ID: 1187257450

View in Genome Browser
Species Human (GRCh38)
Location X:17655754-17655776
Sequence CCCGGCACCTGATTTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187257445_1187257450 -10 Left 1187257445 X:17655741-17655763 CCCGCCCAGGTCTCCCGGCACCT No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data
1187257441_1187257450 3 Left 1187257441 X:17655728-17655750 CCCAGGGCTACGTCCCGCCCAGG No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data
1187257438_1187257450 14 Left 1187257438 X:17655717-17655739 CCCAGCGTGGCCCCAGGGCTACG No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data
1187257440_1187257450 4 Left 1187257440 X:17655727-17655749 CCCCAGGGCTACGTCCCGCCCAG No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data
1187257443_1187257450 2 Left 1187257443 X:17655729-17655751 CCAGGGCTACGTCCCGCCCAGGT No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data
1187257439_1187257450 13 Left 1187257439 X:17655718-17655740 CCAGCGTGGCCCCAGGGCTACGT No data
Right 1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187257450 Original CRISPR CCCGGCACCTGATTTCCCAG TGG Intronic