ID: 1187261521

View in Genome Browser
Species Human (GRCh38)
Location X:17688888-17688910
Sequence GTTTTAGAGCCCCCTAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187261515_1187261521 26 Left 1187261515 X:17688839-17688861 CCTTAAAACCATTCTAATTAGGA 0: 1
1: 1
2: 1
3: 21
4: 219
Right 1187261521 X:17688888-17688910 GTTTTAGAGCCCCCTAAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 81
1187261519_1187261521 18 Left 1187261519 X:17688847-17688869 CCATTCTAATTAGGACAAGGGGA 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1187261521 X:17688888-17688910 GTTTTAGAGCCCCCTAAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187261521 Original CRISPR GTTTTAGAGCCCCCTAAATT GGG Intronic
908398752 1:63750501-63750523 GTTTTAAAGCCCTCAAAATGAGG + Intergenic
912010289 1:104951081-104951103 GTTGTAGATCCCCCTAAGTTTGG - Intergenic
914957133 1:152172890-152172912 CTTTTAGCGCCTCCTAAATTAGG + Intergenic
1063085439 10:2813779-2813801 GTTGCAGAGCTCTCTAAATTGGG - Intergenic
1067220257 10:44338944-44338966 GTCTTAGAACCTCATAAATTGGG - Intergenic
1071122505 10:82295918-82295940 TTTTTAAAGCTCCCTAAAATAGG - Intronic
1082105163 11:48214012-48214034 GGTTTAGTGCCCCGTAAAGTGGG + Intergenic
1087583087 11:100083810-100083832 GTTTTCCATCACCCTAAATTTGG - Intronic
1092025821 12:5239433-5239455 GGTATAGAAACCCCTAAATTGGG - Intergenic
1096227944 12:49881435-49881457 GTCTCTGAGCCCCCTAAATCAGG - Intronic
1098001076 12:65943961-65943983 GTTTTAGTGCTTCCTAAGTTGGG - Intronic
1098081521 12:66791037-66791059 GTCTTAAAGACCACTAAATTTGG + Intronic
1100371560 12:93973442-93973464 GTTTAAGGGCCTCCAAAATTTGG + Intergenic
1106661899 13:31808604-31808626 GTTCAAGACCCACCTAAATTTGG + Intergenic
1111364879 13:87229867-87229889 GTTTTATACCCCCCAAAACTGGG - Intergenic
1111633922 13:90879038-90879060 GTTTTAGAACCCTCTTAATTCGG - Intergenic
1114878028 14:26747595-26747617 CTTTTAGCTCCCCCTAAATAAGG - Intergenic
1116636434 14:47402271-47402293 GTTTTTGAGTCTCCTAAATAAGG - Intronic
1124803021 15:32853340-32853362 GTTTTAGAGCCTCTGATATTGGG + Intronic
1125065406 15:35478648-35478670 GTTTTAGACCACCCCAGATTTGG - Intronic
1126125025 15:45287597-45287619 GTTAGAGAGCCCCATCAATTGGG + Intergenic
1126307040 15:47271680-47271702 GTTTTAGAGCCCCCCAAATCAGG + Intronic
1127210480 15:56769597-56769619 GTTTTAGAGTCTGCCAAATTAGG + Intronic
1127316472 15:57799177-57799199 GTATTAGAGCCTAATAAATTGGG + Intergenic
1140153100 16:72392298-72392320 GTTTTAGTGAACCCTAAATGGGG - Intergenic
1141635627 16:85312533-85312555 GATTTAGAGCCCCGTGGATTTGG + Intergenic
1146372917 17:32276429-32276451 TATTTACAGCCCCGTAAATTAGG - Intronic
1147503055 17:40984348-40984370 GTTTTATAACCCCCCAAAATGGG + Intronic
1152857745 17:82675815-82675837 GTTTGTGACCCCCCCAAATTCGG - Intronic
1153695864 18:7640849-7640871 ATTTTAGAGCACCCTGAAGTTGG + Intronic
1156139532 18:34089966-34089988 CTTTTAGAGCTTCCTATATTAGG - Intronic
1158079349 18:53570850-53570872 ATTTTAAAGCTCCCTAAGTTTGG + Intergenic
1159031404 18:63236326-63236348 TTTTAGGAGCCCCCTAAAGTAGG + Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
929343309 2:40849709-40849731 TTTTAAGAACCCACTAAATTTGG - Intergenic
929907289 2:46057344-46057366 GTATTAAAGAGCCCTAAATTTGG - Intronic
931504818 2:62913456-62913478 GTTTTACATCCCCCAAAATGTGG + Intronic
932389268 2:71371034-71371056 GTTTTAGAGCCCACAAATTGTGG + Intronic
934964652 2:98710111-98710133 GTTTTAGAGACTTCAAAATTTGG - Intronic
937430734 2:121835970-121835992 GCTTTAGAGCCCCATAAAAATGG + Intergenic
937495355 2:122413463-122413485 GTTTTTGAGCCCCCCAAAGGGGG - Intergenic
939792653 2:146598794-146598816 GTTTTCTAGCTCCCCAAATTTGG - Intergenic
1170019203 20:11817049-11817071 GTTTTTGAGAACCCAAAATTAGG - Intergenic
1172218734 20:33257168-33257190 ATTTTAAAACTCCCTAAATTTGG + Intergenic
1173188337 20:40858061-40858083 GTTTCTGAGCCCCCTGAAGTCGG + Intergenic
1173476655 20:43364461-43364483 GCTTAAGAGCCTCCTCAATTAGG - Intergenic
1174929789 20:54800555-54800577 GGTTTAGAGCGCACTAAAATTGG + Intergenic
1175506126 20:59485631-59485653 GTTTCAGAGCCCCTGAAATATGG - Intergenic
1181821412 22:25478700-25478722 GTTTTTGAGCTGTCTAAATTGGG + Intergenic
951491713 3:23277625-23277647 AATTTATAGCCCCCTAATTTAGG - Intronic
953197636 3:40749506-40749528 CTTTTAGAGACCCCAAAAATAGG - Intergenic
954942464 3:54387016-54387038 GATTTAACTCCCCCTAAATTGGG - Intronic
964150076 3:153513399-153513421 GTTTCAGAGCTTCCTAACTTGGG - Intergenic
968311752 3:197689399-197689421 ATTTTAAAGCCCCCAAAATGGGG + Intronic
971342468 4:25783166-25783188 GTTCCAGAGCACCCTAAAATGGG - Intronic
972055969 4:34804270-34804292 ATATTAGAGGTCCCTAAATTAGG - Intergenic
975375504 4:73639332-73639354 GTCATAGTGCCCCCAAAATTTGG - Intergenic
976048448 4:80981710-80981732 GTTTTACCGTCCCCCAAATTGGG + Intergenic
980131100 4:128816715-128816737 GTTTTAGAGTAACCAAAATTTGG - Intronic
982724690 4:158893263-158893285 GCTTTAGAGCCCCATAACCTGGG + Exonic
986199115 5:5565383-5565405 ATTTTGGAGCCTCCTTAATTAGG + Intergenic
992888597 5:81183531-81183553 TTTTTAGAACCCCCTAAAAATGG - Intronic
994415532 5:99465025-99465047 GGTTTAGACTTCCCTAAATTGGG + Intergenic
994827816 5:104738302-104738324 GTTTAAGAGAACCTTAAATTTGG + Intergenic
996922056 5:128779736-128779758 GTTTTAGAGACGCCCAAGTTTGG - Intronic
998037850 5:138931944-138931966 GTTTTAGAGGCTCCCAGATTAGG - Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
999884960 5:155911936-155911958 GTTTTCCAGCCTCCCAAATTGGG - Intronic
1001244009 5:170092255-170092277 GATTTAGAGCACCCTAATTCAGG + Intergenic
1003684638 6:8289724-8289746 ATTTTAGAGCTCCCTTGATTTGG + Intergenic
1016447160 6:144146169-144146191 GGTTTAGAGCTCTGTAAATTAGG + Intergenic
1022057452 7:26753574-26753596 GTTTTAATGACCCCAAAATTAGG - Intronic
1022182892 7:27939472-27939494 GTTTTAGAGGCCCCTGGATCTGG + Intronic
1027502580 7:78971705-78971727 GTATTTGATCCCCCAAAATTTGG - Intronic
1028162658 7:87503615-87503637 GTTTGAGAGCCACCTTAATGTGG + Exonic
1030462514 7:109858254-109858276 GCTTTAAAGCCACTTAAATTTGG - Intergenic
1032519047 7:132528807-132528829 GTTTTAGAGCCGCCCAACTTGGG + Intronic
1037243138 8:16800877-16800899 CTTTTAGAGCCACTTGAATTTGG - Intergenic
1041787846 8:61655470-61655492 GTTTGAGAGCCTGCTAAAGTGGG - Intronic
1043394838 8:79826252-79826274 GTTTTAGATTCCCCTAGATTAGG - Intergenic
1044364873 8:91333069-91333091 ATTTTAAAGAACCCTAAATTAGG - Intronic
1050900582 9:10943091-10943113 TTTGAAGAGCCCCTTAAATTTGG - Intergenic
1052655160 9:31349720-31349742 GTTTGTGAGCTCCCTAACTTAGG + Intergenic
1187261521 X:17688888-17688910 GTTTTAGAGCCCCCTAAATTGGG + Intronic
1191109425 X:56793418-56793440 GTCCTAGGGTCCCCTAAATTTGG + Intergenic
1192094933 X:68200564-68200586 CTTTCAGAGCCACCTCAATTGGG + Intronic
1196693881 X:118590494-118590516 GTCGAAGAGCCCCTTAAATTGGG - Intronic
1197405877 X:126049370-126049392 CTTTTTGAGTGCCCTAAATTCGG + Intergenic