ID: 1187261216

View in Genome Browser
Species Human (GRCh38)
Location X:17686782-17686804
Sequence CTGGATCTGGATAGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187261214_1187261216 -10 Left 1187261214 X:17686769-17686791 CCAGGACAGGAGTCTGGATCTGG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1187261213_1187261216 -9 Left 1187261213 X:17686768-17686790 CCCAGGACAGGAGTCTGGATCTG 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187261216 Original CRISPR CTGGATCTGGATAGTGTGTC TGG Intronic
903070591 1:20725188-20725210 TTGGGTCTGGATGGTGTGTGTGG - Intronic
905202936 1:36326069-36326091 CAGGATCTGGGGAGAGTGTCTGG + Intronic
906873686 1:49512618-49512640 CTGGGTTTGGAGAGGGTGTCAGG - Intronic
908667208 1:66506702-66506724 CTGTATCAGGAAAGTGTATCAGG - Intergenic
912360471 1:109090839-109090861 CTGGACCTGGGTAGGGGGTCCGG - Exonic
914746328 1:150504279-150504301 GTGGTTCTGGATAGTGCTTCTGG + Intronic
914919373 1:151837362-151837384 CTGGCTCTTGAGAGTGAGTCAGG - Intergenic
922603929 1:226877305-226877327 TTGGACCTAGGTAGTGTGTCTGG - Intronic
922846981 1:228694233-228694255 CTGTATCTGCATATTATGTCTGG - Intergenic
924068327 1:240249669-240249691 CTGGATCTGGAGATTGTTTTGGG + Intronic
1067082516 10:43219575-43219597 CTGGATGTGGGCAGTGTGCCCGG - Intronic
1067476769 10:46572615-46572637 CTGGTTCTGGAGTGGGTGTCAGG - Intergenic
1067617969 10:47769165-47769187 CTGGTTCTGGAGTGGGTGTCAGG + Intergenic
1073224079 10:101901672-101901694 CTGGGTGTGGATACTGTGGCAGG + Intronic
1074546974 10:114408706-114408728 CTGGAACTGGAAAGTGGGGCAGG + Intergenic
1074904191 10:117846704-117846726 CTGGTTTTGGCTAGTGTGGCAGG + Intergenic
1075626363 10:123966868-123966890 CTGGATCTGTATACAGTTTCAGG + Intergenic
1076531629 10:131149025-131149047 CTGGAGCTGGAAAGTTTGCCAGG - Intronic
1076773879 10:132682300-132682322 CTGGAGATGGATGGTGTGACGGG + Intronic
1078670656 11:13362101-13362123 GTGGCTCTGGAAAGTGTGTGTGG - Intronic
1083288556 11:61676840-61676862 CTGGGTTTTGATTGTGTGTCTGG + Intergenic
1084571848 11:69964655-69964677 CGGGTTCTGGAAAGGGTGTCCGG - Intergenic
1086101368 11:83103319-83103341 CTGTATCTGGATAGTGTAATTGG + Intergenic
1086200192 11:84193248-84193270 ATGGATCTAGATAGTGATTCAGG + Intronic
1092892334 12:12980655-12980677 CTGGAAGTGGATGTTGTGTCTGG + Intronic
1097407525 12:59209156-59209178 CTGGATCTGGATTATGTCTGTGG - Intergenic
1097537740 12:60894717-60894739 CTGGATATGGATATGGTGGCAGG + Intergenic
1098761014 12:74425219-74425241 CTGGAACTGAATAGTGTCTCAGG + Intergenic
1098876343 12:75869744-75869766 TTGGATCTGGCTACTGTGCCTGG - Intergenic
1102078575 12:110079886-110079908 CCGGAACTGGATAGTGGATCTGG - Intergenic
1104055560 12:125227498-125227520 CTGGATCTGGATACTGGGTAGGG + Intronic
1104267929 12:127254140-127254162 CTGGAGCTGGAGATTGGGTCAGG - Intergenic
1106635773 13:31527068-31527090 CTGGATCTTGATATTGTGCAAGG - Intergenic
1106659009 13:31778983-31779005 CTGAAACTGGTTGGTGTGTCAGG - Intronic
1108585031 13:51863584-51863606 CTGGTTCTGGTTTGTGTGACTGG + Intronic
1113284156 13:108828357-108828379 CTGAAACTGGATAGTGGCTCTGG - Intronic
1113317908 13:109203690-109203712 CTGGATTTTGAAAGTGTGTGGGG - Intronic
1114490467 14:23097887-23097909 CTGGAGCAGCTTAGTGTGTCTGG + Exonic
1117314877 14:54565197-54565219 CTGGATCTGGAGAGTGCGCAGGG - Intergenic
1118505130 14:66402906-66402928 CTGGAATTGGAAAGTGAGTCTGG - Intergenic
1120824332 14:88941881-88941903 CTGGTTCTGCATAGTGTGAGGGG - Intergenic
1123629390 15:22250809-22250831 CTGGGTCTGGATGGTGACTCTGG - Intergenic
1124259510 15:28176010-28176032 CTGGCTGTGGATGGTGTGTCAGG - Intronic
1124356609 15:29000128-29000150 CTGTTTCTGGATAGTCTGTGAGG - Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1128565880 15:68700178-68700200 CTGGGTCTGGATGTCGTGTCTGG - Intronic
1129109263 15:73328209-73328231 CTGGACGTGGAGAGGGTGTCAGG + Intronic
1133402746 16:5500638-5500660 CTGGCTGAGGATGGTGTGTCTGG - Intergenic
1141518693 16:84563312-84563334 CTGGATCTGGCTAGGGTATGGGG - Intergenic
1142029684 16:87832293-87832315 CTGGCTCAGGATGGTGTCTCGGG + Exonic
1142761548 17:2044996-2045018 CTGGGTGTGGAAAGTGTGTGTGG + Intergenic
1148510263 17:48162892-48162914 CTGGATCAGGAAAGTCTGGCGGG - Intronic
1149856962 17:60091135-60091157 CCAGATCTAGATAGTGTCTCAGG + Intergenic
1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG + Intronic
1153020124 18:621330-621352 CTGGAGCCGGGTAGTGTGACAGG + Intronic
1161957194 19:7502813-7502835 CTGAATGTGTATGGTGTGTCTGG + Intronic
1166427254 19:42689733-42689755 CAAGATCTGGATAGTGGGCCGGG + Intronic
1167072625 19:47229766-47229788 CTGGGTTTGGCTTGTGTGTCTGG - Intronic
925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG + Intronic
926954983 2:18284493-18284515 CTGGCTCTGCCTAGTGTGCCAGG - Intronic
928099897 2:28430848-28430870 ATGGATCTGGATACTGATTCTGG - Intergenic
928405847 2:31014302-31014324 CTGGATCTGGATAGCTAGTGAGG + Intronic
929287623 2:40153719-40153741 CTGGAGCTAGAAATTGTGTCAGG - Intronic
930903641 2:56539216-56539238 CTGCATCTGTAAAGTGTGTAGGG + Intergenic
933724368 2:85418356-85418378 CTGGATCTGGACAGTGGGCCCGG - Intronic
934136059 2:88997489-88997511 CAGGAAATGGATAGTGGGTCTGG + Intergenic
934234260 2:90216283-90216305 CAGGAAATGGATAGTGGGTCTGG - Intergenic
943965328 2:194325827-194325849 CTGCTTCTGGGTAGTGTGACAGG - Intergenic
1169611843 20:7389715-7389737 CTGGATATGGATTCTGTTTCTGG - Intergenic
1170408183 20:16061521-16061543 TTGGTTCTGCATAGTGAGTCAGG + Intergenic
1172240719 20:33410976-33410998 CTGGCTCTGGCCCGTGTGTCAGG - Intronic
1174348435 20:49949128-49949150 CTGGCCCTGGACAGTATGTCAGG + Intronic
1175798319 20:61786038-61786060 CTGGACGTGGATTCTGTGTCTGG - Intronic
1182167046 22:28186368-28186390 CTAGGTCTGGTTAATGTGTCTGG + Intronic
1185373689 22:50472335-50472357 CTGGATCTGGACATCCTGTCTGG - Intronic
953380049 3:42463159-42463181 TTGGATCTGAATCTTGTGTCTGG - Intergenic
954622159 3:52002491-52002513 CTGGATGTGGCAGGTGTGTCTGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
958943012 3:100335201-100335223 CTGGAGCTGGAAAGTGAGTGGGG - Intronic
964829591 3:160868983-160869005 TTGTATCTGAATAGTGTTTCTGG + Intronic
968345044 3:197996405-197996427 CTGTATCTGGAAAGTGCATCTGG - Intronic
969124978 4:4940483-4940505 CTGGACCTGGGTAGTGCTTCAGG + Intergenic
969476914 4:7427094-7427116 CTGGATCTGGAGAGTTTGAGAGG + Intronic
971165730 4:24181560-24181582 GTGGATCTGGATAGAGTCTGTGG - Intergenic
976876004 4:89854554-89854576 CTGCATCTGGTGAGTGTCTCAGG + Intergenic
976950026 4:90816673-90816695 CTTGATCTTGATAATGAGTCAGG - Intronic
979413212 4:120404886-120404908 CTGGAACTAGAAAGTGTGGCTGG + Intergenic
980120510 4:128723408-128723430 TTGGAAGTGGATAGTTTGTCAGG + Intergenic
980120593 4:128724089-128724111 CTGGGTCTGGATGGTGTGACAGG - Intergenic
984395870 4:179199302-179199324 CTGGATTTTGACAGTGTGTGTGG - Intergenic
984537308 4:180992377-180992399 CTTGATCTGGATGATGTGTTTGG + Intergenic
995836909 5:116408422-116408444 CTGGATCTGGAAGGTGTTCCTGG + Intronic
998512210 5:142722977-142722999 GTGGATCTGGGAAGTGTTTCAGG + Intergenic
1001378696 5:171287603-171287625 CTGGACCTGGATAGGGGGTGGGG - Intronic
1001434325 5:171687422-171687444 CTGCGCCTGGATAGTGTTTCTGG + Intergenic
1006337673 6:33428838-33428860 CTGGATGTGGGTGGTGTGGCTGG + Intronic
1007917628 6:45575820-45575842 CTGTATCTGGATTAGGTGTCAGG + Intronic
1008451581 6:51657259-51657281 CTGGCTCTGGAGACTGTGTCGGG + Intronic
1014083871 6:117318919-117318941 TTGGTTCAGGATAGTGTGTCAGG - Intronic
1015870683 6:137773371-137773393 ATGGATCTTGCCAGTGTGTCTGG - Intergenic
1023558292 7:41446190-41446212 CTGAATTTGGATTGAGTGTCTGG + Intergenic
1023852887 7:44159940-44159962 CTGGAGCTGGCAAGTGGGTCAGG + Intronic
1024801285 7:53083012-53083034 CTTAGTCTGGATAGTGGGTCAGG - Intergenic
1027871961 7:83718616-83718638 CTGGATCCTGATAATCTGTCAGG + Intergenic
1031092471 7:117376317-117376339 CTGGACCTGGATATTTTGTGGGG - Intronic
1034688923 7:152998447-152998469 CTGGATCTGGATCCTGGGTTTGG + Intergenic
1039200175 8:35082576-35082598 CTGGATCTGGACAGAGTGGGTGG - Intergenic
1043807811 8:84695151-84695173 CTGTTTCTTGATAATGTGTCAGG + Intronic
1045060436 8:98406155-98406177 CTGGATGTTTATTGTGTGTCAGG - Intronic
1047407229 8:124595786-124595808 GTGAATCTGGAGAGTGTGGCAGG + Intronic
1047790990 8:128203451-128203473 CTGAATGTGGACAGTGTGACAGG - Intergenic
1053788931 9:41672406-41672428 GTGCATCTGGAAAGAGTGTCGGG - Intergenic
1054177213 9:61883751-61883773 GTGCATCTGGAAAGAGTGTCGGG - Intergenic
1054660320 9:67697054-67697076 GTGCATCTGGAAAGAGTGTCGGG + Intergenic
1055890406 9:81117749-81117771 CTGGATCAGGATGCTGTGTTGGG - Intergenic
1059055274 9:110972649-110972671 TTGAAACTGGATAGTGGGTCAGG + Intronic
1060694654 9:125698012-125698034 CTGGATTTGGATATTGGGACTGG - Intronic
1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG + Intronic
1189516026 X:41714246-41714268 ATGGAACTGGATATTATGTCTGG + Intronic
1190214595 X:48471183-48471205 CTGAACCTGGATCGTGTGTGTGG - Intergenic
1190761089 X:53438940-53438962 CAGGATCTGGCTTGGGTGTCTGG - Intergenic
1193848287 X:86502305-86502327 CTGGAGCTGGAAAGGGTGTTAGG + Intronic
1197869602 X:131052440-131052462 CTGGATATGGGTAGTGTGAGAGG + Intergenic
1198384096 X:136111805-136111827 CTGGACAAGGATAGTGTGGCTGG - Intergenic
1199406567 X:147468767-147468789 CTGGTTCTGGATAATGAGTTGGG - Intergenic
1199726837 X:150591755-150591777 CTGGATTTTGTTAGTGTGTCTGG + Intronic