ID: 1187258608

View in Genome Browser
Species Human (GRCh38)
Location X:17664295-17664317
Sequence ATTTTCTTCTAGGAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187258606_1187258608 5 Left 1187258606 X:17664267-17664289 CCTCAAGTTCATGAATATTATTT 0: 1
1: 0
2: 2
3: 50
4: 462
Right 1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498
1187258605_1187258608 6 Left 1187258605 X:17664266-17664288 CCCTCAAGTTCATGAATATTATT 0: 1
1: 0
2: 4
3: 41
4: 448
Right 1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187258608 Original CRISPR ATTTTCTTCTAGGAGTTTTA TGG Intronic
Too many off-targets to display for this crispr