ID: 1187257919

View in Genome Browser
Species Human (GRCh38)
Location X:17657995-17658017
Sequence GGCGCCAGCCTGTCTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187257908_1187257919 22 Left 1187257908 X:17657950-17657972 CCTGGACAGTTGGGTGAGGAGCC No data
Right 1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG No data
1187257906_1187257919 24 Left 1187257906 X:17657948-17657970 CCCCTGGACAGTTGGGTGAGGAG No data
Right 1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG No data
1187257915_1187257919 -5 Left 1187257915 X:17657977-17657999 CCTGGTCAGCAGGAGGGTGGCGC No data
Right 1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG No data
1187257912_1187257919 1 Left 1187257912 X:17657971-17657993 CCTCTTCCTGGTCAGCAGGAGGG No data
Right 1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG No data
1187257907_1187257919 23 Left 1187257907 X:17657949-17657971 CCCTGGACAGTTGGGTGAGGAGC No data
Right 1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187257919 Original CRISPR GGCGCCAGCCTGTCTGAAGG GGG Intronic