ID: 1187262661

View in Genome Browser
Species Human (GRCh38)
Location X:17701608-17701630
Sequence TGTGAGTTACTGGGAAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187262654_1187262661 9 Left 1187262654 X:17701576-17701598 CCTAGGGATTGGGCAACAGAAGG 0: 1
1: 0
2: 4
3: 12
4: 189
Right 1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG 0: 1
1: 0
2: 4
3: 21
4: 235
1187262652_1187262661 19 Left 1187262652 X:17701566-17701588 CCTGGGGGTGCCTAGGGATTGGG 0: 1
1: 0
2: 1
3: 23
4: 194
Right 1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG 0: 1
1: 0
2: 4
3: 21
4: 235
1187262648_1187262661 30 Left 1187262648 X:17701555-17701577 CCAGAAAAAGTCCTGGGGGTGCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG 0: 1
1: 0
2: 4
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187262661 Original CRISPR TGTGAGTTACTGGGAAGGAC TGG Intronic
900973213 1:6002751-6002773 TGGGAGGTACTGGGAGGGGCTGG + Intronic
901214956 1:7550099-7550121 GGTGAGTTTCTGGGAGGGGCTGG + Intronic
901230623 1:7640039-7640061 TGTGTGTAACTGGGAACCACGGG - Intronic
903959398 1:27047266-27047288 TGTGAGTTTATGGGAAGGCCAGG - Intergenic
908179302 1:61588405-61588427 TGGGAGTTAATGGGGAAGACAGG - Intergenic
910711925 1:90190723-90190745 TGTGTGTCACTGGGAAGGTGGGG + Intergenic
910762645 1:90749676-90749698 TGTGACTTGCTGGGAAAGCCTGG - Intergenic
911103906 1:94115371-94115393 TGGGAGTTAGTGGGAAGATCTGG + Intronic
911130189 1:94379852-94379874 TGCCAGGTACTGGGAAGGAGAGG + Intergenic
911298407 1:96145545-96145567 TGTGAGGTTCTGGGAAGCAAAGG + Intergenic
913451839 1:118997963-118997985 TGAGAGTTACTAGGGAGGACAGG - Intergenic
917598787 1:176555393-176555415 TGTGGGTTCCTGGGAAGATCGGG - Exonic
917700482 1:177575635-177575657 TGGGAGATACTGAGAAGTACTGG + Intergenic
918740529 1:188125354-188125376 TTTGAGTTAATAGGAAGTACTGG - Intergenic
920213111 1:204343037-204343059 TCTGAGTTAGAGGGAAGGTCAGG - Intronic
920815354 1:209326049-209326071 AGTGAGTTCCTGGGATAGACTGG - Intergenic
921317174 1:213903592-213903614 TGTGAGTTAATGAGGAGGTCAGG - Intergenic
922566125 1:226602708-226602730 TGTGTTTTCCTGGGAAGGAGAGG + Exonic
922595257 1:226808509-226808531 AGTGAGGTAATGGGAAGCACTGG + Intergenic
923675748 1:236079555-236079577 TGTGAGTTACTGTGAAGGGGTGG - Intergenic
1062840399 10:666103-666125 TGTGAGTTCGTGGGAAAGAAGGG + Intronic
1063867604 10:10382617-10382639 TCTAAGTTGCTGGGAATGACAGG - Intergenic
1065481207 10:26195620-26195642 TGCAGGTTACTGGGAAGGAAGGG - Intronic
1066055308 10:31675135-31675157 TGTGAGTTATTATGAAGTACTGG + Intergenic
1069547969 10:69342290-69342312 TGTGAGGCACTGGGGAGGTCAGG + Intronic
1071393063 10:85194851-85194873 TATGAGTTGCTGGGGAGGATGGG + Intergenic
1076370591 10:129950240-129950262 AGTGAATTACTGGGAAGGCGCGG + Intronic
1076433164 10:130421867-130421889 TGTGAGTGACTGGGAACCTCAGG - Intergenic
1076661730 10:132059899-132059921 TCTGGGTTGCTGGAAAGGACAGG + Intergenic
1077353939 11:2106053-2106075 AGGGAGTGACTGGGAGGGACTGG - Intergenic
1077435508 11:2536928-2536950 TGTGAGGTAAAGGGAGGGACTGG - Intronic
1078517382 11:12034494-12034516 TCTGAGTTACTTTGAAGAACTGG - Intergenic
1081052421 11:38360870-38360892 TGTAAGTAAATGGGAAGGACAGG + Intergenic
1082771492 11:57211074-57211096 TGTGAGTTAAATGGATGGACAGG + Intergenic
1083655145 11:64225920-64225942 TGTGACTTTCTGGGAGGGATGGG - Intronic
1083685753 11:64374036-64374058 TGTGAGTTACATGGAATGAGAGG - Intergenic
1084402966 11:68955893-68955915 TGTGTGTGGCTGGGAAGGAGGGG - Intergenic
1089574502 11:119431958-119431980 TGGGGGTCACTGGGAAGCACTGG + Intergenic
1091408884 12:226366-226388 TGAGTGTTACTGGGGAGGCCTGG - Intronic
1091529372 12:1339730-1339752 TGTGGGTTACTGGTGGGGACAGG + Intronic
1092786484 12:12031520-12031542 GGTGAGTGAATGTGAAGGACTGG + Intergenic
1093021456 12:14207743-14207765 AGTGAGTTACTGGGGAGTAACGG + Intergenic
1093504719 12:19851951-19851973 TGTTTGTTACTGGGAAGTGCAGG - Intergenic
1098188260 12:67921471-67921493 TGTGAGTAACTGGGGATGATTGG + Intergenic
1098280120 12:68854235-68854257 AGGCAGTTTCTGGGAAGGACTGG + Exonic
1098796611 12:74896376-74896398 GGTGAGTGAATGTGAAGGACTGG + Intergenic
1101272657 12:103163942-103163964 TGTGACTTATTAGTAAGGACTGG - Intronic
1101415009 12:104501276-104501298 TGGGAGTTCCTGGGAGGGACAGG + Intronic
1101450119 12:104768351-104768373 TGTCATTTACTCTGAAGGACTGG + Intergenic
1104658201 12:130590004-130590026 AGTGAGTTTCTGGGAGGGATTGG + Intronic
1105876896 13:24563813-24563835 TGTGAGTGAATGGCAAGTACAGG + Intergenic
1106352455 13:28946350-28946372 TGTGAGTTCCTGCTAAGGAGTGG + Intronic
1106359678 13:29019037-29019059 TGTAGGTTACTGTGTAGGACCGG + Intronic
1106487821 13:30188169-30188191 TGTGGGTTACTGGGTGGGCCTGG + Intergenic
1107986004 13:45776744-45776766 TGTTAGTTACTGGCAAGATCAGG - Intergenic
1108116223 13:47130885-47130907 TGTGAGGTTCTGAGAAGGAAGGG - Intergenic
1108617205 13:52145266-52145288 TGGCAGTTTCTGGGAAGGGCTGG - Intronic
1109592194 13:64500057-64500079 TGTAAGTTACTGGGAAGTAAGGG + Intergenic
1110514153 13:76389090-76389112 TGTGAGTGAGTGAGAAGGAGAGG - Intergenic
1113574968 13:111388976-111388998 TGTGAGTAGCTGTGAAGGGCTGG + Intergenic
1116069862 14:40030145-40030167 TGTCATTTACTTGGAAGGAGTGG + Intergenic
1118056667 14:62086185-62086207 TGTGAGTTACTGGCTAGGCACGG + Intronic
1119272815 14:73324687-73324709 TTTCAGTCAGTGGGAAGGACAGG - Intronic
1119662246 14:76460295-76460317 TGTGAGATACAGGGTGGGACAGG + Intronic
1120164752 14:81185575-81185597 TGTGAGTGATGAGGAAGGACAGG - Exonic
1121441696 14:93953755-93953777 TGTGAGTTCGAGGAAAGGACAGG - Intronic
1121864586 14:97350770-97350792 TGTTAGTCACTGGGAAGGCAGGG + Intergenic
1123754284 15:23384833-23384855 AGTGTGTGACTGGGAAGGCCAGG + Intergenic
1124823380 15:33069350-33069372 AGTGAGTGCCTGGGATGGACAGG + Intronic
1125013441 15:34906056-34906078 TGTTAGATATTGGAAAGGACAGG - Intronic
1125701346 15:41687880-41687902 TGTCAGTTACTGAGAAAGATGGG + Intronic
1126859032 15:52866214-52866236 TCTGAGATACTGGGAAAGGCTGG - Intergenic
1127217247 15:56836274-56836296 TTTGAGTAACTGGGAAGTTCGGG - Intronic
1128515899 15:68341778-68341800 TGTGATGTACTGAGAAGGGCTGG + Intronic
1129076271 15:72999056-72999078 TGTGGGTGACTGGGAAGTGCTGG + Intergenic
1130103527 15:80912110-80912132 TGGGAGAGACTGGGAAAGACTGG + Intronic
1130262979 15:82373892-82373914 TGTGAGTTACAGGTTGGGACTGG + Intergenic
1131172131 15:90185867-90185889 AGTGAGTTAGTGGGAAGGTCAGG + Intronic
1131809775 15:96160862-96160884 TGAAAGTTGCTGGGAAGGAGTGG - Intergenic
1131874359 15:96788973-96788995 TGTGAGTTCGAGGGCAGGACTGG + Intergenic
1132438335 15:101832002-101832024 TTTGAGGCACTAGGAAGGACAGG + Intergenic
1132809105 16:1789238-1789260 TGTAAGTTTCTGGGCTGGACTGG + Intronic
1133308096 16:4824044-4824066 TTTGTGTTAATGGGAAGAACTGG - Intronic
1133643603 16:7741713-7741735 TGTTAGTTTCAGGGAAGGAGTGG + Intergenic
1133767689 16:8849210-8849232 TGTGAGTCACTGGGATGAGCTGG - Exonic
1134172251 16:11977414-11977436 AGTGGGTAACTGGGAAGAACTGG - Intronic
1135201635 16:20442481-20442503 TCTGAGGTACTGGGAGGAACTGG + Intergenic
1135217473 16:20585385-20585407 TCTGAGGTACTGGGAGGAACTGG - Intergenic
1135379175 16:21979676-21979698 GGTGAGTAAATGGGAAGGGCTGG + Intronic
1136929338 16:34405154-34405176 TTTCAGTTACTGTGAAAGACCGG + Intergenic
1136975236 16:35006651-35006673 TTTCAGTTACTGTGAAAGACCGG - Intergenic
1137727723 16:50668272-50668294 TTTGATTTACTCAGAAGGACTGG - Intronic
1137833620 16:51569216-51569238 TGTCAGTTACTGGTAAGTACTGG + Intergenic
1140224890 16:73069086-73069108 TGTGTGTAACTGGGCAGGACTGG + Intergenic
1141141538 16:81499802-81499824 TGCGAGTTGCTGGGCAGGACCGG - Intronic
1142437065 16:90067087-90067109 TGTGAGTTGTTGGGAACTACAGG + Intronic
1143272800 17:5688375-5688397 TGTGGGGTACTGAGCAGGACCGG + Intergenic
1146430801 17:32792583-32792605 TGTGTGTTCCTGAGATGGACAGG + Intronic
1146466506 17:33090679-33090701 AGAGAGTCACTGGGAAGGAAGGG + Intronic
1147036581 17:37686135-37686157 TGTGAGTTGCAGGGAAGAAAAGG + Intergenic
1147040610 17:37715684-37715706 TGTGAGTTACTGTGAAGCAGTGG - Intronic
1153092388 18:1362886-1362908 TATGAGTCTCTGGGATGGACTGG - Intergenic
1153848816 18:9073863-9073885 TGTGAATTACTGGGGAGTCCTGG - Intergenic
1155477544 18:26249363-26249385 TGTGAGCTACTTGGGAGGAGAGG + Intronic
1156816670 18:41319801-41319823 TGTGAGTTACTGGAAAAGACTGG - Intergenic
1157573219 18:48726860-48726882 TGTGAGTCACTGGGAATGAGAGG - Intronic
1158263695 18:55636820-55636842 TGTGAGATACTGAGAAGAACAGG + Intronic
1158614577 18:58974775-58974797 TGTGAGTTACTGTGAAGTGGGGG - Intronic
1159507145 18:69352844-69352866 TGATAGTTACTGTGACGGACTGG + Intergenic
1160056602 18:75488234-75488256 TCTGCGTTACTGGGAATGAATGG - Intergenic
1160528901 18:79552388-79552410 TGTGAGTTTCTGGGAGACACAGG + Intergenic
1163391381 19:17032820-17032842 TGTGAGTTACTGTGAAGGTCTGG - Intergenic
1164769735 19:30799358-30799380 GGTGGGTTATTGGGAAGGGCAGG + Intergenic
1164797110 19:31042180-31042202 TGTGGGGTACTGGCAAGTACTGG + Intergenic
1165654353 19:37520338-37520360 TGTGAGTGCCTGGGCAGGCCAGG + Intronic
1166742780 19:45124303-45124325 TGTGAGGTGCTGGGAAGCACCGG + Intronic
1167856783 19:52248400-52248422 TGTGAGTTACTGGCTAGGGTTGG - Intergenic
1168232756 19:55043701-55043723 TTTGAGATACTGGGGAGGCCAGG - Intronic
925630140 2:5883621-5883643 GGTGAGTGAATGGGAAGGCCTGG - Intergenic
926188336 2:10708853-10708875 TGTGAGTTAAGGGGAAGGTGTGG + Intergenic
928220375 2:29398293-29398315 TGTAATTTTCTGGAAAGGACAGG + Intronic
929299196 2:40282745-40282767 TCTCTGTTACTGGGCAGGACTGG - Intronic
931612035 2:64111387-64111409 TGTGTGTTAGTGTGAATGACTGG - Intronic
939418243 2:141929262-141929284 TGTTATTTCCTGGGAAGGAATGG - Intronic
941413011 2:165183915-165183937 TGTGAGTTGCTGTGAAGGACTGG + Intronic
941697514 2:168569393-168569415 AGTGAGTTACTGTGAAGTGCTGG + Intronic
945655571 2:212618938-212618960 TGTAAGCTGCTTGGAAGGACAGG - Intergenic
945965178 2:216179397-216179419 TGTGAGGTTTTGGTAAGGACAGG + Intronic
945989776 2:216385802-216385824 GGGGAATTGCTGGGAAGGACAGG - Intergenic
946273775 2:218615451-218615473 TGTGGGTTATTGGGTAGGAAGGG + Intronic
947527598 2:230888579-230888601 GGTGAGTGAATGGGAAGGCCTGG - Intergenic
948620064 2:239228642-239228664 GATGAGATATTGGGAAGGACTGG + Intronic
948968060 2:241400185-241400207 TGTGAGTCAATGGGGAGGTCAGG - Intronic
1169250948 20:4060858-4060880 TCTGAGGTCCTGGGAAGGATAGG + Intergenic
1170913068 20:20594035-20594057 CGTGATTTAGTGGGAAGGAAGGG + Intronic
1171178595 20:23074592-23074614 TGTGGTTCACTGGGAAGCACAGG - Intergenic
1177455190 21:21328843-21328865 GGTGAGTGACTGTGAAGGCCTGG - Intronic
1180594191 22:16962914-16962936 TGTGAGTTCCTGGTGAGGAAGGG + Intronic
1182243450 22:28935843-28935865 TCTGAGTTAGTGGGATGGTCGGG - Intronic
1182651734 22:31857245-31857267 TCTGATTTACTGTGGAGGACTGG + Intronic
1182744961 22:32598373-32598395 AGTGAGTTGCTGGGAAGGGGTGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184803739 22:46778168-46778190 GGTGAGTGAATGGGAAGGTCTGG + Intronic
950408928 3:12821793-12821815 TGTGATGCACTGGGAAGGGCAGG - Intronic
951022258 3:17793619-17793641 TCTGAGTTGCAGGGATGGACTGG + Intronic
952531803 3:34270640-34270662 TCTGTGATACTGGGAAGGAAGGG + Intergenic
953889699 3:46742891-46742913 TGTGAGTTTCTGGGAGGTTCTGG - Exonic
953994817 3:47511838-47511860 TGTCAGTGACAGGGAAGGTCAGG + Intronic
957507689 3:81145460-81145482 TGTGAGTGACTGAGAAGAAAGGG - Intergenic
959154859 3:102654451-102654473 TCTGAGTTAATGGCATGGACAGG + Intergenic
961175229 3:124829966-124829988 TCTCAGTGACTGGGAAGGGCTGG - Intronic
962911408 3:139854645-139854667 AGTGTGTTACTTGGAAAGACTGG + Intergenic
963406595 3:144871558-144871580 TGTGAGTTCCTGGGATAGAGAGG + Intergenic
964299130 3:155268466-155268488 TGTGATTTTCTTGGAAGGGCAGG - Intergenic
964716134 3:159724310-159724332 TGTGAGTTAGGAGGAAGGGCAGG + Intronic
967084629 3:186082891-186082913 AGTGACTGACTGGAAAGGACAGG + Intronic
967840387 3:194000608-194000630 TGTGAGTTCCTGGAGAGCACTGG - Intergenic
968799286 4:2731673-2731695 AGTGAGTTTCTGGCAAGAACAGG + Intronic
968806568 4:2776903-2776925 GGTTAGTAACTGGAAAGGACAGG - Intergenic
970104812 4:12569579-12569601 TTTGAGGTCCTGGGAAGGGCTGG + Intergenic
970823426 4:20246799-20246821 TCTGGGTTACTTGGAAGGAAAGG - Intergenic
975425345 4:74219194-74219216 TGTCAGTATCTGGGAGGGACTGG - Intronic
977088045 4:92629793-92629815 TGTTCTTTACTGGGAAGAACAGG + Intronic
979207372 4:118054987-118055009 TGGGATTTACTGGGAAAGTCTGG + Intronic
980524257 4:133969009-133969031 TGTTATTAACTGGGAAGTACAGG + Intergenic
981107206 4:140894630-140894652 TGTTTGCTACTGGGAAGCACTGG - Intronic
982263886 4:153520841-153520863 AATTAGTTAATGGGAAGGACTGG + Intronic
982456408 4:155614407-155614429 TGGGATTTGCTTGGAAGGACAGG + Intergenic
982625484 4:157760725-157760747 TGTGAGTGACTGTGGAGGAGTGG - Intergenic
984037281 4:174685135-174685157 TGTGAGTGACTGGAAACAACTGG + Intronic
984243850 4:177250878-177250900 TGTGTGTTACTAGGAAGAAAAGG - Intergenic
984515572 4:180734607-180734629 TCTGAGTTACTGTGAAGTAGTGG + Intergenic
984645331 4:182213117-182213139 TGCCAGTTACTGGGAAGATCTGG - Intronic
985637427 5:1044528-1044550 GGTGAGTTACTGTGAATGAATGG + Intergenic
986029086 5:3878799-3878821 GGTGAGTTACTGGAAAAGAAAGG - Intergenic
986041518 5:3998584-3998606 TGTGAGTCCTTGGGGAGGACAGG - Intergenic
986570327 5:9157497-9157519 TGTGGGTGACAGGGAAGGAGAGG - Intronic
986741887 5:10711968-10711990 AATGTGTTGCTGGGAAGGACGGG - Intronic
987694526 5:21310941-21310963 TTTAAGTTTCTGGGAAGGAATGG + Intergenic
987863985 5:23517660-23517682 TGTGAGTTGTTGGGAACTACAGG - Intronic
991745714 5:69738530-69738552 TTTAAGTTTCTGGGAAGGAATGG - Intergenic
991751992 5:69816703-69816725 TTTAAGTTTCTGGGAAGGAATGG + Intergenic
991797314 5:70318487-70318509 TTTAAGTTTCTGGGAAGGAATGG - Intergenic
991825092 5:70613844-70613866 TTTAAGTTTCTGGGAAGGAATGG - Intergenic
991831279 5:70691605-70691627 TTTAAGTTTCTGGGAAGGAATGG + Intergenic
991889659 5:71317815-71317837 TTTAAGTTTCTGGGAAGGAATGG - Intergenic
992137075 5:73757534-73757556 TGAGAGTTATTAGGAAGGACTGG + Intronic
992402348 5:76423267-76423289 TGTGAGTTACTGGGGTTGGCTGG + Intronic
994310486 5:98263645-98263667 TGTGAGTAAATGGGAAGGCCTGG + Intergenic
994955313 5:106523580-106523602 TGTGAGTTATTGTGAAATACAGG - Intergenic
995511165 5:112910812-112910834 TGTGGGTGAGTAGGAAGGACTGG - Intronic
996519751 5:124413663-124413685 TGTAAGTAACAGGGAAGCACTGG + Intergenic
997863653 5:137442347-137442369 AGAGAGTAACTGGGAAGGCCAGG + Intronic
999553843 5:152720155-152720177 TGTGAGTTACAGGTCAGGACTGG - Intergenic
1000823746 5:166017585-166017607 TGTGAGTTACTAAGTAGGAGGGG - Intergenic
1001452529 5:171837424-171837446 TGTGAGTTTCTGGTCAGGATGGG - Intergenic
1004578521 6:16923980-16924002 GGTGAGTGAATGGGAAGGCCTGG + Intergenic
1005556377 6:26988997-26989019 TTTAAGTTTCTGGGAAGGAATGG - Intergenic
1005636091 6:27754559-27754581 TGAGAGTTTCTGGGAAGAAAGGG - Intergenic
1005881761 6:30067516-30067538 TGGGAGATACTGGGAGGGAGGGG + Intronic
1006372851 6:33656187-33656209 TGTGAATTGCTGTGAAGGAGGGG + Intronic
1006838991 6:37016036-37016058 TGTGGGAAGCTGGGAAGGACAGG - Intronic
1007254686 6:40520560-40520582 TGGGAGTTATAGGAAAGGACAGG - Intronic
1007478809 6:42136722-42136744 TGGGACTTGCTGGGAAAGACTGG - Intronic
1007832237 6:44647411-44647433 TGAGTGTTACTGGAAGGGACAGG + Intergenic
1009568099 6:65340207-65340229 TATGAGTTACTGGGAAGGGAAGG - Intronic
1010034629 6:71310556-71310578 TGTGAGTTTCTTGGAAGGATTGG + Intergenic
1012550498 6:100461018-100461040 TGTGAGTTTATGGGGAGGAGGGG - Intronic
1013919036 6:115378397-115378419 TGTTAGGTCCTGGGAAGGATGGG - Intergenic
1016326119 6:142903648-142903670 TGTGAATTAATGGGAACCACCGG - Intronic
1016665429 6:146633953-146633975 TGAGAGTGACTGTGAAGGCCTGG - Intronic
1018267895 6:162044708-162044730 TGTGAGGTACAGGAAATGACAGG - Intronic
1018294205 6:162328444-162328466 TTTGAATTACTGTGAAGGAAAGG - Intronic
1018369177 6:163151376-163151398 TGTGTGTTGCTGGGGAGGGCAGG - Intronic
1018841477 6:167520449-167520471 TCTGTGTTGCTGTGAAGGACAGG + Intergenic
1020441363 7:8220530-8220552 TGTTAGTTACTGGGAGAGAAGGG + Intronic
1020739142 7:11990734-11990756 TGTGAGTGACTGATAGGGACAGG - Intergenic
1022337225 7:29433325-29433347 TGTGTAGAACTGGGAAGGACTGG + Intronic
1023865635 7:44236957-44236979 TGTGTGTTTCTGGAAGGGACTGG - Intronic
1024200201 7:47098510-47098532 TCTGAGTAACTGGGAATTACAGG - Intergenic
1024483783 7:49893340-49893362 TGGGAGTCACTGAGAAAGACAGG + Intronic
1027532986 7:79358648-79358670 TGAGAGTTAGGGGGAAGCACTGG + Intronic
1029432385 7:100539567-100539589 TGTGAGTGACCGGGAGGGAGTGG + Exonic
1030903468 7:115152719-115152741 GGTGAGTTACAGGAAAGTACTGG - Intergenic
1031183835 7:118450500-118450522 TTTGAGGTTCTGGGAAGGATGGG + Intergenic
1031374387 7:121006466-121006488 TGTGAGTGTCTGAGAAAGACAGG + Intronic
1032096747 7:128942087-128942109 TGGGAGCCACTGGGATGGACTGG - Exonic
1033543281 7:142376513-142376535 GGAGAGTTACTGGGAAAGGCCGG + Intergenic
1034652728 7:152704672-152704694 TGTGAACTACTGGTTAGGACTGG - Intergenic
1034773241 7:153800258-153800280 TGTGTGTTTCTGGAAATGACAGG - Intergenic
1035938938 8:3874754-3874776 TGTCTGTGACGGGGAAGGACAGG + Intronic
1036046052 8:5141911-5141933 GGTGAGTTAGTGAGAAGAACGGG - Intergenic
1036078728 8:5528989-5529011 AGTGAGTGATTGGGAAGGAAAGG + Intergenic
1037276708 8:17188220-17188242 TGTGGGGTTCTGGGAAGGAAAGG - Intronic
1038854153 8:31313239-31313261 TGAGAGTTAATGGCAAGGAGTGG + Intergenic
1038999893 8:32968084-32968106 TGTGATTTACTCTGAAGGTCTGG + Intergenic
1039129159 8:34242057-34242079 TGTGTGTGACTGAGAAGGAGGGG + Intergenic
1041751346 8:61264432-61264454 TGTAAGCTACTGGGGAGGTCAGG - Intronic
1042091790 8:65166562-65166584 TGTGGGTCAGTGGGAAGGAGGGG - Intergenic
1047055293 8:121157508-121157530 TGTGAGTGAATGGGAAGCAAGGG + Intergenic
1047619374 8:126590722-126590744 TGTAAGTTACTGGGAAGATTTGG + Intergenic
1048595967 8:135866560-135866582 CCTGGGTTCCTGGGAAGGACAGG + Intergenic
1049832486 8:144710911-144710933 TGTGAGGACCCGGGAAGGACTGG + Intergenic
1051677918 9:19577229-19577251 TGTGAGCAACTGGGAAGGGAGGG - Intronic
1056839671 9:89988299-89988321 TGTGAGCCACTGGGAAGGCTTGG - Intergenic
1058705296 9:107632924-107632946 TGTGAGTTGTTGGGGAAGACTGG + Intergenic
1059799748 9:117738211-117738233 TGGAAGCTACTTGGAAGGACTGG + Intergenic
1060553537 9:124496869-124496891 CGTCACTTACTGCGAAGGACAGG - Intronic
1062294149 9:135814742-135814764 TCTGATCTACTGGGAAGGGCAGG + Intronic
1186884580 X:13900393-13900415 GGTGAGTTACTGGGAAGGGCTGG + Intronic
1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG + Intronic
1187855276 X:23630940-23630962 TGTGAGGTAATGGGAAGTAGGGG + Intergenic
1189144722 X:38643910-38643932 TGAGAGATAATGGGAAGGAGGGG + Intronic
1189965721 X:46370843-46370865 GGTGAGTGAATGGGAAGGCCTGG + Intergenic
1190401790 X:50044283-50044305 GGTGTGTTTCTGCGAAGGACTGG + Intronic
1190620320 X:52280937-52280959 TGTGAGTTACAGGCTGGGACTGG + Intergenic
1192632762 X:72790034-72790056 TGTGAGAGACTGGGAAGTAGAGG - Intronic
1192648947 X:72930767-72930789 TGTGAGAGACTGGGAAGTAGAGG + Intronic
1195521699 X:105837951-105837973 TGTCAGTTACTGGGAGAGTCAGG - Intronic
1196573080 X:117286017-117286039 TATGAGTTATTGGGAAGAACAGG + Intergenic
1200034424 X:153318776-153318798 TCTGAGTCACTGGGAAGGGCTGG + Intergenic