ID: 1187260579

View in Genome Browser
Species Human (GRCh38)
Location X:17682023-17682045
Sequence CTGGCTTTGGGCTGCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187260573_1187260579 8 Left 1187260573 X:17681992-17682014 CCCAGCAAGGAAAGACTCTGGGA 0: 1
1: 0
2: 2
3: 40
4: 254
Right 1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG 0: 1
1: 0
2: 2
3: 42
4: 343
1187260574_1187260579 7 Left 1187260574 X:17681993-17682015 CCAGCAAGGAAAGACTCTGGGAA 0: 1
1: 0
2: 2
3: 38
4: 261
Right 1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG 0: 1
1: 0
2: 2
3: 42
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187260579 Original CRISPR CTGGCTTTGGGCTGCTCTGC AGG Intronic
900004580 1:36250-36272 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
900024302 1:206766-206788 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
900487683 1:2931183-2931205 CTGGCTTTGGGCTCCTGCACGGG + Intergenic
900656737 1:3762382-3762404 CTTGCTGGGGGCTGCTCTGGGGG + Intronic
901742371 1:11350692-11350714 CTGGCTTCGGGCTGCCCTGTTGG + Intergenic
902393149 1:16117910-16117932 CTGGCTTTGGCCTGTTGTCCTGG - Intergenic
902687096 1:18085276-18085298 CTGGCTCTGGGTTTCTCTCCAGG + Intergenic
903261978 1:22136433-22136455 CTGGCTCTGGACAGTTCTGCTGG - Intronic
904775107 1:32901479-32901501 CGGGCCATGGGCTGCTCAGCCGG - Intergenic
905042734 1:34973587-34973609 CTGGCCTTGGGCTGAGATGCTGG + Intergenic
905927274 1:41760393-41760415 CTGTCTCTGGGCTTCTCTGCTGG + Intronic
906668976 1:47641201-47641223 CTGGCTTTGGACTGCTGGGGGGG + Intergenic
908179485 1:61589614-61589636 ACGGCTTTGGCCTGCACTGCAGG - Intergenic
908225182 1:62048868-62048890 TTGGTTTTGGGATGCTCAGCTGG + Intronic
910803821 1:91170875-91170897 CTGGCTTTGGACAGCGCTTCAGG - Intergenic
911104679 1:94120596-94120618 TTGCCTTTGGCCTGCTCTTCAGG + Intronic
911445191 1:97983911-97983933 CTGGCTTTGGGTTACACAGCTGG - Intergenic
912843178 1:113057377-113057399 CTGGATTTGGGTTGCTCGGAAGG + Intergenic
913192647 1:116426495-116426517 CTGGCACCGGGCTGCTCGGCAGG + Intergenic
915331450 1:155115219-155115241 GTGGCCTGGGGCTGCTGTGCTGG + Intergenic
915526704 1:156480565-156480587 CTGGCTCTCGGCTGCCCTGATGG - Intronic
917566115 1:176213450-176213472 TTGGATTTGGGATGCTCAGCTGG - Intergenic
919610746 1:199742785-199742807 TGGGCTTTGGGCTGCTGTGTTGG - Intergenic
920082109 1:203382392-203382414 CAGGGGTTGGGCTTCTCTGCTGG + Intergenic
920092386 1:203463937-203463959 CTGTCTTTGGGCTACTCTAGCGG - Intergenic
920314929 1:205070355-205070377 CTGGTTGGGGGCTGCTCTGCAGG + Intronic
921945706 1:220884630-220884652 CTGGCTGTGGGCTGTGTTGCAGG - Exonic
922151153 1:223005408-223005430 CTGGCTTTACTCTGCCCTGCAGG - Exonic
922796268 1:228341259-228341281 CAGGCTCTGGGCTGCTGGGCGGG + Intronic
923957079 1:239034368-239034390 CTCGCTTTGAGCTGAACTGCAGG - Intergenic
1062928488 10:1336150-1336172 TTGGCTTTGGGCTTCACTGCAGG + Intronic
1063161296 10:3420800-3420822 CTGGCTCTGTGCTGTGCTGCAGG - Intergenic
1063705533 10:8426852-8426874 CTGACTTGGGGGTGCTCTGAAGG + Intergenic
1064155207 10:12898122-12898144 CTCTTTCTGGGCTGCTCTGCAGG + Exonic
1064269848 10:13854801-13854823 CTGTCTGTGGGCTGAACTGCAGG + Intronic
1066145460 10:32553716-32553738 CTGGCTCTGGGCTGCTATTGGGG + Intronic
1067029636 10:42871559-42871581 CTGGCTCTCAGCAGCTCTGCAGG + Intergenic
1067036799 10:42926898-42926920 CTGACTAGGGGCTGCTCTACGGG - Intergenic
1068080456 10:52313019-52313041 CTGGCATTGGGCTGCCCTCTGGG - Intergenic
1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG + Intergenic
1069904536 10:71724640-71724662 ATGGCTTTGGGAAGCTCTGCAGG - Intronic
1070598492 10:77849396-77849418 CTGGCTGTGGGATGCTCAGGTGG - Intronic
1070694585 10:78552459-78552481 CTTGCTGTAGACTGCTCTGCAGG + Intergenic
1071532450 10:86400556-86400578 CTGGCTCTGGGCTCCGCCGCTGG + Intergenic
1071549681 10:86557080-86557102 CTGGCTGTGGGCAGCACTGAAGG - Intergenic
1073994056 10:109295370-109295392 ATGGTCTTGGGCAGCTCTGCAGG - Intergenic
1074507256 10:114082429-114082451 CGGGAGTTGGGCTGCTCGGCTGG + Intergenic
1075485351 10:122818042-122818064 CTGGATTTGGGCTGTTGTGGAGG + Intergenic
1075714572 10:124548591-124548613 CTGGCTTTGGCCTGCACGGCTGG + Intronic
1075790211 10:125078683-125078705 CTGGCTTTGGCCATCTCTACAGG - Intronic
1075971653 10:126659403-126659425 CTGGCTGCTGGCTACTCTGCTGG + Intronic
1076687792 10:132205919-132205941 CTGGATGTTGGCTGCCCTGCCGG - Intergenic
1076923937 10:133471864-133471886 AAGGCTGGGGGCTGCTCTGCTGG - Intergenic
1078786460 11:14499455-14499477 CAGGCCTAGGGCTGCTTTGCTGG - Intronic
1078840954 11:15075067-15075089 CCGGGTCTGGGCTGCTCTCCAGG - Exonic
1079133139 11:17761172-17761194 CTGGCTGTGTGCTGCACTGGCGG + Intronic
1079194157 11:18310242-18310264 CTGGCTTTGCTCTGCTCTGCAGG - Intronic
1081683387 11:45024567-45024589 CTGGCCTTGGTCTGCTGTACAGG + Intergenic
1081960569 11:47133549-47133571 CTGGCCTGAGGCTGCTGTGCTGG + Intronic
1082820668 11:57542730-57542752 GTGCCTTTGGTCTCCTCTGCAGG - Exonic
1083919823 11:65776331-65776353 CTGGCTGAGGTCTGCTCTGATGG + Exonic
1084215939 11:67646910-67646932 CTGGCTCTCTGCAGCTCTGCGGG + Exonic
1084271062 11:68029502-68029524 AGGGCTTTGGGCTGGTCAGCAGG - Intergenic
1085821203 11:79795518-79795540 CTGGTTCTGGGCTGTTGTGCAGG - Intergenic
1086279632 11:85171289-85171311 CTGGCTCTGTGCTGCTCCGTGGG - Intronic
1087289013 11:96299590-96299612 CTGGCTGTGGGCTGCTCCCAGGG - Intronic
1088979791 11:114851865-114851887 CTGGCTTTTTCCAGCTCTGCAGG + Intergenic
1089770240 11:120797244-120797266 GTGGCTCGGGGCTTCTCTGCAGG + Intronic
1090242227 11:125192280-125192302 CTGGCTTTGCACGGCTCTGCCGG - Intronic
1090728456 11:129548885-129548907 CTAGCTTTTGGATGCTATGCAGG + Intergenic
1090865937 11:130700592-130700614 CTTGCTGTGAGCTGCACTGCTGG + Intronic
1091118148 11:133034152-133034174 CTGGCTCTGGGCAGCTTTGAGGG + Intronic
1091316828 11:134620109-134620131 CTGGCTCTGGGCAGCCCTGAAGG - Intergenic
1091352415 11:134907806-134907828 CTGTCTCTGGGCTTCTCTGGGGG + Intergenic
1091377999 12:38302-38324 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1095971975 12:47908279-47908301 CTGTCTAAAGGCTGCTCTGCAGG + Intronic
1096199790 12:49673429-49673451 CTGGCTTGGGGCAGATCTGTTGG - Intronic
1096318311 12:50588611-50588633 CTTGGTTTGGGTTGCTCTGGTGG + Intronic
1096500007 12:52059014-52059036 CAGGCTTGGGGGTGCTCTGGGGG - Exonic
1099135793 12:78898681-78898703 CTGGCTTTGCACTGCTCTCTGGG + Intronic
1102768076 12:115450787-115450809 CTGGTTTGGGACTGCTCTGATGG - Intergenic
1102870445 12:116409998-116410020 TTGGCTGTGGGCTGCTCTGGGGG + Intergenic
1103605136 12:122080302-122080324 CTGTCTTAGGTCTGCTCTGGAGG + Intronic
1103889831 12:124230090-124230112 ATGTCTGTGGGCTGGTCTGCTGG + Intronic
1104949462 12:132432709-132432731 CTGTCTTTGGGCCTCTGTGCTGG - Intergenic
1105571108 13:21603843-21603865 TTGGCTCTGGGCGGCTCTCCCGG - Intronic
1106563399 13:30865476-30865498 GTGGCTTTGGGCTGGGCTGCTGG - Intergenic
1106757968 13:32841064-32841086 CTGGCTTTTGGCTGACCTTCAGG + Intergenic
1106908757 13:34439787-34439809 CGGGATTTAGGATGCTCTGCTGG - Intergenic
1107497317 13:40939748-40939770 TTGGATTTGGGATGCTGTGCCGG + Intronic
1109902818 13:68795844-68795866 CTGGCTTTGGCCTCCTTTCCAGG + Intergenic
1112702931 13:102032705-102032727 CTGGCTTTTTGCTCCTCTTCAGG + Intronic
1113419866 13:110162876-110162898 CAGGCTTTGGGCTGCTATGGAGG - Intronic
1113613743 13:111666054-111666076 CAGGCTTTAGCCTGCTGTGCAGG - Intronic
1113891954 13:113740802-113740824 CTGGCTCAGGGCTGTCCTGCGGG + Intergenic
1113926958 13:113947001-113947023 CTGGCTGTGGCCAGCACTGCAGG + Intergenic
1114617361 14:24075421-24075443 CTTGCTCTGGGAGGCTCTGCTGG + Intronic
1114670652 14:24409123-24409145 CTGGCCTTGGGCAATTCTGCAGG - Exonic
1115681981 14:35750664-35750686 GTGGCTTTGGTCTCATCTGCGGG + Exonic
1115956887 14:38791406-38791428 TTTGCTGTGGGCTGCTCTGTTGG - Intergenic
1120942186 14:89958970-89958992 CAGGGTTTGGGCTCTTCTGCAGG - Intronic
1121020271 14:90575623-90575645 CTGGCTGTGGGCTGGGCTCCTGG + Intronic
1121244453 14:92451899-92451921 CTGGCCTGGGGCTGGACTGCTGG + Intronic
1121336283 14:93079408-93079430 CAGGCCTCGGCCTGCTCTGCAGG - Intronic
1121340297 14:93101001-93101023 TTGGATTTGGGATGCTCTCCTGG - Intronic
1122540944 14:102497372-102497394 CTGGCTTTCGGTGGCTTTGCTGG + Intronic
1122689253 14:103523727-103523749 CTGGCTTTGAGCTGGAATGCGGG + Intergenic
1124006882 15:25801726-25801748 CTGGCTTTGCTCAGCACTGCTGG + Intronic
1124193612 15:27601126-27601148 CAGGAGCTGGGCTGCTCTGCTGG - Intergenic
1124220687 15:27847529-27847551 CTGTCTTTGGCCTCCTCTCCAGG - Intronic
1126688136 15:51266077-51266099 TTGGCTCTGGGCTGCACAGCTGG - Intronic
1127707756 15:61564003-61564025 TTCCCTGTGGGCTGCTCTGCTGG - Intergenic
1129068635 15:72932636-72932658 CTGGGTGTGGGCTGCACTGAGGG - Intergenic
1129381963 15:75173666-75173688 CTGTCTGTGGGCTGCACTGAAGG - Intergenic
1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG + Intergenic
1129829172 15:78656787-78656809 CGGGGTTTGGGTTGCTCTGGTGG + Intronic
1130509010 15:84572867-84572889 TTAGGTTTGGGGTGCTCTGCTGG + Intergenic
1130959143 15:88648248-88648270 CAGGCTCTGGACTGCTCAGCGGG + Intronic
1131532204 15:93203290-93203312 CTAGCTTTGAGCTCCTGTGCTGG + Intergenic
1132222216 15:100113430-100113452 CTGACTATGGGGTGCTCTCCTGG + Intronic
1132448928 15:101954694-101954716 CTGGCTGTGGGTGGCTCTGAGGG - Intergenic
1132667708 16:1089700-1089722 CAGGCTGTGGGCTTCTCTCCTGG + Intergenic
1132993823 16:2812343-2812365 CTCACTGTGGGCTCCTCTGCAGG + Intergenic
1133517420 16:6522936-6522958 CTGGCTTTGGGATGTTGTCCAGG + Intronic
1134024648 16:10944650-10944672 CGGGCGCTGGGCCGCTCTGCTGG + Exonic
1135062303 16:19281245-19281267 CTGACTGGAGGCTGCTCTGCTGG - Intergenic
1136111164 16:28064149-28064171 CTGGCTGTGGGAAGCCCTGCAGG - Intergenic
1136140278 16:28283889-28283911 CTGGCCTCAGCCTGCTCTGCTGG + Intergenic
1137743700 16:50805157-50805179 CTGGGTTAGGGCTGCTCATCTGG - Intergenic
1137765902 16:50977448-50977470 CTGTCAGTGGGCTGCTCTGCTGG - Intergenic
1138669125 16:58598689-58598711 CTGGCTTTGGGCTGGTGCTCAGG - Intronic
1139154295 16:64422280-64422302 CTGACTTTGGGCTGTTCAGATGG - Intergenic
1139935953 16:70571292-70571314 CTGGCTGTGGTCTGCCCTGAGGG - Intronic
1139966753 16:70749983-70750005 CTGGCTTTGAGCCTCTGTGCTGG + Intronic
1141139614 16:81488768-81488790 CTGGCTCTTCGCTGTTCTGCAGG + Intronic
1141626811 16:85265825-85265847 CTGGCCCTGGGCTGCTCATCAGG - Intergenic
1142010277 16:87710368-87710390 CTGACTTTGGGTTGATCTGGAGG - Intronic
1143482609 17:7236324-7236346 CTGGCTTTGGGGTGCTTCGGAGG - Exonic
1143670385 17:8392459-8392481 CTGGCTTTGGGCAGGTCACCTGG + Exonic
1144044678 17:11444487-11444509 CTTACTTTGGACTGCTCTGGTGG - Intronic
1145122915 17:20276962-20276984 CTGACTTCGGGCTGCTCCCCTGG - Intronic
1146653846 17:34623559-34623581 CCTGCCCTGGGCTGCTCTGCAGG + Intronic
1146891126 17:36507098-36507120 CTGGAGCTGGGCTGCGCTGCTGG + Exonic
1148565718 17:48631816-48631838 CTGGCCTTGGGCTGGGCTGGGGG - Intronic
1148582550 17:48753684-48753706 ATAGCTTTGCCCTGCTCTGCCGG - Intergenic
1149630502 17:58118100-58118122 GTGACTTTGGGATGCTATGCAGG - Intergenic
1150480340 17:65504203-65504225 CTGGCTTGGTGCTGTTCTCCTGG - Intergenic
1151940218 17:77287369-77287391 CTGGCATTGGCCTGCTCTACTGG + Intronic
1152064000 17:78100075-78100097 ATGGTCTTGGGCAGCTCTGCAGG + Intronic
1152359009 17:79821654-79821676 CTGGCCTTGGGCAGGTCTGGGGG + Intergenic
1152377500 17:79926439-79926461 GTGGCCTGGGGCTGCTCTGGAGG - Intergenic
1152717139 17:81905577-81905599 CTGGCTGTGGGCTCCTAGGCGGG - Intronic
1152866447 17:82726581-82726603 CCAGCTTTGGTCTGCTCTGCAGG + Exonic
1153161024 18:2204605-2204627 CTGGCTATGTGCTGGTCTGCTGG + Intergenic
1153782143 18:8504331-8504353 CTGGCTTTGGCCTGCAATGACGG + Intergenic
1155508238 18:26550977-26550999 CTGGCTCCGGGCTGCGCTCCTGG + Intronic
1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG + Intergenic
1157394432 18:47330099-47330121 ATGTCTTTGGGCTGCTTGGCTGG + Intergenic
1157479518 18:48044504-48044526 CTGCCTTTGGGCAGCTGGGCTGG + Intronic
1158936247 18:62367215-62367237 TGGGCTTTGAGCTGCTCTGCAGG - Intronic
1160636332 19:77859-77881 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1160838624 19:1136461-1136483 CTGTCTGTGGGCGGCTCTGCCGG + Intronic
1163361604 19:16850485-16850507 CTGGCTCTGGGCTGCTGTTAGGG - Intronic
1163426285 19:17242711-17242733 CTGGCCTGGGGCGGCCCTGCAGG + Intronic
1163484295 19:17576998-17577020 AGGGCTTTGGGCTGCTGTGCAGG + Intronic
1164653670 19:29904157-29904179 CTGGCTTATGGCTGCTCCACAGG - Intergenic
1164792250 19:30997133-30997155 CTGCCTGTGGCCTGCTCTGCAGG + Intergenic
1165362671 19:35346376-35346398 CTGGCTCTGGCCAGCTCTGCCGG - Intronic
1165463749 19:35959837-35959859 CTGGCTTTGCGCTCTTCGGCTGG + Intergenic
1167082930 19:47289669-47289691 CTGCCTCTGGGCTGCTCTTCTGG - Intergenic
1168403513 19:56099202-56099224 GGGGCTTTGGGCTGCCCTGCAGG - Intronic
925257511 2:2502824-2502846 CTGGCTGTGGGCTAAGCTGCGGG - Intergenic
926165164 2:10517991-10518013 TTGACTTTGTGCTGCTTTGCTGG - Intergenic
926790676 2:16568176-16568198 TTGGATTTGGGATGCTCAGCTGG + Intronic
927498119 2:23564163-23564185 ATGGTGTTGGGCTGCTCTGGGGG + Intronic
927524040 2:23721185-23721207 CAGGCGTTTAGCTGCTCTGCTGG - Intergenic
928086002 2:28346849-28346871 CTGGCTTTGGGCTGCCTGTCAGG - Intergenic
928819275 2:35341816-35341838 CTGGCTTAGGGCCCCACTGCCGG + Intergenic
929081662 2:38127944-38127966 AAGGCCTTGGGCAGCTCTGCAGG - Intergenic
929786155 2:44993800-44993822 CTGTCTTTGAACTGCTGTGCTGG - Intergenic
931714920 2:65021299-65021321 CTGGCATTGGGCTCCCCAGCCGG + Exonic
932134167 2:69213991-69214013 CTGGCTGTGGGTTGCCCTGGGGG - Intronic
932188794 2:69721186-69721208 CTGGCTTTTGGCTGCAGTGGTGG - Intronic
932418056 2:71585737-71585759 CTGCCTGTGAGGTGCTCTGCTGG + Intronic
932838606 2:75060757-75060779 GAGCCTTTGGGGTGCTCTGCGGG + Intronic
936565149 2:113577191-113577213 CTGGCTGTGGGTGGCTCTGAGGG - Intergenic
937910918 2:127075309-127075331 CAGGCTGTGGGTTGCTCTGAAGG - Intronic
938074855 2:128326285-128326307 CTGGGTATAGGCTGCTCTGCAGG - Intergenic
938129065 2:128695031-128695053 CTGGGTTTGGGCCGCTTTGGAGG - Intergenic
938497480 2:131808081-131808103 CTGGCTTTGGGCTGGTATTAGGG - Intergenic
939325446 2:140682496-140682518 CTTGCCTTGGGCTGGGCTGCAGG + Intronic
941609339 2:167641709-167641731 CTGGCCTTGGTTTTCTCTGCTGG + Intergenic
943771392 2:191721510-191721532 CTGGCTAAGGGCTGCTGTGGTGG + Intergenic
943781828 2:191832404-191832426 CTGGCATTGGAGTGCTCAGCTGG + Intergenic
946071716 2:217039825-217039847 CTGCCTCTGGGCTGCACTGATGG + Intergenic
946332262 2:219017138-219017160 CTGGCTCTGGGCTGGTCTTCAGG - Intronic
946417478 2:219547638-219547660 TGGGCATCGGGCTGCTCTGCGGG + Exonic
947712386 2:232323557-232323579 CTGGCTCTGGCCTCCCCTGCAGG + Intronic
947719773 2:232363372-232363394 CTGGCTCTGGCCTCCCCTGCAGG + Intergenic
948580724 2:238985970-238985992 CAGGCCTAGGGCTGCGCTGCTGG - Intergenic
1169496648 20:6122488-6122510 CTGTCTTTTGCCAGCTCTGCAGG + Intronic
1170071417 20:12373290-12373312 CTGCATTTGGGCTGCTCTGGAGG - Intergenic
1170802470 20:19601759-19601781 CTGGCTCTGGTCTGCAGTGCTGG + Intronic
1170968297 20:21095876-21095898 CTGGCTGAGGGCTACTCTGCTGG - Intergenic
1171183280 20:23106705-23106727 CTGTCTCTGGGCTTCTTTGCAGG + Intergenic
1171435605 20:25120724-25120746 CTAGCTCAGGGCTGCTCTGTGGG + Intergenic
1172216054 20:33236609-33236631 CTGGCTCTGGACAACTCTGCTGG + Intronic
1172495537 20:35380871-35380893 TTGGATTTGGGATGCTCAGCTGG - Intronic
1173362207 20:42354982-42355004 CTAGCTTCAGGCTGCTCTGGTGG + Intronic
1173482908 20:43416990-43417012 CAGGCTTACAGCTGCTCTGCAGG - Intergenic
1173781153 20:45758520-45758542 CTGGCTGTGGGCTGCCAGGCAGG - Intronic
1174128344 20:48325134-48325156 CAGGATTTGGGCTGCACAGCTGG - Intergenic
1175333247 20:58178874-58178896 CTGGCTGGGGGCTGCTCTTGGGG + Intergenic
1175410148 20:58762402-58762424 CCCGCCTGGGGCTGCTCTGCTGG - Intergenic
1175428971 20:58889704-58889726 CGGGCTTCGGGCTGCTGGGCTGG - Intronic
1176295048 21:5067326-5067348 ATGGCTTTGGTCTCCTCTTCTGG + Intergenic
1176976366 21:15326611-15326633 CTGGCATTGGGGTGATCTTCAGG + Intergenic
1177087042 21:16718789-16718811 TTGGCTGAGGGCTACTCTGCAGG + Intergenic
1177868377 21:26540242-26540264 GTGGCTTTGGGTTTCTCTCCAGG - Intronic
1179085696 21:38215738-38215760 CTGGCCCTGGGCCACTCTGCTGG - Intronic
1179182928 21:39061087-39061109 CTGGCTCCAGGCTGCTCTGGGGG - Intergenic
1179451743 21:41472935-41472957 CAGGCTTCAGGCTGCCCTGCTGG - Intronic
1179615534 21:42580831-42580853 CTGGCTCTCTGCTTCTCTGCTGG - Exonic
1179862001 21:44194802-44194824 ATGGCTTTGGTCTCCTCTTCTGG - Intergenic
1179894736 21:44355148-44355170 CTGGCTTTGGCAAGCTGTGCAGG - Intronic
1180071425 21:45438554-45438576 AGGGCTTTGGGCTACTCTGCAGG + Intronic
1180199428 21:46215643-46215665 CTGACCCTGGGCTGCCCTGCCGG + Intronic
1180594483 22:16964280-16964302 CTGGGTTTTGGCTGCTTTGCTGG + Intronic
1181066174 22:20307070-20307092 CTGGCCTCGGCCTCCTCTGCAGG - Intergenic
1181930659 22:26398783-26398805 CCGGCTTTGGGCTTCTCTATTGG - Intergenic
1182475280 22:30573735-30573757 CTGGCTCTGGGCAGCTGGGCGGG + Intronic
1182782629 22:32880410-32880432 CTGGCCTTGGCCTGGTCTACAGG + Intronic
1183064229 22:35352579-35352601 CTGGGCTGGGGCTGCTCTCCTGG + Intergenic
1184361723 22:44023159-44023181 CTGGCTGATGGCTGCTCAGCAGG - Intronic
1185061995 22:48611925-48611947 CTGGGTGTTGGCAGCTCTGCTGG + Intronic
1185239431 22:49734756-49734778 CTTCCTTTGTGCTGCTCTTCAGG - Intergenic
1203283741 22_KI270734v1_random:144482-144504 CTGGCCTCGGCCTCCTCTGCAGG + Intergenic
950443390 3:13022660-13022682 CAGGCTTTGGGCTGCAGGGCGGG - Intronic
950444384 3:13027798-13027820 CTGGCTGATGGCTGCTCTGTAGG + Intronic
950743621 3:15069196-15069218 CTTGCTTAGGGTTGCACTGCTGG - Intergenic
953180278 3:40588547-40588569 CTGGCCTGGGGCTGCCTTGCGGG + Intergenic
954130999 3:48560930-48560952 CTGGTTTAGGGGTGCTCTGAGGG - Intronic
954426935 3:50448197-50448219 CTGGGTATGTTCTGCTCTGCAGG + Intronic
954638203 3:52083058-52083080 CTGGGTTTATGCAGCTCTGCTGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
957389010 3:79537482-79537504 TTGGCTATGGGCAGCTCTGTCGG + Intronic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
958518634 3:95156100-95156122 AAGGCCTTGGGCAGCTCTGCAGG + Intergenic
960206266 3:114903480-114903502 CTGGCTTTTGGATGAGCTGCTGG - Intronic
961364794 3:126392492-126392514 ATGGCTTTGGGCTCCGCTCCAGG + Intergenic
961825837 3:129598590-129598612 CTGGGGCTGGGCAGCTCTGCAGG + Intronic
964590309 3:158354860-158354882 CTGGCTTTGGCCTGTTCAGCTGG - Exonic
965757862 3:172042756-172042778 GTGGCTTGTGGCTGCTATGCTGG - Intronic
966820264 3:183918682-183918704 CTAGATTTGAGCTTCTCTGCTGG - Intergenic
967305434 3:188054501-188054523 CTCCCTTTGGGCTGTTCTTCTGG + Intergenic
968508950 4:987039-987061 GGGGCTTCGGGCTGCACTGCCGG - Exonic
968664037 4:1810960-1810982 CTGCCTGTGGGCTGGACTGCAGG + Intergenic
969529180 4:7720760-7720782 CTGGCTGTGGGCTTCCCTGGCGG - Intronic
970022758 4:11587528-11587550 CTGTCTTTAGGCTGCTCTCATGG + Intergenic
970483222 4:16498712-16498734 CTGGCTTGTGGCTGCTTTGGTGG + Intergenic
972765563 4:42150730-42150752 CAGGCAGTGGGCTGCTTTGCCGG + Intronic
976891028 4:90048068-90048090 ATGGCTTTTGGATGCTCTCCTGG - Intergenic
984294944 4:177843095-177843117 CTGGCTTTGGGCTTTTATGTTGG + Intronic
985382940 4:189414315-189414337 CTGGGTTCTGGCTGCCCTGCAGG + Intergenic
985879650 5:2628610-2628632 CTGGCAGTGAGTTGCTCTGCTGG + Intergenic
986273995 5:6257685-6257707 TTGGCTTTGGGCTATTTTGCAGG - Intergenic
986887593 5:12258832-12258854 ATGGCTTTGGGGTGCTATGCAGG + Intergenic
987671512 5:21016048-21016070 CTGCCTCTGGGCTGCTATTCTGG - Intergenic
990236841 5:53778040-53778062 CTGGGCTTGGCCTGCTCAGCCGG + Intergenic
990241163 5:53818052-53818074 CCAGCTTTGGACTGCTCTGTAGG - Intergenic
992614482 5:78535500-78535522 CTGGCTTTGTGTGGCTCTGGTGG - Intronic
995399059 5:111720011-111720033 CTGTCATTGTGCTGATCTGCAGG - Intronic
996621945 5:125515985-125516007 CTGGATTTGGGCTACTGTGAAGG + Intergenic
997856957 5:137381215-137381237 AGGGCCTTGGGCAGCTCTGCAGG + Intronic
998074142 5:139222560-139222582 CTGGTTTTACGCTGCTCTCCAGG + Intronic
998079007 5:139259334-139259356 CTGGGGCTGGGCAGCTCTGCAGG + Intronic
998182001 5:139952460-139952482 CTGGTTTTGGGGTGCTCTGGGGG - Intronic
999195446 5:149778558-149778580 CTGCCATTGGGCAGCTCTGATGG + Intronic
999227411 5:150037548-150037570 CCTGCTTTGGGATGCTCTGAGGG - Intronic
999229729 5:150054512-150054534 CTGGGTTTGGGGACCTCTGCTGG - Intronic
999367630 5:151033442-151033464 CTGGCTCTGGGCTGCTACCCAGG - Intronic
999699392 5:154214354-154214376 TTGGCATTTGTCTGCTCTGCCGG + Intronic
1002681393 5:180968120-180968142 CTGGCTTTGGGCTGTCAGGCAGG - Intergenic
1004286303 6:14323970-14323992 CTGACTTTGGGCTACTCTGCTGG + Intergenic
1005275879 6:24216981-24217003 CTGGATGTGTGCTGCTCTGCAGG - Intronic
1005828393 6:29650544-29650566 GAGGCTTTGGGCTGTTCTGTAGG - Intergenic
1006806366 6:36792203-36792225 GGGGCTTTGGGGTGATCTGCTGG - Intronic
1006943287 6:37767026-37767048 TTTGGTTTGGGCTGGTCTGCTGG + Intergenic
1007613275 6:43164529-43164551 CTGGCTTAGGTCTAGTCTGCTGG + Intergenic
1007629858 6:43267259-43267281 CTGTCTTTGGGCTGGCCTGAAGG + Intronic
1008492691 6:52102642-52102664 ATGCCTTTGTGCTGCTCTGGGGG - Intergenic
1009356952 6:62761818-62761840 ATGGCTTTGGGCTGTGTTGCAGG - Intergenic
1010275843 6:73967504-73967526 CTGGCTTTTGCCTGCACTGATGG + Intergenic
1010651282 6:78458027-78458049 CTGCCTTTGGGCCTCTGTGCTGG - Intergenic
1012339000 6:98095234-98095256 CTAGCTTTGTGCTGCTTTGCAGG - Intergenic
1012625004 6:101393849-101393871 CCGGCTGTGGGCTGCACTCCGGG + Intergenic
1013459755 6:110363936-110363958 CTGGCTCTGGGCTGGTCTTATGG + Intergenic
1013537112 6:111073117-111073139 CTGACTTTGGACAGCTCTGATGG + Intergenic
1016186113 6:141199161-141199183 CTGGCTTTAGGCTGCTGTCCTGG + Intergenic
1016866930 6:148776876-148776898 CTGGCCTTGGTCTGTCCTGCTGG + Intronic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1018709319 6:166486422-166486444 GTGACTTGGGGCTGCTCTGCTGG + Intronic
1018998660 6:168729233-168729255 CTGGCTCATGGCTGCTCCGCTGG + Intergenic
1019001809 6:168759952-168759974 CTGGCTTTGGGCTTTTTTGTTGG - Intergenic
1019260557 7:79641-79663 CTGCCTTTGAGCTGGGCTGCGGG - Intergenic
1019331117 7:461389-461411 CTCCCTCTGGGCTGCCCTGCTGG - Intergenic
1019771602 7:2886826-2886848 CTGGCTTTGGGCCTGTCTGGGGG + Intergenic
1020211037 7:6158486-6158508 CTGGCTCTGGGCTGCTGGGAGGG - Intronic
1020736049 7:11950360-11950382 CTGGGTGGGTGCTGCTCTGCTGG + Intergenic
1022023143 7:26420894-26420916 CTGTTTCTGGGCTGCTTTGCGGG - Intergenic
1022139929 7:27484666-27484688 CTGGATTTTGGCTACTCTCCTGG + Intergenic
1023020003 7:36003297-36003319 CTGGCTTTGGCCAGTTCTTCAGG + Intergenic
1023026612 7:36056554-36056576 CTGGCCTGGGTCTCCTCTGCAGG - Intergenic
1024246606 7:47475566-47475588 CTGGCTGTGGGCTGCCCAGGAGG + Intronic
1024247616 7:47482026-47482048 CAGGCATTGCGCTGCTCTGGGGG + Intronic
1025100442 7:56130434-56130456 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1025147791 7:56519950-56519972 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1025607083 7:63047272-63047294 CTGGGTAAGGGCTGCTCTGAAGG - Intergenic
1026318607 7:69249371-69249393 CTGGCTTTGGGCTGCAGTTGAGG + Intergenic
1030349121 7:108463689-108463711 CAGACAGTGGGCTGCTCTGCTGG + Intergenic
1032098363 7:128951764-128951786 ATAGCTTTTGGCTGCTCTGGTGG + Intergenic
1032266156 7:130371386-130371408 CAGGGTTTGGGCTGACCTGCAGG + Intergenic
1034875821 7:154724124-154724146 CTGACTTTGGGTTGGTCTGGTGG + Intronic
1035002089 7:155620706-155620728 CTGCCTTTGGGCTGCCTTCCAGG - Intronic
1035066339 7:156107901-156107923 CTGGCTCTGTGCTGCTCTGACGG + Intergenic
1036505440 8:9350614-9350636 CTGTGTGTGGGCAGCTCTGCTGG - Intergenic
1036777852 8:11625753-11625775 CTGGGTAGGGGCTGCTCTTCAGG + Intergenic
1037719628 8:21431517-21431539 CTGGCTTTGGGCCCCTTTCCAGG - Intergenic
1037828993 8:22177251-22177273 CAGGCTGTGGGCAGCGCTGCGGG - Intronic
1037872420 8:22510748-22510770 ATAGCTTTGGGCTCCTCTGAAGG - Intronic
1038506506 8:28089503-28089525 CTGCCTCTGAGCTGCTCTTCTGG - Intergenic
1039478777 8:37856482-37856504 TTGCCCCTGGGCTGCTCTGCGGG - Intergenic
1039881421 8:41627631-41627653 CTAGCATTTGCCTGCTCTGCGGG - Intergenic
1040014982 8:42692471-42692493 CTGGGTTTGTGCTGCCCTCCTGG + Intergenic
1041840671 8:62266890-62266912 CTGCCTTTGAGCTGCTCCTCTGG + Intronic
1042300492 8:67275065-67275087 CTGTCTCTGGTCTGCTCAGCTGG + Intronic
1042480941 8:69301761-69301783 TTGGCTATGGGCTGCTCAGCAGG + Intergenic
1045059886 8:98402515-98402537 CTGGCTTTGCTCTGCTGTACTGG - Intronic
1048257293 8:132914757-132914779 CTTGGTTTGGGCAGCTCTGATGG - Intronic
1049263327 8:141651765-141651787 CTGTCTCAGGGCTGCTCTGAGGG - Intergenic
1049528881 8:143143359-143143381 CTGGCTCTGGGCACCGCTGCAGG - Intergenic
1049607375 8:143536044-143536066 CTGGCTGTGGGATGTGCTGCTGG - Intronic
1049778458 8:144416848-144416870 CTGGCTGAGGGCGGCTTTGCTGG + Exonic
1049784330 8:144443435-144443457 CTGGCCTTGGCCTGCTCTGTGGG - Intronic
1049854654 8:144853565-144853587 TCCGCTTTGGGCTGCTCTGTTGG + Exonic
1049887275 9:36033-36055 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1050689472 9:8209111-8209133 CTGGCTTGGGCCTGATCTGTTGG - Intergenic
1053122149 9:35555455-35555477 GTGGCTGTGGGCTGCTCTGGGGG - Exonic
1053285851 9:36849088-36849110 CTGGCTTTGCCCTGACCTGCAGG + Intronic
1053664666 9:40308980-40309002 AGGGCTTTGAGTTGCTCTGCAGG - Intronic
1055205170 9:73721348-73721370 CAGGCTATGGGATGATCTGCAGG + Intergenic
1055554210 9:77459347-77459369 CTGGGCTTGGGCTGAGCTGCAGG - Intronic
1056468913 9:86886281-86886303 CTGTCTTTTTGCTTCTCTGCTGG - Intergenic
1056613899 9:88145294-88145316 CTGGCTTTGGCCTCTTCAGCTGG + Intergenic
1057134921 9:92680722-92680744 CTGGCTTAGGGCTGCTCCCTGGG + Intergenic
1057442262 9:95091101-95091123 CTTGCTTTCAGCTGCTCTGTGGG - Intergenic
1057514962 9:95713055-95713077 CTGGCCTTTGGCTCCTCTCCTGG + Intergenic
1057907978 9:98997059-98997081 CTTGTTTGGGGCTGCTGTGCTGG - Exonic
1058492891 9:105521060-105521082 GTGGCTTTGGTCTCATCTGCGGG - Intronic
1058679076 9:107425642-107425664 TTGTCTCTGGCCTGCTCTGCGGG - Intergenic
1059465991 9:114469240-114469262 ATGACTGTGGGCTGCTGTGCAGG + Intronic
1059747284 9:117215151-117215173 CTGTCCTTGGGATGCTCAGCTGG - Intronic
1060265439 9:122109162-122109184 CTGGCTTTGGCCTGGTCCCCAGG + Intergenic
1060363654 9:122985869-122985891 TTGGATTTGGGGTGCTCAGCAGG - Intronic
1060973445 9:127752037-127752059 GTGGCCTTGGGCTTCCCTGCTGG - Intronic
1061374436 9:130215691-130215713 CTGGGTTTGGGCTGCTATTATGG + Intronic
1061464724 9:130768541-130768563 CTGGCTTTGCACTGGTCTGGGGG + Intronic
1061549548 9:131325445-131325467 CTGGGTTTGGGTTCATCTGCAGG - Intergenic
1061851953 9:133421561-133421583 CTGGCTTGGGGCTGCTTTCCTGG + Intronic
1061853126 9:133427769-133427791 CTGCCTTTGAGCTGCTCTTTTGG - Intronic
1062138176 9:134940659-134940681 CTGTCCTTGGGCTCCTCTGCTGG + Intergenic
1062149054 9:135008052-135008074 CTGGGTTTGGGCTGCCCAGAGGG - Intergenic
1062375981 9:136262142-136262164 GTGGCTGGGGGCTGTTCTGCCGG - Intergenic
1062490111 9:136800892-136800914 CTGCCTTTGGCCTCGTCTGCAGG - Intronic
1062707643 9:137954165-137954187 CTGGCTTGGGGGCCCTCTGCTGG - Intronic
1185519514 X:728375-728397 CTGTCTGTGGTCAGCTCTGCTGG - Intergenic
1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG + Intronic
1188615794 X:32157729-32157751 CTGGCTGTGAGCTGCTCAGAGGG - Intronic
1189064301 X:37790020-37790042 TTGGCTGAGGGCTGCTCTGAGGG - Intronic
1189321456 X:40090094-40090116 GTGGCTTTGGCAGGCTCTGCGGG - Intronic
1190520254 X:51272038-51272060 CTGGCTTGGGGTTTCTATGCTGG + Intergenic
1192538072 X:71945565-71945587 CCGACTTGGGGCTGGTCTGCTGG + Intergenic
1192557958 X:72105368-72105390 CTGGCTTTGGGCTGCAGGGAGGG - Intergenic
1194217466 X:91148351-91148373 GTTGGTTAGGGCTGCTCTGCTGG + Intergenic
1196828254 X:119757923-119757945 CTGGTCTTGGGCTTCTCTGCTGG + Intergenic
1200146288 X:153928031-153928053 CTGGCTTTTGGATGCTTTGAAGG - Intronic
1200208380 X:154333816-154333838 CTGCCTTTGGGCTGGAGTGCAGG - Intergenic
1200553979 Y:4612143-4612165 GTTGGTTAGGGCTGCTCTGCTGG + Intergenic