ID: 1187254748

View in Genome Browser
Species Human (GRCh38)
Location X:17632145-17632167
Sequence AAAGAGAAGGAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1826
Summary {0: 1, 1: 0, 2: 14, 3: 174, 4: 1637}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187254748 Original CRISPR AAAGAGAAGGAGAATGTGGA AGG Intronic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900583566 1:3421392-3421414 AAAAGGAAGGAGAACGTGCAGGG - Intronic
900935307 1:5762221-5762243 AAAAAGAAGAATAAAGTGGAAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
901787075 1:11631847-11631869 AGAGAGAGAGAGAAAGTGGAAGG + Intergenic
902115200 1:14115473-14115495 AAAGAGAAGAAGCTTGTGCAGGG - Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903784003 1:25844783-25844805 AAAGTGGAGGAGAATGAGTAGGG - Intronic
903799458 1:25955710-25955732 AAAGAGAAAGAGAAAAAGGAAGG + Intergenic
904136566 1:28317135-28317157 AAAGAGAGTGAGAATGTGTCAGG - Intergenic
904269146 1:29337926-29337948 AAAGTGAAGGAGAATGTACAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904691563 1:32296977-32296999 GAAGATAAGGAGAAAGTTGAGGG + Intronic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905466393 1:38157112-38157134 AAATAGAATGGGAATGTGGTGGG - Intergenic
905566260 1:38967511-38967533 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906515100 1:46434200-46434222 TAAGAGAAGGGGTATGTGGATGG - Intergenic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906672724 1:47668461-47668483 TGAGAGAAGGAGGAGGTGGAGGG + Intergenic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
906994625 1:50778668-50778690 GAAGAGAAGGAGGAAGGGGAGGG + Intronic
907094528 1:51765295-51765317 AAAGAGGAGAGGAATTTGGATGG + Intronic
907619560 1:55962655-55962677 AGAGAGAAAGAGAAATTGGAAGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908000902 1:59677828-59677850 TAAGAGAAGGAGAATCTGAATGG - Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908686179 1:66722323-66722345 AAAGAGGAAGAAAATGTTGACGG - Intronic
908877803 1:68697750-68697772 AAAGAGCAGGAGATAGTTGAGGG + Intergenic
909205594 1:72753075-72753097 GAAGAGGAGGAGGAAGTGGAGGG - Intergenic
909423243 1:75490587-75490609 AAAGACAATGAGAGTGTAGAAGG - Intronic
909461857 1:75925787-75925809 AAATTGAAGGAGAATGAGAAGGG - Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
909835385 1:80248224-80248246 AAAGGAAAAGAGAAAGTGGAAGG + Intergenic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
910140160 1:84018419-84018441 GAAAGGAAGGAGAAAGTGGAAGG - Intergenic
910178562 1:84457227-84457249 GAAGAGAAGGAGAGTGAAGAAGG + Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910668992 1:89754126-89754148 ACAGAGAAGGAGAATGGGACAGG - Intronic
910917113 1:92300682-92300704 GAAGAGGAGTAGAATGTGAAGGG + Intronic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911123504 1:94319194-94319216 AAAGAGAAAGAAACTGTGGAGGG - Intergenic
911259700 1:95670450-95670472 TAAAAGAAAGAGAATGTGAAAGG - Intergenic
911382161 1:97128891-97128913 AGAGAAAAGTAGAGTGTGGATGG + Intronic
911429723 1:97769192-97769214 AAAGAAAAGGACATTTTGGAAGG + Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
911935507 1:103965216-103965238 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
912095248 1:106132576-106132598 AAAGAGAAGAAAAATCTGAAAGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912524430 1:110270669-110270691 AAATAGAAGCAGTATGTGCAAGG + Intronic
912662372 1:111543720-111543742 AAAGAGGAGGAGGAAGAGGAGGG + Intronic
912664727 1:111568758-111568780 GAAGAGATGGAGGAAGTGGAAGG - Intronic
912913154 1:113783697-113783719 AAAGAGAAAAAGGAAGTGGAGGG - Intronic
912916186 1:113816957-113816979 GAAGAGAAGGAGAGTAGGGAAGG + Intronic
912945109 1:114078273-114078295 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
913296378 1:117324682-117324704 GAAGAGAAGGAGCAAGAGGAGGG - Intergenic
913303133 1:117394567-117394589 AAACAGAAGAAGAAAGTGAATGG - Intronic
913373791 1:118129641-118129663 GAAGAGAAGGAGGATGGGCAGGG - Intronic
913509312 1:119547805-119547827 AAAGAGAGGAAGAAATTGGATGG + Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914803666 1:150977307-150977329 AAAGAGAAGGTGGATGGAGAAGG + Intergenic
914915625 1:151817486-151817508 ACAGAGGAGGGGAGTGTGGAGGG + Intronic
914998043 1:152561817-152561839 AAAGGGAAAGGGAATGGGGAAGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915313110 1:155014277-155014299 AAAGAGATGGGGAATGGGGCAGG + Intronic
915338535 1:155162808-155162830 CCAGAAAAGGGGAATGTGGAAGG + Intergenic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915877099 1:159622684-159622706 AAAGAGCAAGAAAACGTGGAAGG + Intergenic
916125866 1:161570545-161570567 AAAGAGAAGAAGAATGTATTAGG - Intergenic
916198341 1:162246304-162246326 GAAGAGAAAGACAATGTGCAGGG + Intronic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916674240 1:167053087-167053109 AAACAGAAGGAGGCTGTGGGAGG + Exonic
917138049 1:171806709-171806731 AAAGAAAAAGAGAAAGAGGAAGG - Intronic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
917800286 1:178563449-178563471 GCAGAAAAGGAGACTGTGGAGGG + Intergenic
917844928 1:179012779-179012801 AAAGAGAAGGAATAAGTGAAAGG + Intergenic
918251271 1:182705686-182705708 AAAAAGACGGGGAATGTGTAGGG + Intergenic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
918948915 1:191109259-191109281 AGAGAGATAGAGTATGTGGAGGG + Intergenic
918978425 1:191522743-191522765 TAAGAAAAGGAGAATGTGGTCGG - Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919536464 1:198793918-198793940 AAAGAGAGGAAGAATGTCGCTGG - Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919747624 1:201018308-201018330 TAAGAAAGGGAGAATGTGGCTGG + Intronic
919887187 1:201943342-201943364 AAAGAAAAGGTGAATGTGCTCGG + Intronic
920194970 1:204220905-204220927 AAAGAGACGGACAAAGTGGCAGG + Exonic
920218152 1:204376178-204376200 AAAGAGGAAAAGAATCTGGATGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920612695 1:207456867-207456889 AAAGAGAAGGCCAGTGTGGCTGG - Intronic
920644426 1:207788963-207788985 AAAAGGAGGGAGCATGTGGATGG - Intronic
921249374 1:213281960-213281982 AAAGAGACGGAGCAAGGGGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921528911 1:216255103-216255125 AAAGAGCAGGAGAATCTCCATGG - Intronic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921593505 1:217030136-217030158 AAAGAGAAAGAGAAAGGGAAAGG - Intronic
921678253 1:218001511-218001533 AAAGAGAAGGCCAGTGTGGCTGG - Intergenic
921776655 1:219108663-219108685 AAAGACAAGGAGAATTACGAAGG - Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922918434 1:229278222-229278244 AAAAAGAAGGACGAGGTGGAAGG - Intronic
922985480 1:229863057-229863079 AAAAAGAAGGAGATTCTGGCTGG - Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923053923 1:230410923-230410945 AAAGAAAAGGTGAGTGTGGTGGG + Intronic
923272326 1:232368920-232368942 AAAGAGGAGGAGCAAGAGGAAGG - Intergenic
923509808 1:234640695-234640717 AAAGAGAGGGAGAGTGAGGGAGG + Intergenic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1062792656 10:318896-318918 AAAAAAAAGAAAAATGTGGAAGG - Intronic
1062943825 10:1444910-1444932 AGATGGAAGGAGAATGTAGACGG - Intronic
1063113635 10:3057568-3057590 GCAGAGGAGGAGGATGTGGAAGG + Intergenic
1063130730 10:3174100-3174122 AAAAAGAGGGAGAAGGTGAAGGG - Intergenic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1063524726 10:6774207-6774229 AAAGCTAAGAAGAATGTGGGAGG - Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063596385 10:7439652-7439674 AATGAGAAGGAGAAACTGCAAGG - Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1063680492 10:8182757-8182779 AAAGAGAAAAAGAAAGTAGAGGG - Intergenic
1063692181 10:8297228-8297250 AAAGAGAAAGAAAGTGTGGCAGG - Intergenic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064359037 10:14646775-14646797 AAAAAAAAGGAGAAAATGGAAGG - Intronic
1064482878 10:15757061-15757083 AGAGAGAAGGGGAATGAAGATGG + Intergenic
1065289336 10:24214458-24214480 AAAGAGAGAGAGAACGTGGAAGG + Intronic
1065293951 10:24257436-24257458 AAAGAAAATGAGAAAGGGGAAGG - Intronic
1065639799 10:27770269-27770291 AGAGAGAAAGAGAAAATGGAAGG - Intergenic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1066063518 10:31745181-31745203 GAAGAGAAGGAGCAAGGGGAGGG - Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066382665 10:34914544-34914566 AAAGAAAAAGAGAATGTGACTGG - Intergenic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1066551362 10:36561351-36561373 AACGGGCAGAAGAATGTGGAAGG - Intergenic
1066562813 10:36689156-36689178 AAACACAAGGAGACTCTGGAAGG + Intergenic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067757936 10:49019336-49019358 AAAGAGGAGAAAAATGTGAAGGG + Exonic
1068017982 10:51542236-51542258 ATAGAGAGAGAGAATTTGGAGGG + Intronic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068104688 10:52599661-52599683 AATGAGATGGAAAATGTGAATGG + Intergenic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068800249 10:61132392-61132414 AAAGAGAAGGAGAAACTAGGAGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069219515 10:65865808-65865830 CAAGAGAAGGAGCATGTGTTTGG + Intergenic
1069286301 10:66719962-66719984 AAAGAAAAGGGTAAAGTGGAAGG + Intronic
1069357787 10:67607521-67607543 GAAGAGATGGAGGAGGTGGAAGG + Intronic
1069679792 10:70276026-70276048 AAAGAGGATGAGAAAATGGATGG - Intronic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069733272 10:70633330-70633352 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1070729338 10:78814480-78814502 AAAAAAAATGAGAGTGTGGAGGG - Intergenic
1070737071 10:78870460-78870482 AATAAGAAGGAGAATCTGGGAGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071237707 10:83668364-83668386 AAAGAGTGGAAGGATGTGGAAGG - Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071725690 10:88196208-88196230 AAAAAGAAGGGGAAAGTGGGAGG + Intergenic
1072034586 10:91552468-91552490 AAAGAGAAAGAGAAAGGGGTGGG - Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073060399 10:100730298-100730320 AAAGAAAGGGAAAATGAGGAAGG - Intergenic
1073167994 10:101474822-101474844 AAAAAGACGGAAAATGGGGAAGG - Intronic
1073340169 10:102738256-102738278 AACGAGGAGGAGGATGTGGAAGG - Exonic
1073552983 10:104420707-104420729 AAAGAGAAAAAGAAAATGGAAGG - Intronic
1073597804 10:104817635-104817657 GGAGAGAAGGAGGAGGTGGAGGG - Intronic
1073775829 10:106784999-106785021 CAAGGGATGAAGAATGTGGATGG - Intronic
1073931115 10:108578232-108578254 AAATAGAAGCAGATTGTGGGTGG + Intergenic
1073963408 10:108960287-108960309 ATAGAGATGGAGAATGTGTTTGG - Intergenic
1074022514 10:109598191-109598213 AAAGAGAAAGAGTTTGTGCAGGG + Intergenic
1074256770 10:111810872-111810894 CAAGAGAAGGAAAAAGTGGGTGG + Intergenic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074610535 10:115016998-115017020 AAAAGGAAGGAGAATGTGGGTGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1075038948 10:119092410-119092432 AAAGGAATGGAGAATGTGGTAGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076035688 10:127196724-127196746 GAAGAGGAGGAGGAGGTGGAAGG + Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076566561 10:131403269-131403291 AAAGGAAAGGAGAATGTGGGAGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1077165874 11:1138047-1138069 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078017212 11:7625241-7625263 AAAGGGTAGGAGCGTGTGGAGGG + Intronic
1078416067 11:11166045-11166067 AAAGAGAAAGAGAAAGTGCAAGG - Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078875480 11:15390965-15390987 AAAGAGGAGGAGAGTGGGGGAGG + Intergenic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1079556309 11:21761874-21761896 AAAGACAAGGAGAAGGGGCAAGG + Intergenic
1079585770 11:22125591-22125613 AAAGAGAAAGAGCTTGTGCAGGG - Intergenic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1080107027 11:28521577-28521599 AAATAGAAAGTGAATCTGGAGGG - Intergenic
1080157409 11:29127919-29127941 AAAGGGAAGGAGAAGGGGAAGGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080921478 11:36713671-36713693 AAAGAAACTGAAAATGTGGAAGG - Intergenic
1081557153 11:44175347-44175369 AAAGAAAGGTAGATTGTGGAGGG - Intronic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082061759 11:47867124-47867146 AAAAAGAAGAAGAATTTGGAAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083040132 11:59677872-59677894 AAAGAGAGGGAGAAAGATGAGGG + Intergenic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1083067469 11:59939707-59939729 GAAGAGAAAGAGAAAGAGGAAGG - Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083148069 11:60773331-60773353 AAAGAGAAGGAGAAAAGGCAGGG - Intronic
1083420139 11:62547688-62547710 GAAGAGAAAGGGAGTGTGGAGGG - Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084390291 11:68871113-68871135 AAAGTTCAGGAGAAGGTGGAAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085806117 11:79637928-79637950 AAAGAGAAGGAGGATGTGCCAGG + Intergenic
1085993058 11:81874916-81874938 AAAGAGAAAGAGAAAGAGAATGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086474473 11:87156297-87156319 AAAAAGAAGAAGAAAGTTGAAGG - Intronic
1086580224 11:88390947-88390969 AAAGAGAAAGAGCTTGTGCAGGG + Intergenic
1086595901 11:88570041-88570063 AAAGAGAAGGGGAAGGGGAAAGG + Intronic
1086899522 11:92350860-92350882 GAAGAAAAGGAGAATGTCAAGGG + Intergenic
1087067831 11:94044125-94044147 AAATAGACCGAGAATGGGGAAGG + Intronic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087140724 11:94763191-94763213 AAAAAGGAGGACAATGTGGAGGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087474491 11:98619413-98619435 AAAGAAAAAGAGCTTGTGGAGGG - Intergenic
1087505365 11:99013734-99013756 AAAGAGAAGGAAAAGGTTGGGGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087692289 11:101335450-101335472 AAAGAAATGGAGCATGTGGTGGG + Intergenic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1087973613 11:104516656-104516678 GAAGAGAAGGAGAAAGATGAGGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088621499 11:111689074-111689096 AAACAGAAGCAGAATGTTGCAGG + Intronic
1088899978 11:114108548-114108570 GCAGGGAAGGGGAATGTGGAGGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089778424 11:120855929-120855951 AAAGAGGAAGAGAAAGAGGAAGG + Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090061151 11:123465157-123465179 GAAGAGAAAGAGACTCTGGATGG + Intergenic
1090128430 11:124115009-124115031 AAAGATAAGGAGATAGTGCAAGG - Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090451471 11:126810101-126810123 AAAGTGAAGGATGATGGGGAGGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090732905 11:129587159-129587181 GAAGAGGAGGTGAATTTGGAGGG - Intergenic
1090785334 11:130043222-130043244 AGAGAGATTGAGTATGTGGAAGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091182079 11:133614426-133614448 AAAGAAAAGAAGAATAGGGAAGG + Intergenic
1091192576 11:133707362-133707384 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1091481732 12:839479-839501 AGAGAGAAGGCCAAAGTGGATGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093502609 12:19829180-19829202 AAAAGGAAGGAGAAAGTAGAAGG + Intergenic
1093993250 12:25613828-25613850 AAAGAGATGGATGATGTGGGAGG + Intronic
1094231166 12:28105030-28105052 AAAGTAAAGGAGACTTTGGATGG + Intergenic
1094256443 12:28433643-28433665 AAAGAGAAGGACAAAGTTGGAGG - Intronic
1094406814 12:30125096-30125118 AAAGATAATGAAAATATGGAAGG + Intergenic
1094754979 12:33457273-33457295 AAAGAGATGGAAAATGTAAAAGG + Intergenic
1095129936 12:38528766-38528788 AAAGAGAGAGAGATTATGGAGGG + Intergenic
1095315781 12:40759459-40759481 AAAGAGAAAGAGAAAGGGAAAGG - Intronic
1095361973 12:41353280-41353302 AAAGAGAGAGAGAAAGTGAATGG - Intronic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1095716975 12:45356717-45356739 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1095900769 12:47325724-47325746 AAAGAGAATGAGAATGAGATAGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096118261 12:49069143-49069165 ACAGAGGATGTGAATGTGGATGG - Intronic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096465540 12:51846353-51846375 AAAGACAGGGACAATGAGGAAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096745588 12:53724864-53724886 CAAGAGAAAGGGAAAGTGGAGGG + Intronic
1096755472 12:53796037-53796059 TAAGTGAGGGAGAATGTGGAAGG + Intergenic
1096766977 12:53899314-53899336 AAAGAGAAGGAAAAAGGAGAAGG + Intergenic
1097216635 12:57419125-57419147 AAAGGAAAGGAGAATATGGATGG - Intronic
1097411959 12:59266434-59266456 TAAGAGAAAGAGAAAGTTGATGG - Intergenic
1097548070 12:61029857-61029879 AAAGAGGAGGAGGAAGAGGAAGG - Intergenic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097816595 12:64081200-64081222 AAAGTAAAAGAGAATGTGGAAGG + Intronic
1097838789 12:64301016-64301038 AGAGAGAGAGAGAATGTGCAGGG - Intronic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098214932 12:68205631-68205653 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1098225705 12:68320610-68320632 AAACAGAAGGATAATTTGGATGG - Intronic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1098752300 12:74309941-74309963 AAAGAGAAGGAGTATTTGGCAGG + Intergenic
1098910282 12:76202107-76202129 AAAGAAAGGGAGAATTTAGAGGG + Intergenic
1099073656 12:78078282-78078304 AAAGAGAATGAGAATGTTATCGG - Intronic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099791848 12:87345650-87345672 AAATAATAGGAGAAAGTGGAGGG + Intergenic
1100003139 12:89861366-89861388 GAAGAGGAGGAGAAAGAGGAGGG + Intergenic
1100262983 12:92950281-92950303 AAAGAAAAGAAGAATGGGTACGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100726821 12:97417615-97417637 AAAGAGAAGAAGAATCTGGGGGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1100915610 12:99417487-99417509 AAAGAGAAGAAAAAAGTGGGAGG - Intronic
1101055307 12:100906373-100906395 TAATAGAAGGAGGATCTGGAAGG + Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1101344501 12:103873690-103873712 AAAAAGAAGGCCAATGTGGCTGG + Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102015774 12:109646963-109646985 AAAGAGAAGGATAAAGGGGTAGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102240002 12:111319303-111319325 AAAGGGAAGGGAAATGAGGAAGG + Intronic
1102695670 12:114797526-114797548 AAAGAAAAAGAGAATTTGGCTGG - Intergenic
1102749535 12:115280399-115280421 AGAGAGATTGAGAGTGTGGAAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103000727 12:117383553-117383575 AAAGCGAAGGAGAAAGTCGAGGG + Intronic
1103018371 12:117513732-117513754 AAAGAGGACGAGAGAGTGGATGG + Intronic
1103149151 12:118622078-118622100 AAAGAGAAAGTGAATCTAGAGGG - Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103667938 12:122585511-122585533 TAACAGAAGGACAATGTCGAGGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103894581 12:124264588-124264610 AAAAAAAAGGAGGAAGTGGATGG - Intronic
1104462474 12:128966710-128966732 AAAGATAATGGGAATCTGGAGGG + Intronic
1104509973 12:129368359-129368381 ACAAGGATGGAGAATGTGGAAGG - Intronic
1104567204 12:129895788-129895810 AAAGGGCAGGAGAATTTGGAGGG - Intronic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104916750 12:132269469-132269491 AAAAAGCAAGAGAAGGTGGAGGG + Intronic
1106161896 13:27208661-27208683 AAAGAGGAGGAGAAAGAGAAAGG + Intergenic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1106243111 13:27925574-27925596 AAAGAGGAGGAGGAAGAGGAGGG - Exonic
1106323057 13:28659789-28659811 AAAAAGAAAGAGAAAGTGGTGGG - Intronic
1106360042 13:29022638-29022660 AATGAGGAGGAAAGTGTGGAAGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1106721029 13:32434664-32434686 AAATAGCAGGAGAATCTGGTTGG - Intronic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1106882998 13:34152215-34152237 AAAGGAACGGAGCATGTGGAAGG + Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1106970174 13:35130242-35130264 AAAGAGAAGGGTAAAGTGGTAGG + Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107088278 13:36448770-36448792 AGAGAGAAAGAGCATGTGAAGGG - Intergenic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107497874 13:40946599-40946621 GAAGAGATGGAGGAAGTGGAAGG - Intronic
1107662212 13:42650424-42650446 GAAGAGGAGGAGGATGGGGAAGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108213135 13:48158367-48158389 AAAGGGAAAGAGCATGTAGAAGG - Intergenic
1108256686 13:48618065-48618087 TAAGAGAAGGAGAATGAAGGGGG + Intergenic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108546223 13:51497434-51497456 AAAGAAAAAGAGAAAGTTGAGGG - Intergenic
1108560807 13:51642150-51642172 AAAGATATGGAAAATGTGAAAGG - Intronic
1108571284 13:51754232-51754254 ACAGAGAAGTAAAATGTGAATGG - Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109241985 13:59900836-59900858 CAAGAGAAGCAGATTATGGAAGG - Intronic
1109607607 13:64717412-64717434 AAAGAGAAGGAGAAGGTCACTGG + Intergenic
1109608876 13:64737389-64737411 AAAGAGAACAAGAAGGTGAAAGG - Intergenic
1109693863 13:65928104-65928126 GAAGAGAAGTTGAATGAGGAGGG + Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1110271337 13:73594237-73594259 AGAGAGAGAGAGAATGTGGCTGG - Intergenic
1110398879 13:75066291-75066313 AAAGAGATGGAGGATGGGCATGG + Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110529289 13:76577746-76577768 AGAGAGAAGGAGGAGGTGCAAGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111134671 13:84025516-84025538 AAAGAGAAAGAGAATGTATCCGG - Intergenic
1111523942 13:89442342-89442364 AGAGAGATGGAGAATGTGAGGGG + Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1111873065 13:93858688-93858710 AAAGAGTATGAGAATGAGAATGG + Intronic
1111925548 13:94459694-94459716 AAAGGGGAGGAGAATGGAGAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112265616 13:97920663-97920685 TAAGAGAGGGAGCATGTGCAGGG - Intergenic
1112359918 13:98708134-98708156 AAAGAGAGGGAGGAAGTGGTGGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112810846 13:103216842-103216864 AAATAGGAGGAGAATGATGAAGG - Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113809142 13:113127050-113127072 AAAGAAATGGGGAATTTGGAAGG + Intronic
1113815185 13:113164692-113164714 AGAAGGAAGGAGGATGTGGACGG - Intronic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114742532 14:25112771-25112793 AAAGGGAAAAAGGATGTGGAAGG - Intergenic
1114863843 14:26562523-26562545 AAAGACAAGGAGAAGGGTGAGGG + Intronic
1115085459 14:29509661-29509683 AAAGTGAAGGACAGTGGGGATGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115111457 14:29828325-29828347 AGAGAGAAGGAGAAGGTGCCAGG + Intronic
1115212722 14:30984004-30984026 GAAGGGAAGGAGAGTGGGGATGG + Intronic
1115267629 14:31517431-31517453 AAAGAGAAGGAAAACAAGGAGGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115752672 14:36506995-36507017 AAAGAAATGGAAAATGGGGAAGG + Intronic
1115906881 14:38210618-38210640 AAAGAGGGGGAGAATGAGAAGGG + Exonic
1116698980 14:48213845-48213867 AAAGAAAAAAAGAATCTGGATGG + Intergenic
1116859303 14:49980911-49980933 GAAGAGAAGGAGGATGACGAAGG + Intergenic
1116917084 14:50535966-50535988 AAAGAGAGGGAGCTTGTGCAGGG - Intronic
1116931220 14:50693393-50693415 AAAGAGAAAGAGCTTGTGCAGGG + Intergenic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1117861367 14:60095593-60095615 AAAAAGAAGGGAAATGTGAAAGG - Intronic
1117899043 14:60514762-60514784 AAAGAGAATGTGAATGGGGCGGG + Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118036623 14:61875421-61875443 AAAGAGATGGACAATTTTGAAGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118203960 14:63704227-63704249 AAAAAGAAGAACAATGTGGAAGG + Intronic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118704345 14:68466640-68466662 AGAGCGAAAGAGAAAGTGGAGGG + Intronic
1118767750 14:68921559-68921581 AAAGAGGAGGAGGAAGAGGAAGG + Intronic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1118863310 14:69682700-69682722 TAAGAGAAAGAGAAAGTGGGAGG + Intronic
1118975991 14:70677105-70677127 GCAGAGAGGGGGAATGTGGAAGG - Intergenic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1119707716 14:76795741-76795763 AAAGAAATGGAAAATTTGGATGG - Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1120020796 14:79527395-79527417 AATGATGAGGAGATTGTGGATGG + Intronic
1120147405 14:80993987-80994009 GAAGAGATGGAGGATGTGCAAGG - Intronic
1120238504 14:81921702-81921724 AAAGAGAAGAATAAAGTGGGAGG + Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120327648 14:83050687-83050709 AAACAGAAGATGATTGTGGAAGG - Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121714738 14:96065566-96065588 AGAGAGAAGGGGAAAGTGGTGGG - Intronic
1121811563 14:96895777-96895799 ACAGAGAATGAGAAAGTGAAAGG + Intronic
1121857144 14:97280644-97280666 AAAAAGAAGAAGAATGTCGATGG + Intergenic
1121895536 14:97643556-97643578 AAAGAGAAAGAGAGTGTGTAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122546517 14:102525748-102525770 AAAGAGAAAGAGAAAAAGGAGGG - Intergenic
1122775797 14:104116592-104116614 AAAGAGAAAGTGAAACTGGAGGG - Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123825784 15:24080917-24080939 AAAGAGAAGGAGAAGAGGAAGGG - Intergenic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124620290 15:31270166-31270188 AAAGAGAAAGAGAGTGAGCAGGG + Intergenic
1124791922 15:32735780-32735802 AAAAAAAAGAAGAATGTGGGAGG + Exonic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125254817 15:37751398-37751420 AAAGAAAAGGAAAAAGAGGAAGG + Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125788432 15:42343610-42343632 AAAGAGCAGAGGAATGTGGGAGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1125911677 15:43445389-43445411 AGAGAGAAGGAGAACTAGGAGGG - Intronic
1126096571 15:45094764-45094786 CAAGAGACAGAGAATGGGGAGGG + Intronic
1126567659 15:50116392-50116414 GAAAAGGAGGAGAAGGTGGAGGG + Intronic
1126650530 15:50916745-50916767 AGAGAGAAAGAGAATGTTAAAGG - Intronic
1126868380 15:52960876-52960898 AAAGAGAAGAACAAAGTAGAAGG - Intergenic
1127303811 15:57682879-57682901 ACAGAGAAGGTGAATCTTGAAGG - Intronic
1127765731 15:62184203-62184225 AAAGAGAAAGAAAATAAGGAAGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128109225 15:65066186-65066208 AAAGAGAAAGAGAAAAAGGAAGG + Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1128533010 15:68467886-68467908 AAAGAGCAATAGAATGTGCAAGG - Intergenic
1128536269 15:68493007-68493029 CAAGAAAAGGAGGATGTGGAGGG + Intergenic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128687722 15:69699247-69699269 AAATAGTATGAGAATGTGGTTGG - Intergenic
1129146045 15:73648458-73648480 AGAGGGATGGAGAAAGTGGAGGG - Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129726385 15:77903749-77903771 ACAGGGAAGGTGAATGTGGGAGG + Intergenic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1129990104 15:79954718-79954740 AAAAAGAGGGAGTATGGGGATGG + Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130356576 15:83137454-83137476 AAACATAAGGGGAATGTAGATGG - Exonic
1130395162 15:83494980-83495002 CAAGGGAAGGAGCATCTGGAAGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131080053 15:89527120-89527142 AAAGAGAAGGATGGTGGGGAGGG + Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1132612875 16:826121-826143 AAAGAGAAAGAGAACTTGGGAGG - Intergenic
1132820502 16:1865585-1865607 AGAGAGAGAGAGAATGTGGGAGG + Intronic
1133175818 16:4013468-4013490 AAAGAGAAGAATAATCAGGAAGG + Intronic
1133276469 16:4641077-4641099 AAAGAAAAGGAGACTGTGAGTGG - Intronic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133490626 16:6264584-6264606 GAAGAGGAAGAGAATGTGGTGGG - Intronic
1133634456 16:7652402-7652424 AATAAGAAGAAGAATGTGGGCGG - Intronic
1134316970 16:13127533-13127555 AAAGAGAAGCGGAACTTGGAAGG + Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1134464242 16:14459180-14459202 CAAGAGAAAGAAAATGTGTATGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135126148 16:19810813-19810835 AAAAAGAAAGAAAATGGGGATGG + Intronic
1135157452 16:20065037-20065059 AAAAAGAAGAAGAATCTAGAGGG - Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135624387 16:23982032-23982054 AAAGGGAAGGGGAAGGTGAAGGG - Intronic
1135667397 16:24347361-24347383 AAAGAGAAAGAGAAAGAGAAGGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135859020 16:26038120-26038142 AATGAGGAGGACCATGTGGATGG - Intronic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1136005552 16:27326669-27326691 AAAGAGAAGGAGAATAAGTGAGG + Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136552331 16:30988325-30988347 AAAGAAAAAGAAAATGTGGAGGG - Exonic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137778121 16:51073500-51073522 AAAGTGGAGGAAAATGTTGAGGG - Intergenic
1137854060 16:51775815-51775837 GAAGAGAAGGAGGAGGTGGGAGG - Intergenic
1137878054 16:52016406-52016428 AAAGAAAAGGAGGATGTTTACGG - Intronic
1138094405 16:54200788-54200810 AAAGAGAAGGAGAGAGTTTAGGG - Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1138928372 16:61619859-61619881 AAAGAGAAGGACTGTGTGGCTGG + Intergenic
1139109491 16:63872218-63872240 AAAAAGAAGAATAATGTGGAGGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1139946386 16:70645155-70645177 GAAGAGAAGGAGGAAGAGGAAGG + Intronic
1140056287 16:71528619-71528641 AAAGAGAGAGAGAATGGGGTTGG - Intronic
1140153146 16:72392903-72392925 AAAGAGAATGAGAAAAAGGATGG + Intergenic
1140203140 16:72910961-72910983 AATGTGAAAGAGAATGTGGCTGG + Intronic
1140223354 16:73059172-73059194 AAAGAAAAGGGGGAGGTGGAGGG + Intronic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1140662916 16:77205063-77205085 AAAGAAAAAGATAATGTGGGAGG + Intronic
1140724440 16:77799333-77799355 AAAGAGATGGAGAAAGTGGGAGG - Intronic
1140761598 16:78113825-78113847 AAATAGAATGAGGATGAGGATGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141261318 16:82456301-82456323 AATGACAAGGATGATGTGGAGGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141711408 16:85701333-85701355 AAAGAAGAAGAAAATGTGGATGG - Intronic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141907754 16:87038712-87038734 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142437279 16:90069062-90069084 AAAAAGAAGGATAAAGTTGAAGG + Intronic
1142943520 17:3404224-3404246 AAAGAGGAGAACAATGTAGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1143992905 17:10981761-10981783 AAAAACAAGGAGATTATGGAGGG + Intergenic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1144002044 17:11064245-11064267 AAAGAGAAGGGGCATATGGATGG + Intergenic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144299879 17:13913233-13913255 CAAGAGAGGGAGCATGTGCAGGG - Intergenic
1144379942 17:14684826-14684848 AAATAGAGGGAGTATGTAGAAGG - Intergenic
1144594485 17:16556636-16556658 GAAGAAAATGAGAATGTGGATGG + Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1145017844 17:19410748-19410770 AGAGAGCAGGAGGATGTGCAGGG + Intergenic
1145221383 17:21092458-21092480 AAAAAGAAGAAGAAGGTGGTGGG - Intergenic
1145911234 17:28544456-28544478 AATGAGGACAAGAATGTGGAAGG - Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146455219 17:33004418-33004440 GAAGAGAAAGAGAAAGGGGAAGG + Intergenic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147134151 17:38425603-38425625 AAAGAGGGGGAGTATGAGGAGGG + Intergenic
1147281470 17:39364619-39364641 AAAGAAAAAAAGAATGTGGCAGG + Intronic
1147749229 17:42718386-42718408 AAAGAGAAGGAAATGGTGGCTGG + Intronic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148492499 17:48032351-48032373 ACTGGGAAGGAGAATGTGAAGGG + Intronic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1148674588 17:49438081-49438103 AAAGTGAAAGAGAGTGTAGAGGG - Intronic
1148806399 17:50266208-50266230 AGAGAAAGGGAGAAAGTGGAAGG - Intergenic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149114175 17:53071794-53071816 AAAGAAAAAGAGAAAGAGGAGGG + Intergenic
1149153068 17:53593256-53593278 AAAGGAAATGAGTATGTGGAAGG - Intergenic
1149351767 17:55796044-55796066 AAACAGAAAGTGAATGAGGATGG + Intronic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149420055 17:56501715-56501737 TAAGAAGAGGAGACTGTGGAAGG + Intronic
1149578304 17:57729247-57729269 GAAGAGAAGGAACAGGTGGAAGG - Intergenic
1149635786 17:58168183-58168205 AAAAAGAAGAAGAAGATGGAGGG - Intergenic
1149928983 17:60731020-60731042 AACGTAAAGGAGAATGTGGGAGG - Intronic
1150023357 17:61644210-61644232 AAAGAGAAGGAGAAAGAGAGAGG - Intergenic
1150115404 17:62544368-62544390 AAAGAGAATGAGAGAGTGAAGGG + Intronic
1150471186 17:65438799-65438821 AAAGAGGAGGATAAAATGGAGGG - Intergenic
1150638756 17:66934953-66934975 AGAGAGAGGGAGCATGTGCAGGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150776663 17:68086888-68086910 AAGGAGAGGGAGAAGGTTGAGGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150833291 17:68542182-68542204 AGAGAGGAGGAGTAAGTGGAGGG + Intronic
1150843071 17:68627663-68627685 AAAGAGAAAGAGAAAGGGAAAGG - Intergenic
1150947801 17:69765923-69765945 AGAGGGAAGGGGATTGTGGAGGG - Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1151988157 17:77557223-77557245 AAAGAGAAAGAGAAAGAGAAGGG - Intergenic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155076765 18:22364250-22364272 GAAGAGGAGGAGGAGGTGGAAGG - Intergenic
1155119629 18:22805070-22805092 AAGGAGAAGGAGCATGTGTAAGG + Intronic
1155124037 18:22853736-22853758 AAAGAAAAAGAAAATGTGGAGGG - Intronic
1155402104 18:25450243-25450265 AAAGAAAAAGAGTATGGGGAAGG + Intergenic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155740759 18:29285105-29285127 ACACAGAATGAGAATTTGGAGGG - Intergenic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1156354007 18:36325680-36325702 AAAGAGAAGGAGAAAGAGAGAGG - Intronic
1156445672 18:37235172-37235194 AAGGACAGGGAGAATTTGGATGG + Intergenic
1156528139 18:37787677-37787699 AAAGGCAAGGAGAATCTGGGTGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156564471 18:38169730-38169752 AAAGAGAAGGAGAAAGTTAAAGG - Intergenic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156618612 18:38820981-38821003 AAAGAGAGAGAGATTGTGCAGGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156748308 18:40419244-40419266 AAAAAAAAAAAGAATGTGGATGG - Intergenic
1156852640 18:41746060-41746082 AAAGAGGAGGGGATAGTGGATGG + Intergenic
1156952417 18:42918855-42918877 AAAGATAAGGTGAATGGTGACGG - Intronic
1156987153 18:43361763-43361785 AAAAAGAAGAAGAATAAGGAGGG + Intergenic
1157150034 18:45207427-45207449 AAAGAGAAAGAGAAAGCGTAGGG + Intergenic
1157269713 18:46263151-46263173 AAAGAGGATGAGGAAGTGGAAGG - Exonic
1157419254 18:47531628-47531650 AAAGAGAAGGAAGATGGGGGTGG + Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157641858 18:49223837-49223859 AAAGTAAAGGACAATGTGTAAGG + Intronic
1158071053 18:53470839-53470861 CAAGAGAAGGACAAAGTGGGAGG - Intronic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1158544229 18:58382089-58382111 AGAGAAAAAGAGAATGTCGAGGG + Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159178603 18:64871544-64871566 AAAGAGGAGGATAATCTTGATGG + Intergenic
1159386355 18:67730215-67730237 AAAGAGAAGAAAATTGTGGTGGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159679800 18:71334991-71335013 ACACAGAAGGAGTAGGTGGAGGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159780527 18:72655788-72655810 AAAGAGATAGAGATTGTGCAAGG - Intergenic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160251684 18:77209063-77209085 AAAGAGAAAGTGAAACTGGAAGG - Intergenic
1160333271 18:78014821-78014843 AAAGAGAAGGGATATGTGGGTGG + Intergenic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160888546 19:1364351-1364373 AAAGATCAGGAGAATCTGAAAGG - Intronic
1160965472 19:1745357-1745379 GAAGAGAAGGGGATTGGGGAGGG - Intergenic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161425775 19:4202249-4202271 AAATAGGAGAAGCATGTGGATGG - Intronic
1161712112 19:5854700-5854722 AAAAAGAAAGGTAATGTGGATGG - Intergenic
1161784212 19:6313089-6313111 AAAGAGAAGGAGAATATATATGG - Intronic
1161785597 19:6323458-6323480 AAAGAGAAAGAGCTTGTGCAGGG - Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163078185 19:14915257-14915279 AATAAGAAGGAAAGTGTGGACGG - Intergenic
1163350964 19:16776965-16776987 GAAGGGAAGGAGAGTGGGGAGGG + Intronic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1163739217 19:19000330-19000352 AAAGAGAGGGAGAATAAGGTGGG - Intronic
1164064843 19:21706906-21706928 AAAGAGAATGAAAATGTGATTGG - Intergenic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164509242 19:28883972-28883994 AAAGAGAAGGAAAGAGAGGAGGG - Intergenic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164932594 19:32186907-32186929 AACGAGAAGGAGAATTGAGATGG - Intergenic
1165168471 19:33873218-33873240 AAATAGAAGGAGAATGACAATGG + Intergenic
1165611853 19:37161591-37161613 GAAGAGGAGGAGAAGGTGGAAGG - Intronic
1165810213 19:38607573-38607595 AAAAAAAAGAAGAAGGTGGAAGG + Intronic
1165821695 19:38680762-38680784 AAAGAGAAGGAGGAAGGTGAGGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166095660 19:40537428-40537450 AGAGAGAATGAGAATGGTGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166301691 19:41914914-41914936 ACAGAGACGGAGATGGTGGAGGG - Intronic
1166502189 19:43350021-43350043 AAAGATAAGGTGAATATGGCCGG + Intergenic
1166507919 19:43383428-43383450 AAAGATAAGGTGAATATGGCCGG - Intergenic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168189725 19:54729317-54729339 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168194006 19:54760255-54760277 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168196052 19:54774990-54775012 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168204420 19:54839253-54839275 ACAGAGACAGAGAAGGTGGAAGG + Intronic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925580955 2:5409979-5410001 ACAGAGACTGAGAATGTGCACGG - Intergenic
925772915 2:7300903-7300925 AAAGAGAAGGAGAATGTTCGAGG - Intergenic
925817166 2:7764725-7764747 AAAGAGAGGGAGCTTGTGCAGGG + Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
926096930 2:10087448-10087470 CAAGAGAAGGAGAATTTGGATGG - Intergenic
926229417 2:10991307-10991329 AAACATAAGGAGACTCTGGAAGG - Intergenic
926377016 2:12240697-12240719 AAAGAGAAGGAACATGGAGAAGG - Intergenic
926404451 2:12536725-12536747 AAAGAGAGGGATAAAGTTGAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927302410 2:21530724-21530746 AAGGAGAAGGAGAAGGCGAAGGG - Intergenic
927307147 2:21586621-21586643 AAAAAAAATGAAAATGTGGACGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927711888 2:25331326-25331348 TATGTGAAGGATAATGTGGAAGG - Intronic
927770011 2:25851900-25851922 AAAAAGAAAGAAAATGTGCATGG + Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928011562 2:27613016-27613038 AAAGAAAAGGGGAATGGGAATGG - Intronic
928060002 2:28102411-28102433 TAAGAGTAGTAGAATTTGGAAGG + Intronic
928226531 2:29453718-29453740 AAAGAGAAAGAAAAAGAGGAAGG + Intronic
928229174 2:29481344-29481366 AAATAGAAGAGCAATGTGGAAGG + Intronic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
928520636 2:32084908-32084930 AAAGGGAAGGAGCATGGGAATGG + Intronic
928746725 2:34424749-34424771 AAAGAGAAGGAGAGAAAGGAGGG + Intergenic
928831155 2:35485388-35485410 AACGAGATGAAGGATGTGGAAGG + Intergenic
929325389 2:40604422-40604444 AAATAGATGGTGAATGTGGCAGG + Intronic
929328977 2:40656418-40656440 AAAGATAAAGAGAATGTGAGAGG + Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930259233 2:49125865-49125887 AAAGACTAGGAAACTGTGGATGG + Intronic
930417559 2:51107953-51107975 AAAGAGATGGAGAATATTTAGGG + Intergenic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
930642337 2:53866360-53866382 AATGAGAAGGACAAAGTGAATGG + Intronic
930880042 2:56260076-56260098 AAAGAGAAGTAGGATCTGAAGGG + Intronic
930923332 2:56784543-56784565 AAAGACAGGGAAAAGGTGGATGG - Intergenic
930969364 2:57376899-57376921 AAAGAGAAGGAAATGGTGCATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931638819 2:64363624-64363646 ACAGAGAAGGAGGAGGTGAAAGG - Intergenic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932857039 2:75245822-75245844 AAAGAGAGGGAAAACGAGGAGGG - Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933332967 2:80918387-80918409 AAAGACAAACAGAATCTGGATGG - Intergenic
933457573 2:82536068-82536090 GGAGAGGAGGAGAATGTGAATGG - Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933798917 2:85944280-85944302 AAAGAGAAATGGAAGGTGGAAGG - Intergenic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934144666 2:89079801-89079823 AAAGACACAGAGAATTTGGAAGG - Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934224587 2:90120750-90120772 AAAGACACAGAGAATTTGGAAGG + Intergenic
934963483 2:98698770-98698792 AAAGAGAAGGTGGATCTGGTAGG - Intronic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
935398582 2:102637019-102637041 AAAGAAAAAGAAAAAGTGGAGGG + Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935508793 2:103944237-103944259 AAACAGAAGGACAAAGTGGGAGG + Intergenic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
935685243 2:105677220-105677242 AAAGAGAAGTTGTATGTGGCCGG - Intergenic
935867583 2:107407629-107407651 GAAGAGAAAGAGAAAGGGGAGGG - Intergenic
936101711 2:109587434-109587456 AGAGAGAAGGTGAAAGTGGGGGG + Intronic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936915597 2:117636475-117636497 AGAGAGAATGAGCATGTGCAGGG - Intergenic
937071485 2:119067089-119067111 AAATAGAAGGAGAAGTTGGTAGG + Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937266486 2:120617947-120617969 AGAGGGAAGGAGAATTTGCATGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937546703 2:123030894-123030916 GAAGAGAAGGAGGAAGAGGAGGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938165240 2:129020310-129020332 AAAGAGAAGGAGCTTGTGCAGGG - Intergenic
938654763 2:133419738-133419760 AAATAGAAGCAGCATGTGGTAGG - Intronic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
938735859 2:134186160-134186182 AAAGAGCAGTTCAATGTGGAAGG + Intronic
939008816 2:136821136-136821158 AAAAAGAAAGCGAATGTGGTAGG + Intronic
939086629 2:137726955-137726977 AAAGAGAAAAATAATGTTGAAGG - Intergenic
939287153 2:140146726-140146748 AAAGAAAAGGAGAGTGTAGAAGG - Intergenic
939364050 2:141209755-141209777 AAAGAAAAGGAGAAAGTTAAGGG + Intronic
939734857 2:145830712-145830734 AAAGGGAAGGTTAATGGGGAAGG + Intergenic
939747039 2:145986231-145986253 AAAGAGAAGGAGAAAAGGAATGG - Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940424042 2:153510787-153510809 AAAGAGACAGAGACTGTGGTTGG + Intergenic
940690513 2:156913907-156913929 AAAAAGAAGAACAATGTTGAAGG - Intergenic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941202095 2:162524719-162524741 AGAGAGAAGAAAAATGTGGTGGG + Intronic
941315450 2:163986400-163986422 AAAGGGAAGGATAAGGAGGAAGG + Intergenic
941475042 2:165940654-165940676 AAAGAGATGGGGAGTGTTGAGGG - Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942486096 2:176441469-176441491 AAAGAGAAGTAGAATAGAGATGG + Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942714826 2:178880395-178880417 AAAAAGAAGGGGAGTGTGAAGGG + Intronic
943199927 2:184809324-184809346 AATGAGTAGGAGAAAGTGAATGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
943404278 2:187460794-187460816 TAAGAACAGGAGACTGTGGAGGG - Intergenic
943418795 2:187639908-187639930 AGAGACAAAGAGAAGGTGGAAGG + Intergenic
943803997 2:192099133-192099155 AAAGGGAAGGAAAATAGGGAAGG - Intronic
943837630 2:192533553-192533575 AAAGAGAAGTGGAATTTGGAAGG - Intergenic
943924215 2:193750800-193750822 GGAGAGAAGGAGAATGGAGAAGG - Intergenic
944118638 2:196216182-196216204 AAAGGGAAAGGGGATGTGGAGGG + Intronic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
945015178 2:205507647-205507669 ACAGGGAAAGAGAATGTAGATGG + Intronic
945150898 2:206790050-206790072 AAATATAACGAAAATGTGGAAGG - Intronic
945208268 2:207355649-207355671 AGAGGGAAGGAGAAAGTGGGAGG - Intergenic
945264938 2:207881772-207881794 AAAGAGTAGGAGAAAGGGAAGGG - Intronic
945347242 2:208732545-208732567 GAAGAGAAGGAGGAAGTGGGTGG + Intronic
945380888 2:209138605-209138627 AAAGAAAAGGAGCCTATGGATGG - Intergenic
945777680 2:214127502-214127524 AAGGAGGAGGAGAGTTTGGAAGG + Intronic
945862921 2:215144401-215144423 AAAGAAGCAGAGAATGTGGAGGG + Intergenic
945863011 2:215145148-215145170 AAAGAGAAGAAGGAAATGGAAGG - Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946088539 2:217198634-217198656 AATTAGAAGGTGAATGTGGGGGG - Intergenic
946145167 2:217725168-217725190 AAATAGAAGAAGCATGTAGAGGG - Intronic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946279601 2:218657275-218657297 AAAGCAAAAGAGAATGTGGTGGG - Intronic
946300031 2:218817380-218817402 AAAAAGAAGGAGAATCTAGAGGG + Intergenic
946413073 2:219525268-219525290 AAAGAGAGGAAGTATGTGAAAGG - Intronic
946479110 2:220036721-220036743 AAAGAGAGGGAGAAATTGGTGGG + Intergenic
946566766 2:220974138-220974160 AAGAAGGAGGGGAATGTGGAGGG + Intergenic
946620357 2:221555296-221555318 AAACAGAAGGAGATTTTGGCTGG + Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946695794 2:222357784-222357806 AAAGAGAAGGTGAAAGAGAAAGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947356342 2:229299951-229299973 AAAGAGTAGGAGAAAGATGAAGG - Intergenic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947755140 2:232557354-232557376 AAGGTGAATGAGACTGTGGAAGG + Intronic
947901107 2:233723002-233723024 GAAGAGGATGAGAAGGTGGAAGG + Intronic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948100242 2:235367227-235367249 AAAGAGCAGGGGAATGTGGTGGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948724537 2:239925242-239925264 AAAAAGAAGAAAAATGTGGGAGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948962045 2:241346955-241346977 AAAGAAAAGGTGAGTGAGGATGG - Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168771135 20:417698-417720 AAAGAGAGGGAGAGTGGGAAGGG - Intronic
1168821015 20:773937-773959 AGAGGGCAGGAGAATGTGGAGGG - Intergenic
1168957761 20:1846490-1846512 AATGGGAAGGAAAAAGTGGATGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169402061 20:5290559-5290581 AAAGACAATGTGACTGTGGATGG + Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170253751 20:14316885-14316907 AAAGAGGAGGAGAAGGTGTGGGG - Intronic
1170309017 20:14972365-14972387 AAAGAGAGTGAGAAAGAGGAAGG - Intronic
1170474880 20:16705080-16705102 AAAGAGAATGAGCTTGTGCAGGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170602448 20:17851191-17851213 GAAGAGGATGAGAAGGTGGAAGG + Intergenic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171011977 20:21513832-21513854 AAAGAGAAAGAAACTGGGGATGG + Exonic
1171076308 20:22128146-22128168 AAAGATAAAGAGAATTTTGAAGG + Intergenic
1171147124 20:22794729-22794751 AAAGAGAAGCTGATTATGGAGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171983079 20:31640536-31640558 TCAGAGCAGGAGACTGTGGAGGG + Intronic
1172171687 20:32939251-32939273 AGAGAGAGAGAGAATATGGAAGG - Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172540012 20:35705312-35705334 ACAGAGAAGAAGAAGTTGGATGG - Exonic
1172779542 20:37427750-37427772 ACAGAGAAGGAGCATGTGTAGGG - Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173040772 20:39460264-39460286 AAAGAGATGGGGCATGGGGAGGG + Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173163917 20:40672620-40672642 AAAAAGAAGAAGAAGGTGGGTGG + Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173662541 20:44744619-44744641 AAAGAGATGGAGCACGTGTAGGG + Intergenic
1173779461 20:45742560-45742582 TTAGAGAAGGACAATGTGAATGG - Intergenic
1174360235 20:50024298-50024320 AAAGAGAAGGAGCCTGTCCAGGG + Intergenic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1174819646 20:53715418-53715440 CTAGACAAGGAGTATGTGGAAGG + Intergenic
1174827745 20:53783855-53783877 AGAAAGAAAAAGAATGTGGAGGG + Intergenic
1174839987 20:53892712-53892734 AAAGAGAAGGGGAAAGGGAAAGG - Intergenic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1175422073 20:58840854-58840876 GAAAACAAGGAGAATCTGGACGG - Intronic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176003480 20:62845772-62845794 GAAGAGCTGGAGAATGGGGAAGG + Intronic
1176017108 20:62939894-62939916 AAAGAGAAAGACAGAGTGGACGG + Intronic
1176413181 21:6459707-6459729 ACAGAGAATGGGAATTTGGAGGG - Intergenic
1176744466 21:10639418-10639440 AAAGAGAAACAGAATGTGCTAGG + Intergenic
1177050052 21:16221762-16221784 AAAGAGAAAGAGAAAGAGAAAGG - Intergenic
1177068812 21:16475552-16475574 CAAGATTAGCAGAATGTGGAAGG - Intergenic
1177249361 21:18572226-18572248 GAAGAGAAGGAGGATGGGAATGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177519663 21:22202989-22203011 AAAGAGAAAGTGAATATGGGTGG - Intergenic
1177748288 21:25248256-25248278 AAAGAGAATGAGAAATTGCAAGG - Intergenic
1177792380 21:25735049-25735071 AAACAGGAGGAGGAAGTGGAGGG + Exonic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179243969 21:39614283-39614305 AAAGAGAAGGAAAAAATGAAAGG - Intronic
1179624684 21:42642153-42642175 AACGAGGAGGAGACTCTGGAAGG - Intergenic
1179688677 21:43068029-43068051 ACAGAGAATGGGAATTTGGAGGG - Intronic
1179944240 21:44660088-44660110 AAAGAGAAAGAGAAAGAGAAGGG + Intronic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182091370 22:27597156-27597178 AGAGAGAAAGAGAAAGTGAATGG - Intergenic
1182159429 22:28106735-28106757 AATGAGAAGGATAATAGGGATGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182799976 22:33024092-33024114 AAAGAGAAGGAGGCTGTGCCCGG - Intronic
1182862166 22:33569651-33569673 AAAGAGGGGGAGAATGTGGATGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1184048803 22:41989336-41989358 AAAGAGAGGCAGAATCTGCAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184537499 22:45097278-45097300 AAAGAGAGAGAGAAGGTGGGGGG - Intergenic
1184652804 22:45926825-45926847 GCCGAGAAGGAGAGTGTGGAGGG + Intronic
1184848077 22:47101426-47101448 AGAGAGACGGAGAAGCTGGAAGG - Intronic
1185160307 22:49222714-49222736 AAAGAGAAGAACAAAGTTGAAGG + Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949378639 3:3419242-3419264 AAAGAGAATCAGAATGTCAAAGG + Intergenic
949431865 3:3985436-3985458 AAACTGAAGGAGCATGGGGAAGG - Intronic
949499484 3:4665646-4665668 AAAGAGACGGAGAATTTTAAAGG - Intronic
949539564 3:5021290-5021312 AAAGAGAAGGAAAAAAAGGAAGG + Intergenic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950479493 3:13235713-13235735 AAAGGGAAGAAGAATGTGATAGG - Intergenic
950539015 3:13599010-13599032 CAAGAGAAGGTGTATGTGGCTGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950856718 3:16112599-16112621 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
950861339 3:16150007-16150029 GAAGAGAATGAGAATGCAGAAGG - Intergenic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951847086 3:27096237-27096259 AAAGAGAAGTATAATGTTGATGG - Intergenic
952460424 3:33519491-33519513 AAAAAGGAGGAGAAAGTGCATGG + Intronic
952708259 3:36401888-36401910 AAAGGGAAGGGGAAAGGGGATGG + Intronic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953188861 3:40664703-40664725 CAAGAGTATGTGAATGTGGAGGG - Intergenic
953263573 3:41363915-41363937 AAAAAGAGAGAGAATTTGGATGG - Intronic
953550453 3:43898472-43898494 AACGTGAGGGAGAATGGGGAGGG + Intergenic
953575790 3:44112227-44112249 AGAGAGGAGGAGAATAGGGAGGG + Intergenic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953778773 3:45846778-45846800 AAAGAGTTGGAGGAGGTGGAAGG + Intronic
953854680 3:46492189-46492211 AGAAAGAAAGAGAGTGTGGAAGG + Intergenic
953860766 3:46542386-46542408 ACAGAGAAGGCTAAGGTGGAAGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954447181 3:50553102-50553124 AAAGAGAAGGTGAAGATGAAGGG + Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954843152 3:53530834-53530856 AAAGAAAAGGAGGATGTGCACGG - Intronic
954940557 3:54368484-54368506 AAAGAGCAGGAGAGTGAGCACGG + Intronic
955033860 3:55247606-55247628 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955484391 3:59420938-59420960 AAAGAGAGGTAGAATGCTGAAGG - Intergenic
955501535 3:59589216-59589238 AAAGAGAGAGAGAATGGGAAAGG - Intergenic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955628310 3:60945064-60945086 AAAGAGATGGAGGATGATGAGGG + Intronic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956310835 3:67877814-67877836 AAAGAGAAGGAGGAGAGGGAGGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956343450 3:68251554-68251576 AAAGTGAAGGAGAAAGAAGAGGG + Intronic
956666652 3:71648810-71648832 AAAGCTAAGGAGAACATGGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957155853 3:76542965-76542987 AAGGAGAATGAGAATGTCGTAGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957957059 3:87201295-87201317 AAAGAGAACGTGAATGATGAGGG - Intergenic
957960399 3:87242872-87242894 AAAAAGAAGTACAAAGTGGAAGG - Intronic
958001745 3:87759453-87759475 AAAGAGAAGAACAAAGTGGGAGG + Intergenic
958065813 3:88543983-88544005 AAAGAGAGAGAGCATGTGCAGGG - Intergenic
958136195 3:89496005-89496027 AAAAAGAAAGAGAATGAGGGAGG - Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
958893024 3:99801346-99801368 AAAGAAATGTAGAATTTGGATGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959327526 3:104956513-104956535 AAAGAGAATGAGAAAGTACAAGG - Intergenic
959598680 3:108154929-108154951 AAAAAGAAGAACAAAGTGGAGGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959655444 3:108799408-108799430 AAAGAAAAGGAGAAAAAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960043206 3:113171065-113171087 AAAGTGAAGAACAATGTGGTGGG + Intergenic
960072557 3:113447517-113447539 AAAGAGAAAAAGAACGTGCAGGG + Intronic
960148574 3:114229281-114229303 AAAGAGATTGAAAATATGGAAGG + Intergenic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960419350 3:117424947-117424969 AAAGAGAGGGAGAATCAAGATGG + Intergenic
960997346 3:123348858-123348880 GAAGGGCAGGAGAATGAGGAGGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961581547 3:127887454-127887476 ACAAAGAAGGAGGATGTGGCTGG + Intergenic
961806734 3:129495033-129495055 ACAGAGCAGGAGAATGTTTAGGG - Intronic
962006377 3:131353945-131353967 AAAGAGAAGGAGAAAGTGTGGGG + Intergenic
962050681 3:131811571-131811593 GGACAGAAGGAAAATGTGGAAGG - Intronic
962177762 3:133172909-133172931 AAAGAGAGAGAGCTTGTGGAGGG - Intronic
962254003 3:133858042-133858064 AAAGATAAGGAGTTTGTGGGAGG - Intronic
962268515 3:133960918-133960940 GGAGAGAAAGAGAGTGTGGAAGG + Intronic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
962466860 3:135668594-135668616 AAAGAGAAGTAGGATCTGAAGGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
963942159 3:151106011-151106033 AAAGAGAAGGAAGAAATGGAGGG - Intronic
964025525 3:152069316-152069338 AAAGAGAAGGATAATATAAAAGG - Intergenic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
964261923 3:154849100-154849122 GAAGAGAAGGGGGATGAGGAAGG + Intergenic
964368394 3:155973162-155973184 AGAGGGAAGGAAAAAGTGGACGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964734086 3:159898566-159898588 AAAGAAAAGAAGAAAGTGGAAGG - Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965028609 3:163334793-163334815 CAAGAGAGAGAGCATGTGGAAGG + Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965597592 3:170423551-170423573 AAAGAGAAAGAGGATTTTGAAGG + Intronic
965641303 3:170831362-170831384 AAAGAGAAAGAGAAATAGGAAGG + Intronic
965724362 3:171698517-171698539 AAAGAAAAGGGGAAAGTGAATGG + Intronic
965795451 3:172434114-172434136 AAAGAGAATGAGTTTGTGCAGGG + Intergenic
965842011 3:172917010-172917032 AAAGAAAAGGAGACTGTGCAAGG - Intronic
966211668 3:177459706-177459728 GAAGAGGAGGAGTATATGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967111744 3:186299686-186299708 AAAAAGGAGGAGGATGTGGGAGG - Intronic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967185401 3:186940346-186940368 AAAGAGAAGTGGAATGAGGGAGG - Intronic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967288705 3:187898531-187898553 ATAAAGAAGGATTATGTGGAGGG + Intergenic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967399108 3:189040968-189040990 AAAGACCAGAAGACTGTGGAGGG - Intronic
967476860 3:189931989-189932011 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
967578794 3:191127159-191127181 AAGGAAAAGAAGAATGTGTATGG - Intergenic
967634510 3:191785283-191785305 AAAGAGAAGGAGCTTGTTCAGGG + Intergenic
967735585 3:192948404-192948426 AGAGAGAAGGAGAAAGTGATGGG - Intergenic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
967938173 3:194746019-194746041 AAACAGAAAGAGAAACTGGAAGG + Intergenic
968135630 3:196217668-196217690 AAAGAGAAAGAGAGAGTGAAAGG + Intronic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969194774 4:5551865-5551887 AAAGAGAAAGAGCATGTGCAGGG - Intronic
969551233 4:7868928-7868950 AAAGAGAAAGAGAAAGAGAAAGG + Intronic
969551235 4:7868934-7868956 AAAGAGAAAGAGAAAGGGAAAGG + Intronic
969551239 4:7868994-7869016 AAAGAGAAAGAGAAAGGGAAAGG + Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970099147 4:12501342-12501364 AAAGAAAAGGAGAAGGGGAAGGG + Intergenic
970698227 4:18703259-18703281 CAAGAGAAAGAAAATGGGGAGGG - Intergenic
970755876 4:19426034-19426056 AAAGAGAATGAGAAAGTATAAGG - Intergenic
970807134 4:20050183-20050205 GAAGAGGTGGAGAAAGTGGAAGG - Intergenic
970912013 4:21287798-21287820 AAAAAGCAGGATAAGGTGGATGG - Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971545555 4:27880851-27880873 AAAAAAAAAAAGAATGTGGAGGG - Intergenic
971669560 4:29539800-29539822 GAAGAGGAGGAAAAAGTGGAGGG + Intergenic
971753452 4:30679265-30679287 AAAGAGAGAGAGCTTGTGGAGGG - Intergenic
971865670 4:32168299-32168321 AAAGAGGAGGAGAAAGAAGAAGG - Intergenic
972004230 4:34078609-34078631 AAAGAGAAGGACTATGTGGATGG + Intergenic
972191655 4:36599882-36599904 AAAAGGAATGAGATTGTGGAGGG + Intergenic
972263133 4:37431268-37431290 AAAGATAAAGAAAATGTAGAAGG + Intronic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973594175 4:52468613-52468635 AAAGAGAAGAAAAATGTTGGAGG - Intergenic
973655607 4:53044575-53044597 AAAGAGAAGGGGAATGGGAAGGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974496159 4:62631195-62631217 AAAGAGAAGGAGAGTGAGACAGG + Intergenic
974520588 4:62976167-62976189 CAACAGAAGGATAATATGGATGG + Intergenic
974555704 4:63445312-63445334 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974733008 4:65894749-65894771 AAACAGAGGTAGAATTTGGAAGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974970521 4:68820127-68820149 AGAGAGTAGGACAATGTAGAAGG + Intronic
975543702 4:75539810-75539832 AAAGAAAAACAGTATGTGGATGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
976520045 4:86016326-86016348 AAAGAGTAGGAGAGACTGGAGGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
976742196 4:88367917-88367939 GAAGAGAGAGAGAATGTGCAGGG + Intergenic
976860710 4:89662701-89662723 TAAGAGAAGGATAAAATGGAAGG + Intergenic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
977275076 4:94967462-94967484 AAAGAGAAGGAGAGAGGAGAGGG - Intronic
977542535 4:98334932-98334954 AAAGAGATGGGGAAGGTAGAAGG + Intronic
977722350 4:100254396-100254418 AAAGGGAAGGAGCATGAGCAGGG + Intergenic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
977919236 4:102625306-102625328 AGAGAGAAAGAGAAAGCGGAGGG - Intergenic
978441925 4:108742522-108742544 AAAGAGAAATGGAATGTGCACGG - Exonic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
978987833 4:115037303-115037325 GAAGAGAAAGAGACTGTAGATGG + Intronic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
979123029 4:116926833-116926855 AATGAGCAGAGGAATGTGGATGG + Intergenic
979203085 4:118002672-118002694 AAGAAGAGGGAGAATGTGCATGG - Intergenic
979222873 4:118248944-118248966 AATGAGAAGGAGAAGCTAGAAGG - Intronic
979235213 4:118392248-118392270 AAAAAGAAAGAGACTGTCGAGGG + Intergenic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
979547314 4:121952181-121952203 GAAGAGAAAGAGAGTGGGGAGGG - Intergenic
980365543 4:131799593-131799615 AAAGAGAGAGAGAAAGTTGAAGG - Intergenic
980423316 4:132592903-132592925 AAAGAGAAAGAGAAAGGGAAGGG + Intergenic
980444331 4:132886294-132886316 CAACAGAAGGACAATATGGACGG + Intergenic
980657146 4:135804016-135804038 AAAGAGAAGGTGGAGGTAGAGGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980855695 4:138436661-138436683 AAAGAGGAGAAGCATGTGGAAGG + Intergenic
981003881 4:139854939-139854961 AAATAGAAGGAGGCTGTGGCGGG - Intronic
981355827 4:143788022-143788044 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981377150 4:144028913-144028935 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
981619339 4:146676369-146676391 GAAGAGAAGAAGAAAGTAGAAGG - Intergenic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
981906777 4:149930031-149930053 AAAGAGGACTAGAAAGTGGAAGG + Intergenic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982536073 4:156607693-156607715 AAAGGGAAGGAAAAACTGGAGGG + Intergenic
982653157 4:158112709-158112731 AAAGAGATTGAGGATGTTGAAGG + Intergenic
982682226 4:158445049-158445071 AATGAGAAGGAGAATATACAGGG + Intronic
982833078 4:160087428-160087450 AAAGAGAAAGAGCTTGTGCAGGG + Intergenic
982849805 4:160298107-160298129 AAAGAGAAAGAGACTATAGATGG - Intergenic
983720456 4:170845250-170845272 GAAGAGAAGGAGAAGGTGTCAGG + Intergenic
983933779 4:173481578-173481600 GAAGAGGTGGAGGATGTGGAGGG - Intergenic
984019713 4:174470298-174470320 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
984177294 4:176435127-176435149 AAAGAGAAGGAAAATATCAATGG - Intergenic
984348852 4:178566258-178566280 AGAGAGAAGGAGAAATTGAAAGG - Intergenic
984404906 4:179315752-179315774 AAAGAGAAGAAAAAAGTTGAAGG - Intergenic
984589925 4:181605948-181605970 GAAGAAAAGGATGATGTGGACGG - Intergenic
984591536 4:181622799-181622821 CCAGAGAAAGGGAATGTGGAAGG - Intergenic
984615152 4:181888877-181888899 AAATAGAACAAAAATGTGGAGGG - Intergenic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
984850693 4:184149992-184150014 AACTAGAAGGATAAGGTGGAGGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985003735 4:185512057-185512079 GAAGAGAAGGAGGATGTTGGGGG + Intronic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986355094 5:6916025-6916047 AAAGAGAAGGGTAATGTTCAAGG + Intergenic
986538192 5:8814771-8814793 AAAGAGAGAGAGAAAGTGAAGGG - Intergenic
986960191 5:13202062-13202084 AAAGAGAGAGAGATTGTGCAGGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987174150 5:15289744-15289766 AAAGAGAAGGATTGTGTGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987517997 5:18939685-18939707 AAAGAGAACAAAATTGTGGATGG + Intergenic
987955078 5:24728748-24728770 AAAGAGAAAGCGAATGAGGGTGG - Intergenic
988046342 5:25960575-25960597 AAAGAAATGGAAAATATGGAAGG + Intergenic
988174005 5:27696795-27696817 AAAGAGAGGGAGAAAAAGGAGGG + Intergenic
988297287 5:29382064-29382086 CAAAAGAAGGAGAATATGGATGG - Intergenic
988647195 5:33107668-33107690 AAAGGTCAGGAGAGTGTGGAGGG + Intergenic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
989546797 5:42683682-42683704 AAAGAAAAGAGGAAGGTGGAAGG + Intronic
989578908 5:43013733-43013755 AAAGAGATTGAAAATGTGAACGG + Intergenic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990026903 5:51203218-51203240 AGAGAGATAGAGAATGTGAAGGG - Intergenic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990210475 5:53478577-53478599 AAAGAGAGGGAGAAAAGGGAGGG + Intergenic
990598776 5:57336651-57336673 AAAAAGGTGGAGAATGGGGAGGG - Intergenic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
990976806 5:61568018-61568040 AAAGAGAAAGAGAAGGGGGGAGG - Intergenic
991137564 5:63199973-63199995 GAAGAAAAGTAGAAGGTGGAGGG - Intergenic
991396021 5:66206215-66206237 AAAGATAAGGAGAATGTTCCAGG + Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992126446 5:73646985-73647007 ACAGAGAAGGACATTGTGGTGGG + Intronic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992750326 5:79855330-79855352 AAGGAGAAAGAGAATGTAGGTGG + Intergenic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
992822642 5:80513426-80513448 AAAAATAGGGAGAATGTGTACGG + Intronic
992929911 5:81632705-81632727 TAAGAGAAGGAGACAGTAGAGGG - Intronic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993175237 5:84475645-84475667 GAAGAGAAGGAAGAAGTGGAAGG + Intergenic
993179918 5:84539510-84539532 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
993261850 5:85667672-85667694 GAAGAGGAGGAGAAAGGGGAGGG - Intergenic
993558981 5:89379956-89379978 ACAGAGAAGGAAAATGTGACAGG + Intergenic
993660885 5:90633273-90633295 AAATAGAAAGAAAATGTAGATGG - Intronic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994221716 5:97204084-97204106 GAAGAAAAGGCCAATGTGGATGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994686368 5:102958405-102958427 AAAGAGAAGGATAATATGGCGGG + Intronic
994736355 5:103561677-103561699 TAAGAGAAAGACAATTTGGAAGG - Intronic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
994857394 5:105141387-105141409 AAAGAGAAAGAGAAAGTGGGTGG + Intergenic
995239153 5:109866038-109866060 AAAGATAAGAAAAATGTGGTAGG + Intronic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995349207 5:111155828-111155850 AAAAAGAAAGAGGATGTGGGTGG - Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996280990 5:121728878-121728900 AAAGAGGGGGAGGATGGGGATGG - Intergenic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996507863 5:124288180-124288202 AAAAAAAAGAAAAATGTGGAGGG - Intergenic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997324338 5:133007579-133007601 AAAGAGAGAGAGACTGTGCAGGG - Intronic
997349061 5:133217158-133217180 AAAGCAAAGAAGAATGTGGCAGG + Intronic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997652174 5:135530590-135530612 AAAGAGAGGGAGTTTGTGCAGGG + Intergenic
997671044 5:135672220-135672242 GAAGAGATGGAGAATGTAAAGGG + Intergenic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
997889826 5:137665851-137665873 AAAGGGAAGGGGAAAGGGGAAGG + Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998234162 5:140383497-140383519 AAAAGGAAGGAGGAAGTGGAGGG + Intergenic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998537806 5:142950982-142951004 AAAGAGAAAGGGAAAGAGGAAGG - Intronic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998745734 5:145258003-145258025 AAAGAGAAAGAGAGAGTGAAGGG - Intergenic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998939349 5:147263764-147263786 AGAGAGAAAGAGAAAATGGAAGG + Intronic
999020712 5:148162931-148162953 AAGGAGGAAGAGATTGTGGAAGG + Intergenic
999104585 5:149059791-149059813 AGAGAGAAGGAGAATGAGATTGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999652443 5:153780780-153780802 GAAGAGATGGTGAGTGTGGAGGG - Intronic
999703430 5:154249495-154249517 AAAGAGTAGGAGAGAATGGAAGG - Intronic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000717982 5:164670256-164670278 AAAAAAAAGGATAATGTGGGAGG - Intergenic
1000957694 5:167562024-167562046 AAAGAGATGGTGAGCGTGGAGGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001442202 5:171751514-171751536 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001442551 5:171755480-171755502 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1001670998 5:173473878-173473900 AAAGAGGAGGAGACTGGGAAAGG + Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001737725 5:174020407-174020429 AAAGAAAAGAAAAATGTGGGGGG - Intergenic
1001879730 5:175233064-175233086 AATGTGAAGGAGAATGGGCACGG + Intergenic
1001920401 5:175595213-175595235 AAAAAGAAGGAAAATATGGCCGG - Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003197314 6:3926261-3926283 AGAAAGCAGGAGGATGTGGAGGG + Intergenic
1003376601 6:5584077-5584099 AAAGAGAGAGAGAATGTCGGGGG - Intronic
1003393219 6:5731270-5731292 GAAGAGAAGGAGGAAGAGGAAGG - Intronic
1003393231 6:5731357-5731379 ACAGAGGAGGAGAGTCTGGAGGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003513464 6:6800406-6800428 AAAGAGAAAGAGAAAGGAGAGGG - Intergenic
1003523595 6:6880001-6880023 TAAGAAAAAGAAAATGTGGATGG + Intergenic
1003528474 6:6917993-6918015 AAGCAGAGGGAGAATTTGGAAGG + Intergenic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004255504 6:14059887-14059909 ACAGAGAATGAGAAAGTGGTAGG + Intergenic
1004417577 6:15438701-15438723 AGATAGAAGGATACTGTGGAGGG - Intronic
1004542282 6:16562403-16562425 AGAAAGAAGGGGAATGGGGAAGG + Intronic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1005219114 6:23565846-23565868 AAAGAGAAGGAGAGTAATGAAGG - Intergenic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005495266 6:26382828-26382850 AAAGAAAAAGAGAATGAGAAAGG + Intergenic
1005835965 6:29709901-29709923 AAAAAGCAGGAGAAGGTGTATGG + Intergenic
1005847025 6:29789892-29789914 AAAGGTAAGGAGAATGTCCATGG + Intergenic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006290827 6:33135235-33135257 AAAGAGAGAGAGAGAGTGGAAGG - Intergenic
1006334250 6:33412178-33412200 AAAGAAAAAGAAAATGGGGAAGG + Intronic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006932900 6:37698153-37698175 AAAGAGAAAGAGAAAGAGAAAGG - Intronic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007151934 6:39702173-39702195 AGAGAGAATGAGAGTCTGGAAGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007446149 6:41907641-41907663 AAAGAGAAGGAAAATGTGTGTGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007630276 6:43269617-43269639 AAAGAGACCAAGAAAGTGGAGGG - Intronic
1007667343 6:43522955-43522977 AAAGACCATGAGATTGTGGAAGG + Exonic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1008859800 6:56134771-56134793 AAAGAGAAAGAGCTTGTGCAGGG - Intronic
1008888419 6:56456893-56456915 AAAGAGAAGGAATGTGTGTAGGG + Intergenic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009193674 6:60659940-60659962 AAAAAAAAGGAGAATATGTAGGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009671258 6:66753889-66753911 AAAGAGAGAGAGAATGAGGGAGG + Intergenic
1009884467 6:69608717-69608739 AAAAACAAAGAGAATGTAGAAGG + Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010114908 6:72292604-72292626 AAAGAGAGAGAGAATGTATACGG + Intronic
1010548861 6:77194486-77194508 AGAGAGAAGGAGAATGTTTCAGG - Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010731364 6:79394928-79394950 AAAGTGAGGGAGAATGTGGATGG + Intergenic
1010766182 6:79778937-79778959 AATGAGAAGGAGAATATGAAGGG + Intergenic
1010801191 6:80177481-80177503 AAAGAGAGGTTGAATGTAGAGGG + Intronic
1011151100 6:84274194-84274216 AAAGAGAACGAGAATGGGATTGG + Intergenic
1011568658 6:88708876-88708898 AGAGAAAAGGAGAATCTGAAAGG + Intronic
1011629321 6:89309237-89309259 ATAGGGCAGGACAATGTGGAAGG - Intronic
1011747324 6:90418881-90418903 AAAGAGATCAAGAATATGGAAGG - Intergenic
1011817998 6:91214772-91214794 ACACAGAAGGAAACTGTGGAAGG + Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012011029 6:93785707-93785729 AAAGGGAAGGAGAGAGGGGATGG - Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012066915 6:94559658-94559680 TAAGATAACGAAAATGTGGAGGG + Intergenic
1012118296 6:95332930-95332952 AAAGAGAAGGAGTAAGATGAGGG + Intergenic
1012380883 6:98617638-98617660 AAAGAGAAAGAGCTTGTGCAGGG + Intergenic
1012447281 6:99319490-99319512 AAACAGCAGGCAAATGTGGAGGG - Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013089255 6:106884656-106884678 AAAGAGAGAGAGATTTTGGAAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013815251 6:114090224-114090246 ACACAGACGGAGAATGTGTAAGG - Intronic
1013918288 6:115367682-115367704 AAAGAGAAAGAGCTTGTGCAGGG - Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014175940 6:118331284-118331306 CTAGAGAACGAGAATGTGGGTGG + Intergenic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014344799 6:120254614-120254636 AAAGAGGAGGAGATGGGGGAGGG + Intergenic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014595470 6:123332176-123332198 TAAGAGAATGAGTATTTGGATGG + Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1014824314 6:126031545-126031567 AAAGAGATGGGGAATTTGGTTGG + Intronic
1014980649 6:127942682-127942704 AAAGAGAGAGAGCTTGTGGAGGG + Intergenic
1014990868 6:128074760-128074782 TAACAGAAGGACAATGTGGTTGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015207338 6:130654985-130655007 AATGAGAAAGAGCGTGTGGAAGG + Intergenic
1015217018 6:130762026-130762048 AAAGAGAGAGAGACTGTGCAGGG + Intergenic
1015220443 6:130798588-130798610 AGAAAGAAGAAGAATGTTGAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015521885 6:134139899-134139921 GAAGAGAAGGAGGAAGAGGAAGG - Intergenic
1015682312 6:135822051-135822073 AAAAAAAAGGAGAAAGTGTAGGG - Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016477230 6:144440902-144440924 AAAGAGAGGGAGCTTGTGCAGGG + Intronic
1017107188 6:150898758-150898780 AAAGAGAATGTGTATGTAGATGG - Intronic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017825096 6:158075920-158075942 AAAGAAAAGAAGGATGTGCATGG + Intronic
1017931952 6:158963490-158963512 AAAGAGAAAGAGACTGGGAAGGG - Intergenic
1018190610 6:161306424-161306446 AACGGGAAGGAGAAAATGGAGGG + Intergenic
1018525924 6:164710032-164710054 CAAAGGCAGGAGAATGTGGAAGG - Intergenic
1019007697 6:168815561-168815583 AGAAACAAGGAGAATGTGGATGG - Intergenic
1019092268 6:169548603-169548625 AAAGAGAAGAACAAAGTTGAAGG + Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020050798 7:5080370-5080392 AAAAAGAAAAAAAATGTGGAGGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020156468 7:5728594-5728616 AAAGAAAAAGAAAAGGTGGAAGG + Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020356749 7:7285039-7285061 TAACAGAAGGAAAATCTGGAAGG + Intergenic
1020405235 7:7825507-7825529 AAAGAGAAAGAGCTTGTGCAGGG + Intronic
1020593560 7:10174082-10174104 AAAAAGAAGAAGAAAGTTGAAGG - Intergenic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1021040934 7:15861165-15861187 AAAGACACGGAGGAAGTGGAAGG + Intergenic
1021079744 7:16349724-16349746 AAAGAGAATGAGAAAGAGTACGG + Intronic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021280147 7:18707121-18707143 AAAGAGAGGGAGGAACTGGAAGG + Intronic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1021292349 7:18862260-18862282 CAAGAGAAAGAGAATGTGAAGGG + Intronic
1021521066 7:21539514-21539536 CAAGAGAAGGAAAAGGTGAATGG + Intergenic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1021761667 7:23908209-23908231 TAAGCTAAGGAGAATGTAGAAGG + Intergenic
1021857091 7:24867558-24867580 AAAGAGAAAGAGTTTGTGCAGGG - Intronic
1021920399 7:25479332-25479354 AACGAGAAGGAGATTGTTGTGGG + Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022203465 7:28139969-28139991 AAAGAGACGGAGGTTGGGGAGGG + Intronic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022290835 7:29000987-29001009 AAGGAGAAGGCTAATTTGGAAGG + Intronic
1022395615 7:29985762-29985784 GGAGAGAAGGAGTATGTGGTGGG - Intronic
1022448738 7:30493909-30493931 AAAGAGAAGAAGACTCTGAAAGG - Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023447212 7:40244269-40244291 AAAGATAGATAGAATGTGGATGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024196426 7:47063890-47063912 GAAGAGGAGGAGGAGGTGGAGGG - Intergenic
1024368927 7:48558206-48558228 AAAGGGAAAGAGAAAGTGAAAGG - Intronic
1024424627 7:49211726-49211748 AAAGAGAAAGAGCTTGTGCAAGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024586966 7:50850215-50850237 GGAGAGGGGGAGAATGTGGAAGG - Intergenic
1025928070 7:65974852-65974874 ACAGGGAAGGCGAAAGTGGAGGG + Intronic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026415314 7:70173379-70173401 AGAGAGAAAGAAAATGTTGACGG + Intronic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1027173824 7:75890743-75890765 AAAGAGAGGGGGGCTGTGGAGGG + Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027394529 7:77740961-77740983 AAAGAAAAGAAAAATGTTGATGG - Intronic
1027644843 7:80785027-80785049 AAAGAAAAGGAAAAAATGGAGGG - Intronic
1027957308 7:84897223-84897245 GAAGAGAAGGAAAAGGTGAATGG + Intergenic
1028057961 7:86272178-86272200 AAAGCGAAAGTGAATGAGGAAGG - Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028246745 7:88488397-88488419 AAAGAAGAGGAGAATGAGAAAGG - Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028311182 7:89338522-89338544 AAAGAGAAAGAAAGGGTGGAGGG + Intergenic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028721942 7:94043054-94043076 AAGGAGAAGAAGAATTTGCAGGG - Intergenic
1028920639 7:96306711-96306733 AAAGAGAAGATGGAAGTGGATGG - Intronic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030666518 7:112284855-112284877 AAAGAAATGGAGAATGTACAGGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030781876 7:113610836-113610858 AAAGAAAAGGAAAATATTGATGG - Intergenic
1030828026 7:114185986-114186008 AAAGAGAAAGAGAAAAAGGAGGG + Intronic
1030930203 7:115513341-115513363 AGAGAGAAGGAGAAGATAGAAGG - Intergenic
1030977776 7:116148180-116148202 AAACAGGAGGCCAATGTGGATGG + Intronic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031307262 7:120145804-120145826 AGAGAGATGGAAAATGTGGCAGG - Intergenic
1031524270 7:122805594-122805616 AAAGAGAAGGCAATTTTGGAAGG - Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031546534 7:123057084-123057106 AGAGAAAAGGAGAAAGTGCAGGG + Intergenic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031769418 7:125824357-125824379 AGAGAGCAGGAGACGGTGGAGGG + Intergenic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1031844665 7:126790765-126790787 CAAGTGAAGGTGAATGAGGAAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031912485 7:127532730-127532752 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1031917837 7:127579650-127579672 AGATGGACGGAGAATGTGGAGGG - Intergenic
1032280181 7:130493560-130493582 TAAGAGGAGGAGGGTGTGGAGGG + Intronic
1032355953 7:131210719-131210741 AAAGAGAGAGAGAAAGGGGAAGG + Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1032930480 7:136662489-136662511 AGAGAGAAGGAGAATGTCCCAGG - Intergenic
1032988198 7:137361979-137362001 AAAAGGAAGGAAAATGGGGAGGG - Intergenic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033804333 7:144937440-144937462 AAAGGGAAGGAGAAAGGGAAGGG - Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034001022 7:147413388-147413410 AAGGAAAATGAGAATGTGGTAGG + Intronic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034171045 7:149063416-149063438 CAGGAGTAGGAGAATCTGGATGG - Intergenic
1034189057 7:149199655-149199677 AAAGAGAAGGGGAAAAGGGAGGG - Intronic
1034279201 7:149839874-149839896 AAAGAGAAGCAAAATGTAGGGGG + Intronic
1034319797 7:150169401-150169423 AAAAAGAAGAAGAAGATGGAGGG + Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034550746 7:151819107-151819129 AAAGAGACAGAGAATCTGGCCGG + Intronic
1034772954 7:153797825-153797847 AAAAAGAAGAAGAAGATGGAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035268205 7:157703867-157703889 ACAGGGAAAGAGAAAGTGGAGGG - Intronic
1036061838 8:5331520-5331542 AAAGAGAAAGAGAAAGAGAAAGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036544108 8:9749802-9749824 AAAGAGAAGGATAATTCAGAGGG - Intronic
1036563289 8:9916237-9916259 AAAGAGAAGGAGAAATAGAAAGG + Intergenic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1036960023 8:13234182-13234204 AAATACAGGGAAAATGTGGAGGG + Intronic
1036960095 8:13235365-13235387 AAATACAAGGAAAATGTGGAGGG + Intronic
1037061928 8:14523779-14523801 AAAGGAAAGAAGAAAGTGGATGG - Intronic
1037139290 8:15500714-15500736 AAAGAGAAAGAGAATGTGACAGG + Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037220144 8:16509279-16509301 CAAGAGAAATGGAATGTGGATGG + Intronic
1037326609 8:17697711-17697733 AAAGGGGAGGAGAAAGTGGGTGG + Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1037843409 8:22261753-22261775 AAAGAGAATGGGGAGGTGGACGG + Intergenic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038271514 8:26079546-26079568 AAAGACCAGGAGGATGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039799902 8:40944988-40945010 AAGGAGAAGGAGAACGTAAAGGG - Intergenic
1039947747 8:42144509-42144531 CAGGAGGAGGAGATTGTGGATGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040569898 8:48598975-48598997 ACAGAGTAGGAAAATGTGGGGGG - Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1040677420 8:49766891-49766913 CAAGAGAGAGAGAATGTGGGTGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040819212 8:51536509-51536531 AAAGCAAAAGAGAATGGGGAGGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1041307732 8:56480145-56480167 AAAGAGAAGAACAATAAGGACGG - Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041321246 8:56615145-56615167 AAAGAGAAAGAGGAAGGGGAAGG - Intergenic
1041500512 8:58534239-58534261 AAAGGGAAGGAGACAGTGAAGGG - Intergenic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1041751550 8:61266276-61266298 AAAAAGAAAGAAAATTTGGAGGG - Intronic
1042599269 8:70481995-70482017 AGAGAGAAGGGTAATGTGGAAGG - Intergenic
1042816555 8:72883654-72883676 AAAGAGAATGGGATTGGGGAGGG - Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042905651 8:73769175-73769197 AGAGAGAGAGAGAATGTGTATGG - Intronic
1042934694 8:74046886-74046908 AAAAAGAATGAGAATGAGAATGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043197370 8:77313916-77313938 AAAGAGGAGGAGAAAGTAGTAGG - Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043636523 8:82391018-82391040 GAAGAGGAGGAGAGTGAGGAGGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044319486 8:90786455-90786477 AAAGAGAACAAGAATGGGAAGGG + Intronic
1044728540 8:95212461-95212483 AAGGAGAAGGAGAAGGTGATGGG + Intergenic
1044792071 8:95857972-95857994 AGAGATAAGGAAAATGTAGAAGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044805621 8:96005555-96005577 GAAGGGAAGGAGAAGGTAGATGG + Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045073668 8:98539103-98539125 CAAGGGTAGGAGAATGTGTAGGG - Intronic
1045428663 8:102092651-102092673 AAAGGGAAGGTCAATGTGGGAGG - Intronic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045840312 8:106572132-106572154 AAAGAGAAGGATGATATTGAAGG - Intronic
1045963467 8:107996526-107996548 AAATAAAAGGAGATTCTGGAAGG + Intronic
1046001914 8:108431884-108431906 AAAGAGAAAAAAAATGTGAATGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046130490 8:109961856-109961878 AAAGAGAAGGAAACTATTGAAGG - Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046476603 8:114752674-114752696 AAAGGGAAGGGAAATGTGTAGGG + Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046732057 8:117736502-117736524 GAAGAGGAGGAGAATGAAGATGG + Intergenic
1046786179 8:118269169-118269191 AAAGCAAAGAAGAATGTGAAAGG - Intronic
1046901890 8:119532782-119532804 AAAGTGAAGGAGAAAATGGTTGG + Intergenic
1047124436 8:121944728-121944750 AAATAGAAGGACAATTTTGAGGG - Intergenic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047244651 8:123130472-123130494 AAAGAGAATGAGAAAGCTGAGGG - Intronic
1047468879 8:125147645-125147667 AAAGAGTGGGAGAATTTTGATGG + Intronic
1047692971 8:127375218-127375240 AAAGAGAAGGAAGATGTGAAGGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048766363 8:137848630-137848652 AAAGAGAAGGATATTGGGGCCGG + Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049048173 8:140169541-140169563 AAACAGAATGCGGATGTGGAAGG + Intronic
1049154401 8:141058113-141058135 AAACAGAAGGGGACTGTGGGCGG - Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049361149 8:142213075-142213097 AAAGAGAGGGAGAGTGAGGGAGG - Intronic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049905427 9:212385-212407 AAAGATACGGAGAAAGAGGAAGG + Intergenic
1050307020 9:4315046-4315068 GAAGAGCAGGAGAGAGTGGAAGG - Intronic
1050421116 9:5466214-5466236 ATAGGGAAGTAGAATATGGAAGG + Intronic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051100152 9:13512325-13512347 GGAGAGAAGGATCATGTGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051480417 9:17554036-17554058 AAAGAGAGAGAGAAAGGGGAGGG - Intergenic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1052092989 9:24352811-24352833 AAAGAGAAGGAGCAAGCTGAGGG - Intergenic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052809961 9:33049173-33049195 AAAGAGAAGGACAAAGTTGGAGG + Intronic
1052889128 9:33680793-33680815 TAAAAGTAGAAGAATGTGGAAGG + Intergenic
1052988956 9:34507523-34507545 GAAGAGGAGGAGAAAGAGGAGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1054820280 9:69515227-69515249 AGAAAGAATGGGAATGTGGAGGG - Intronic
1055252301 9:74322493-74322515 AAAAAAAAAGAAAATGTGGAAGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1055778435 9:79792226-79792248 AAATAGAAAGACAAGGTGGAGGG - Intergenic
1055863212 9:80779971-80779993 AAAAAGAAGAAAAATGTGGGAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056512752 9:87321267-87321289 AAAGAGAAGGAGCTTGTTTAAGG - Intergenic
1056546840 9:87620548-87620570 GAAGAGAAGGAGTAGGGGGAGGG + Intronic
1056638267 9:88348910-88348932 AAAGAGAAGGAAAAGGTAGCGGG - Intergenic
1056707661 9:88965822-88965844 AAAGGGAAGGGGAGTGGGGAGGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057937664 9:99254237-99254259 AACTAGGAGGAGAATGGGGAGGG - Intergenic
1058167717 9:101638990-101639012 AATGAGATGACGAATGTGGAGGG - Intronic
1058193929 9:101951562-101951584 AAACAGAAGGTGATTGTGAAAGG - Intergenic
1058344562 9:103945645-103945667 AAAGAAAAGGAGAAGGTCGTAGG - Intergenic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058817537 9:108698933-108698955 GAAGAGAAGGTGGATGGGGAGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059524397 9:114976952-114976974 AAAAAGAAGGAAAATGTGTGTGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059933277 9:119282697-119282719 AAAGAGAAAGGGATTCTGGAAGG + Intronic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060517942 9:124277483-124277505 AAAGGGTAGGAGAAGGTGGTGGG - Intronic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1060631221 9:125160534-125160556 AAAGAGAGAGAGACTGTGCAGGG - Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061751871 9:132784148-132784170 AAAGAGAAAGAGAAGGGGGTAGG + Intronic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062182053 9:135196182-135196204 AGAGAGAAGGGGAATGTGAAGGG - Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203490551 Un_GL000224v1:100867-100889 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1203503174 Un_KI270741v1:42746-42768 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1185928257 X:4171357-4171379 AAAGAGAAAGAGCTTGTGCAGGG + Intergenic
1186017836 X:5218111-5218133 AAAGGGAAGGATAAAGAGGAAGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186424837 X:9455694-9455716 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186518722 X:10186620-10186642 AAGGAGGAGGGGAATGTGTAGGG + Intronic
1186664057 X:11700593-11700615 AATGACAAGGTGAATGTGGCTGG - Intergenic
1186683507 X:11900410-11900432 GAAGAGAAGGAGCATGGGTAGGG + Intergenic
1186753223 X:12643092-12643114 AAAGAGAAGGAGCCATTGGAGGG + Intronic
1186952708 X:14645016-14645038 AATGTGAAGAAGAATTTGGATGG + Intronic
1187052616 X:15709633-15709655 AAAGAGAAAGAAATTGTGGGCGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187540553 X:20189165-20189187 AAAAACAAGGAGTATGGGGAAGG - Intronic
1187667246 X:21627635-21627657 AAAGAGAGAGAGCTTGTGGAGGG + Intronic
1187742078 X:22366646-22366668 AAAGAGAAGGGGGAGATGGAGGG + Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1187867042 X:23732708-23732730 AAAGAGAAAGACAATATGGGAGG + Intronic
1187944388 X:24412146-24412168 AAAGAGCAGGGGAATGAAGAAGG - Intergenic
1188303625 X:28535317-28535339 GAAGAGGAGGAGGAAGTGGAAGG - Intergenic
1188411775 X:29881510-29881532 AAAGAGAAGGAGAATAGTAAAGG - Intronic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190735767 X:53255249-53255271 AAAGAGAATGAGAAAGGAGAAGG + Intronic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191579281 X:62742495-62742517 AAAGAAAAGGAGGATATGTAGGG + Intergenic
1192619551 X:72663938-72663960 AAAGAGAAAGAGAAAGAGAAAGG + Intronic
1192732772 X:73817844-73817866 AAATAGAAGAAGAATGTCAAAGG - Intergenic
1192778692 X:74271792-74271814 AGAGAGAAAGATAATGTAGAAGG + Intergenic
1192797187 X:74433638-74433660 AAAGTGGAGGATAAGGTGGATGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193145900 X:78075208-78075230 AAAGAGAATGAAAAGGGGGAAGG + Intronic
1193221096 X:78928170-78928192 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
1193500496 X:82268094-82268116 AAAGATAAGGAGAGTTTTGAAGG + Intergenic
1193570461 X:83135465-83135487 AAAGACATAGAGAATGTGGAAGG + Intergenic
1193588198 X:83353661-83353683 AAAAAGGAGGAGAATGAGAATGG + Intergenic
1193739367 X:85199443-85199465 AAAGAAAAGCAGTATATGGAAGG + Intergenic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1194205424 X:91005824-91005846 AAAGAGAGAGAAAATGTGAAAGG - Intergenic
1194877842 X:99211195-99211217 ACTGAGAATGAGAATATGGAAGG - Intergenic
1194896585 X:99448964-99448986 AAAGACAATGAAAATTTGGAAGG + Intergenic
1195462121 X:105139356-105139378 AAAAGGGGGGAGAATGTGGAAGG + Intronic
1195589466 X:106607771-106607793 AAATAGAAGTAGGATTTGGATGG + Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1195881788 X:109600619-109600641 CAAGAGGATGAGAATCTGGAGGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196091787 X:111751957-111751979 AAAGAGAAGGGCAATGAGCAAGG - Intronic
1196116234 X:112002480-112002502 AAAGAGCAGGAGTATGTGTTTGG - Intronic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1196230827 X:113219060-113219082 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197040939 X:121934153-121934175 AGAGAGAAGGTGGAAGTGGATGG - Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197359493 X:125482466-125482488 AAAGATAGGAAGCATGTGGATGG + Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197979237 X:132198292-132198314 AAAGTGAAGGATAGTTTGGAGGG - Intergenic
1198084704 X:133271018-133271040 TAAGAGATGGAAAATGTTGATGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198162998 X:134026073-134026095 AAAAAGAAGGCGAATGTGGGTGG + Intergenic
1198264245 X:134994722-134994744 AAAGAGAAAAAGAAATTGGAAGG + Intergenic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1198466738 X:136910204-136910226 AAAGAGAAGGAGATGGGAGAGGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200087444 X:153614660-153614682 AGAGAGAAGGAGGAGGTGGGTGG - Intergenic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200255876 X:154582590-154582612 AAGGAGAAAGAGAAAGTGAAGGG - Intergenic
1200261893 X:154621813-154621835 AAGGAGAAAGAGAAAGTGAAGGG + Intergenic
1200287906 X:154841661-154841683 AAAAAGAAGGAAAATATGTAAGG - Intronic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1200944904 Y:8825018-8825040 GAAGAGAAAGACAGTGTGGAAGG - Intergenic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201271077 Y:12254134-12254156 GAAGAGAAGGAAAAGGTGGGAGG + Intergenic
1202025187 Y:20514422-20514444 AAAGAAATAGAGAATGTGGAAGG + Intergenic