909 2:239534856-239534878 GTGGCTTGACTGGAGACTGCAGG - Intergenic
948779209 2:240307389-240307411 TTGGCTTGATAGAAGACAGCTGG - Intergenic
1168881042 20:1206457-1206479 CTGTCTTAATAGAACACAGCTGG + Intronic
1169178079 20:3536706-3536728 GTAGCTTAATAAAAGACAGCTGG + Intronic
1169858680 20:10129935-10129957 GTGACTTCACAGAAGGCTGCAGG - Intergenic
1170274976 20:14575323-14575345 CTGGCTTAATAAAAGACAGTTGG + Intronic
1171029503 20:21664662-21664684 CTGGCTTAATAGAAGATAGCTGG + Intergenic
1172967061 20:38843828-38843850 CTGGCTTAATGGAAGACAGTTGG + Intronic
1174859780 20:54079944-54079966 CTGCCTTAATAGAAGACAGCTGG - Intergenic
1179148353 21:38788737-38788759 CTGGTTTAATAGAAGGCAGCTGG - Intergenic
1181290926 22:21792981-21793003 CTGGCTTAATAGAAGACAGTTGG - Intronic
1182169939 22:28217937-28217959 TTTGCTTAATAGAAGACAACTGG + Intronic
1182375972 22:29848287-29848309 CTGGCTTAACAGAAAGCTGCTGG - Intergenic
1182398081 22:30051278-30051300 CTGGCTCAAAAGAAGACAGCTGG - Intergenic
1184087716 22:42275221-42275243 AGGGCTTAATATATGACTGCTGG - Intronic
1184329001 22:43813797-43813819 CTGGCTTAGTACAAGACCGCTGG - Intergenic
1184523600 22:45009238-45009260 ATCGCTTAAGAGAAGACTCCAGG + Intronic
949148703 3:737618-737640 GAGGCTGAATAGTAGACAGCAGG + Intergenic
949441652 3:4087616-4087638 CTGGCTTCATAGAAGACAGTAGG + Intronic
949540500 3:5028192-5028214 CTTCCTTAATAGAAGACAGCTGG - Intergenic
950337111 3:12204403-12204425 CTGGCTTAATAGGAGACAGCTGG + Intergenic
950526214 3:13525496-13525518 CTGACTTAATTGAAGACAGCTGG - Intergenic
950572575 3:13811108-13811130 CTGGCTTAATAGAAGTCAGCTGG + Intergenic
952082352 3:29774773-29774795 CTGGCTTAATAAAAGACAGCTGG - Intronic
953237708 3:41120630-41120652 GTGGTTGAATGGAAGGCTGCTGG - Intergenic
955570789 3:60303280-60303302 CTGGTTTAGAAGAAGACTGCAGG + Intronic
958986926 3:100791474-100791496 CTGGCTTAAGAGAAGATAGCTGG - Intronic
960660786 3:120056099-120056121 GTTGCTTAATAGAAGATACCTGG - Intronic
960791441 3:121435735-121435757 TTGGCTTAAGAGAACACAGCTGG - Intronic
961719938 3:128886808-128886830 TTGGCTTATTAGAAGACAGCTGG + Intronic
962150470 3:132887543-132887565 GTGTGTTCATAGGAGACTGCTGG - Intergenic
962150652 3:132889748-132889770 GTGACTTAATAAAAGACAGCTGG + Intergenic
962945154 3:140162074-140162096 CTGGCTTAATAGAAGACAGCTGG + Intronic
963072484 3:141316090-141316112 CTGGCTTAATAAATGACAGCTGG - Intergenic
963450592 3:145476358-145476380 GTGAATGAAAAGAAGACTGCAGG - Intergenic
964491851 3:157244756-157244778 TTGGCTTAATACAAGACAGCTGG + Intergenic
964571837 3:158115698-158115720 CTGGTTTAATAGAAGATGGCTGG + Intronic
965417294 3:168412885-168412907 GTGAATTAATAGAAGACAGCTGG - Intergenic
966590024 3:181672524-181672546 CTGGCTTAATAGAAGACAGCTGG - Intergenic
967103209 3:186233781-186233803 GTGGCTTAAAACAACACTACTGG - Intronic
967707621 3:192670167-192670189 CTGCCTTAATAAAAGACAGCTGG - Intronic
970191469 4:13523006-13523028 GTGGCTTAAATGAAGAGTCCTGG + Intergenic
971501110 4:27318752-27318774 GGGACTTAATGGAAGACTGAAGG + Intergenic
972075227 4:35079109-35079131 GTGACTTGATGCAAGACTGCAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972258557 4:37384909-37384931 GTGGCTGAGCAGAAGACTTCAGG - Intronic
972728202 4:41765201-41765223 CTGGCTTCATAGAAGACAGCTGG + Intergenic
972798582 4:42448214-42448236 CTGGCTTAATAGAAAGCAGCTGG + Intronic
973670288 4:53210522-53210544 CTGGTTTAATAGAAGACAGCTGG - Intronic
974835404 4:67242604-67242626 CTGGCTTAATAAAACACAGCTGG - Intergenic
975271419 4:72438533-72438555 CTGACTTAATAGAAGACAGTTGG + Intronic
975872221 4:78793012-78793034 TTGGCTTAATAGAAGACTGTTGG - Intronic
976406706 4:84667629-84667651 CTGGCTCAATAGAAGACAGGTGG - Intergenic
976466443 4:85374580-85374602 GTGGCTGAATAGAAGGCAACTGG - Intergenic
976626862 4:87194181-87194203 GTGCCTTAAGAGAGGACTGGAGG + Intronic
977931697 4:102757027-102757049 GTGGCATAATAGCAGGCTGAGGG + Intronic
978636114 4:110809278-110809300 GTGGCTTAAAAGAACAAAGCTGG + Intergenic
978788124 4:112632609-112632631 TTGGCTTAATGGAAGACAACTGG - Intronic
979279694 4:118851752-118851774 CTTGCTTAATAGAACACAGCTGG + Intronic
979442937 4:120773857-120773879 GTGGTTTAAGAGGAGACAGCTGG - Intronic
979885492 4:126022922-126022944 GTGGTTTAATAGCAGTCTTCAGG + Intergenic
979947938 4:126857913-126857935 TTGGCTTAATAGAAGACAGTTGG + Intergenic
980405536 4:132350656-132350678 CTGGCTTAATAGAAGACAGCTGG - Intergenic
980887161 4:138775628-138775650 CTGCCTTAACAGAAGACAGCTGG + Intergenic
981303100 4:143212785-143212807 CTGGCTTAACAGAAGACAGCTGG - Intronic
981551173 4:145942990-145943012 CTGGCTTAATAGGACACAGCTGG - Intergenic
981781220 4:148432185-148432207 CACACTTAATAGAAGACTGCTGG + Intronic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
982210663 4:153032580-153032602 CTGGCTTAATAGAAGACTGCTGG + Intergenic
982240166 4:153292243-153292265 CTGGCTTAACAGAAGATGGCTGG - Intronic
982574388 4:157090384-157090406 CTGGTTTAATGGAAGACAGCAGG + Intronic
983614086 4:169681847-169681869 CTGGCTTAATAAAACACTGCTGG + Intronic
984590667 4:181613923-181613945 CTGGCCTAATAGAATACAGCTGG - Intergenic
984710938 4:182884249-182884271 CTGGCTTAATAGAAAACAGCTGG - Intergenic
987277932 5:16381639-16381661 TTGGTTTAATAGAAGGCAGCTGG - Intergenic
987909287 5:24121570-24121592 GTGGCTTAATAGGAGATGACTGG - Intronic
988992572 5:36685638-36685660 CTGGCTTAATACAAGACAGTTGG + Intronic
989219795 5:38944215-38944237 CTGGCTTAATAGAAGATAGCTGG + Intronic
990269314 5:54118347-54118369 CTGGTTTAATAGAAGAGGGCCGG - Intronic
991274768 5:64831848-64831870 CTGGTTTAATAGAAGGCAGCTGG + Intronic
991581331 5:68158111-68158133 CTTGCTTAATAGAAGACAGTTGG + Intergenic
992813200 5:80409623-80409645 CTGGCATTATAGAAGACAGCTGG + Intronic
993392419 5:87336126-87336148 CTGGCTTAAATGAAAACTGCTGG - Intronic
993569386 5:89518238-89518260 CTGGCTTAATAGAATATTGGAGG - Intergenic
993662830 5:90660094-90660116 CTGGCTTAATAGAAGACAGCTGG - Intronic
994144663 5:96381132-96381154 CTGGCTTAATAGAAGAATGCTGG - Intergenic
994199098 5:96952224-96952246 TTGGCTTAATAGAATACAACTGG + Intronic
995897883 5:117036207-117036229 GTGTCTTAATGGAAGACTCTGGG - Intergenic
996888746 5:128391348-128391370 CTGCCTTAATAGAAGCCAGCTGG - Intronic
997501650 5:134379785-134379807 CTGGCTTAACAGAAGATAGCTGG - Intronic
997504947 5:134410051-134410073 GTGGATTAATAAGAAACTGCAGG + Intronic
997810198 5:136959847-136959869 CCGACTTAATAGAAGACAGCTGG - Intergenic
998268470 5:140684930-140684952 CTGACTGAATAGAAGACAGCAGG + Intronic
999429442 5:151513173-151513195 CTGGCTTAATAGAAGATAGCTGG - Intronic
999977120 5:156922792-156922814 CTGGCTTAATAGGAGACAGAGGG - Intronic
1000358629 5:160426299-160426321 TTGGCTTAATACAAGACAACTGG + Intronic
1000602801 5:163295676-163295698 AAGGCTTAATAGGAGTCTGCTGG + Intergenic
1002939153 6:1700714-1700736 GTGGCAAGAAAGAAGACTGCAGG + Intronic
1003104138 6:3201435-3201457 CTGGCTTAATACAACACAGCTGG - Intergenic
1003344579 6:5255346-5255368 TTGGCTTAATAGAAGACAACTGG - Intronic
1003584116 6:7370695-7370717 CTGGCTTAATTGAAGATAGCTGG + Intronic
1003848869 6:10201711-10201733 CTTGCTTAATAGAAGACAGCTGG + Intronic
1003934628 6:10962772-10962794 CTGGCTTAATAGAAGCCAGCTGG + Intronic
1004097792 6:12576173-12576195 CTGGCTTAACAGAAGACAGCTGG - Intergenic
1004317954 6:14607372-14607394 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1005591823 6:27336737-27336759 GTGGCACAGTAGAAGCCTGCTGG - Intergenic
1006254164 6:32816398-32816420 GTGGCTTAATAAATGACAGAAGG + Intronic
1007463723 6:42036806-42036828 CTGACTTCATAGAAGACAGCTGG - Intronic
1007502865 6:42312116-42312138 GTGGTTGGATAGAAGACAGCAGG + Intronic
1008036491 6:46750462-46750484 CTGACTTAATAGAAGACAGCTGG + Intronic
1008268001 6:49455193-49455215 ATGGCTTAAGAGAAAACAGCTGG + Intronic
1008413111 6:51206512-51206534 GTGGCTTGATACAAGACACCTGG - Intergenic
1009437451 6:63635142-63635164 CTGGCTTAATAGAAGATGGCTGG + Intergenic
1009603841 6:65839323-65839345 ACAACTTAATAGAAGACTGCTGG - Intergenic
1010068446 6:71713733-71713755 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1010597688 6:77784970-77784992 GAGGCTTATTAGAAGTTTGCCGG + Intronic
1010741180 6:79507182-79507204 CTGGCTTAATAGGGGACAGCTGG - Intronic
1010884127 6:81215897-81215919 CTGGTTTAATAGAAGAAAGCTGG - Intergenic
1011716431 6:90110074-90110096 CTGGCTTAACAGAGGACTGCTGG + Intronic
1012464149 6:99498813-99498835 CTGGCTTAGTAGAAAACAGCTGG - Intronic
1012700847 6:102454836-102454858 GTGCCTTAATGGAAGTCTGAAGG - Intergenic
1012750860 6:103161908-103161930 CTGGCTTAATAGAAGACATCTGG + Intergenic
1013402179 6:109809265-109809287 CTGGCTTAATAGAAGACAACTGG - Intronic
1013577990 6:111504302-111504324 GTAGCTTAATAAAAGTCTGCTGG - Intergenic
1013731231 6:113170035-113170057 CTGGCTTAACAGAAGACAGCTGG + Intergenic
1014629011 6:123766608-123766630 TTGACTTAATAAAAGACAGCAGG - Intergenic
1014677187 6:124381132-124381154 ATAGCTTAATAGAAGACAGTTGG - Intronic
1015055196 6:128893883-128893905 CTGGCTTAATAGAAGAGAACTGG + Intronic
1016379012 6:143454144-143454166 TTGGCTTAATTGAAGAAAGCTGG + Intronic
1016940372 6:149478321-149478343 CTGGGTTAATAGAAGACAGCTGG - Intronic
1017723405 6:157260023-157260045 GTGGCTTAATTTAGGACTGGCGG - Intergenic
1017777094 6:157688951-157688973 CTGGCTTAACAAAAGCCTGCTGG - Intergenic
1018257206 6:161933448-161933470 TTGGCTTAATAGACAACTGATGG + Intronic
1019794880 7:3042335-3042357 ATGCATTAACAGAAGACTGCTGG + Intronic
1019871286 7:3764841-3764863 TTAGCTTAATAAAAGACAGCTGG - Intronic
1019991144 7:4692196-4692218 CTGGCTTAATAGAAGACAGCTGG + Intronic
1020925547 7:14319338-14319360 CTGGTCTAATAGAAGACAGCTGG - Intronic
1020955409 7:14734583-14734605 CTGGCTTCATGGAAGACAGCTGG - Intronic
1021686315 7:23190318-23190340 TTGGCTTAATAGAAGACTGCTGG - Intronic
1021848195 7:24783018-24783040 GTAGCTTAAAAGAAGACAGTGGG + Intergenic
1022149312 7:27583973-27583995 CTGGCTTAATAGAAGACAGCTGG + Intronic
1022334485 7:29409494-29409516 CTGGCTTAAAAGAAGACAGCTGG + Intronic
1022999712 7:35796034-35796056 CTAGCTTAATAGAAGATAGCCGG + Intergenic
1023535606 7:41205914-41205936 CTGGATCAATAGAAGACAGCTGG - Intergenic
1023656465 7:42427162-42427184 CTGGCTAAATAAAAGACAGCTGG + Intergenic
1023741306 7:43283366-43283388 CTGGTTTAACAGAAGACAGCTGG - Intronic
1024402672 7:48943407-48943429 CTGGCTTCATAGAAGGCTGTAGG + Intergenic
1026153498 7:67808021-67808043 CTGGCTTAATGGAAGACAGCTGG - Intergenic
1026924292 7:74179081-74179103 CTGGCTTAATAGAACACAGCTGG + Intronic
1027418933 7:78001250-78001272 GTGGCTTTACAGAAGAGTCCTGG + Intergenic
1027484053 7:78737629-78737651 CTGGCTTCATAGAAGACAGCTGG - Intronic
1028557210 7:92136934-92136956 CTGGCTTAATAGAAGACTGTTGG - Intronic
1028905729 7:96152159-96152181 GTGGCTGAAAATAAGATTGCTGG + Intronic
1028965378 7:96796183-96796205 GTGGCTTCAAAGAACACTCCCGG + Intergenic
1029412677 7:100425692-100425714 CTGGCTTAATAGAAAACAACTGG - Intronic
1029899843 7:104027235-104027257 CTGGCTTACTAGAAGGCAGCTGG + Intergenic
1030551212 7:110962478-110962500 CTGGCTTAATAGAAAACAGCTGG + Intronic
1031797959 7:126201656-126201678 CTGGCTTAATAAGAGACAGCCGG + Intergenic
1033237834 7:139652301-139652323 GTGGCTTTGTATAAGACAGCAGG + Intronic
1034625522 7:152489274-152489296 CTGGCTTAATAGAGGACAGCTGG - Intergenic
1034975529 7:155447235-155447257 CTGGCTTAATAGAAGATAGTTGG - Intergenic
1035092215 7:156322641-156322663 CTGACTTAATAGAAGATGGCTGG + Intergenic
1035285240 7:157801843-157801865 GTGGCTTATCAGAAACCTGCAGG + Intronic
1035356922 7:158281510-158281532 GTGTCTTCATAGCAGACTGTGGG - Intronic
1036532512 8:9607273-9607295 TTGACTTAATTGAAGACAGCAGG + Intronic
1036624691 8:10459075-10459097 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1036940315 8:13045599-13045621 TTAGCTTAATAGAAAACAGCTGG + Intergenic
1037235302 8:16713107-16713129 GTGGGTTAATAGAAGAAATCAGG + Intergenic
1037268322 8:17094518-17094540 CTAGCTTACTAGAAGACAGCTGG + Intronic
1038305204 8:26394624-26394646 CAAGCTTAATAGAAGACAGCTGG + Intronic
1038498150 8:28021538-28021560 CTGGCTTAATAGAACACAGCTGG - Intergenic
1039054312 8:33522825-33522847 CTGGTTTAATAGGAGACAGCTGG + Intergenic
1039616714 8:38960615-38960637 CTGGCATAATAGAAGACAACAGG + Intronic
1040046170 8:42966009-42966031 CTGTTTTAATAGAAGACAGCTGG - Intronic
1043115348 8:76245706-76245728 CTGGCTTAATAGATGACAGCTGG + Intergenic
1043290264 8:78590565-78590587 CTGGCTTAATAAAAGACATCTGG - Intronic
1043414159 8:80031126-80031148 GTGGATTAATATTAAACTGCTGG - Intronic
1043858809 8:85291801-85291823 CTGGCTAAATAGAAGACAGCTGG - Intergenic
1044732588 8:95241817-95241839 CTGGCTTAACAGAAGACAGCTGG + Intergenic
1044740963 8:95326105-95326127 GTGCCCTAATATAAAACTGCTGG - Intergenic
1045674471 8:104591575-104591597 CTGGTTTAATAGAAGACAGCTGG + Intronic
1047071668 8:121351847-121351869 CTGGTTTAATAGAAGACAGCTGG + Intergenic
1047376679 8:124305007-124305029 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1050587251 9:7125349-7125371 GTGGCGTGAGAGAAGACTGATGG - Intergenic
1051240134 9:15046136-15046158 CTGGCTTAATAAAACACTGCTGG - Intergenic
1051435729 9:17029296-17029318 CTGGCTTAATTGAAGACAGCTGG + Intergenic
1051805173 9:20984593-20984615 CTGGCTTAATAGAAGACAGCTGG + Intronic
1052631386 9:31045632-31045654 TTGGCTTAATAAAAGCTTGCTGG + Intergenic
1053307172 9:36993154-36993176 CTGGCTTAATAGAAAACAGCTGG - Intronic
1053357476 9:37459112-37459134 GTAGTTTAATAGAAGACAGCTGG - Intronic
1053426812 9:38015580-38015602 GTTGCTTAGTAGAAGAGAGCTGG - Intronic
1054771176 9:69085654-69085676 TTGGCTTAATAGAAAACAGCTGG - Intronic
1054917878 9:70512395-70512417 CTGTCTTAATAGAAGACAGCTGG - Intergenic
1055226223 9:74000284-74000306 CTGAATTAATAGAAGACAGCAGG + Intergenic
1055371958 9:75609617-75609639 CTGGCATAAAAGAAGACAGCTGG - Intergenic
1055826876 9:80338234-80338256 ATGGCTGAATAGAAGCCTCCAGG + Intergenic
1056691101 9:88809259-88809281 GTGGGTTGATAGAAAACTGGAGG - Intergenic
1058738609 9:107920343-107920365 CTAGCTTAATAGAAGACAACGGG + Intergenic
1059371236 9:113839822-113839844 GTTGCTTAATAGAAGTCAGCTGG + Intergenic
1059429753 9:114242946-114242968 CTGGCTTAATAGAAGTCAGCTGG + Intronic
1059522117 9:114952732-114952754 CTGGCTTAATATGAGACAGCTGG - Intergenic
1061343158 9:129999847-129999869 CTAGCTTAATAGAAGACAGCTGG + Intronic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186746339 X:12573870-12573892 CTGGCTCAATAGAAGATAGCTGG - Intronic
1186798116 X:13066326-13066348 CTGACTTAATAGAAGACAACTGG + Intergenic
1186873548 X:13795538-13795560 CTGGCTTAACAGTAGACAGCTGG - Intronic
1186884774 X:13902572-13902594 GTGGCAGAATAGAAGAGTGCTGG - Intronic
1187254035 X:17625210-17625232 GTGGCTTAATAGAAGACTGCTGG + Intronic
1187823582 X:23313245-23313267 TTGGCTTAATAGAAGACAGCTGG - Intergenic
1187916228 X:24154686-24154708 CTGGCTTAATAGAAACCGGCTGG - Intronic
1188236391 X:27736947-27736969 CTGGTTTAATAGAAGACATCTGG - Intronic
1189447858 X:41097690-41097712 CTGGCTTAATAGAAGACAACTGG + Intronic
1189485974 X:41432277-41432299 CTGACTTAATAGAAGACAGCTGG + Intergenic
1189897506 X:45671072-45671094 CTGGATTAATAAAAGACAGCTGG + Intergenic
1189942529 X:46139732-46139754 CTGGCGTAATAGAAGACAGCTGG + Intergenic
1190882449 X:54501634-54501656 ATGGCTTAATAGAAGACAGCTGG - Intergenic
1192267175 X:69546889-69546911 GTGGCTTAGTACAGGCCTGCAGG + Intergenic
1192355606 X:70400636-70400658 CTGGCTTAGTTGAAGACAGCTGG - Intronic
1192855193 X:75001644-75001666 CTGACTTAATAGAAGATAGCTGG + Intergenic
1193087722 X:77462085-77462107 CTGCCTTGATAGAAGACAGCTGG + Intergenic
1193691091 X:84643580-84643602 CTGGTTTAATAGAATACAGCTGG + Intergenic
1194647577 X:96476345-96476367 CTGGAATAATAGAAGACAGCTGG + Intergenic
1195813525 X:108859830-108859852 CTGGCTTAAGCGAAGACAGCTGG + Intergenic
1196558351 X:117118312-117118334 CTGGCTTAATAGAACACTGCAGG + Intergenic
1196903747 X:120411856-120411878 GTGGCTTATTTTAACACTGCAGG - Intergenic
1197955414 X:131941342-131941364 TGGGCTTAACAGAAGACAGCTGG - Intergenic
1198012276 X:132569617-132569639 CTGGCTAAATAGAAGAAAGCTGG + Intergenic
1199684272 X:150252448-150252470 TTGGCTTCATAGAAAACAGCTGG + Intergenic
1202297233 Y:23372355-23372377 TTGGTTTAATAGAAGACAGTGGG - Intergenic
1202573574 Y:26298242-26298264 TTGGTTTAATAGAAGACAGTGGG + Intergenic